k.) 1990 Oxford University Press
Nucleic Acids Research, Vol. 18, No. 10 2923
Identification of a TFIIIA binding site region of the TFIIIA gene
on
the 5' flanking
Jay S.Hanas and James F.Smith Department of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73190, USA Received January 20, 1990; Revised and Accepted April 9, 1990
ABSTRACT Xenopus transcription factor IIIA (TFIIIA) regulates 5S ribosomal RNA gene transcription in a positive manner by binding to the internal control region (ICR) of the 5S RNA gene. The present study reports the identification of a TFIIIA binding site on the 5' flanking region of the Xenopus laevis gene that codes for the synthesis of this transcription factor. This TFIIIA binding site (deduced from TFIIIA-dependent alterations in DNase I protection patterns) extends on the 5' flanking region from about nucleotide - 326 to - 264 on the non-coding strand and from - 331 to - 271 on the coding strand. The affinity of TFIIIA for the 5' flanking region of its own gene is less than that for the 5S RNA gene but within the same order of magnitude. A sequence similarity between this newly identified binding site and the 5S gene ICR is the presence of purine-rich tracts. EDTA chelation of TFIIIA inhibits binding to this 5' flanking element indicating, as with the 5S RNA gene, zinc is required for DNA binding specificity. When TFIIIA is bound to 5S RNA in the 7S particle, the protein does not bind to this 5' flanking region, an observation similar to that observed with binding to the 5S RNA gene. These results indicate TFIIIA is using similar nucleic acid binding domain(s) for interaction with the 5S gene, 5S RNA, and the 5' flanking region of its own gene. This upstream DNA region to which TFIIIA binds has been previously shown to contain a negative and a positive regulatory element for transcription of the TFIIIA gene (Scotto, K.W., Kaulen, H., and Roeder, R.G., 1989, Genes & Develop. 3, 651 - 662). The present results indicate TFIIIA binds to the negative control element located at - 306 to - 289 and possibly interacts/interferes with another transcription factor which binds to the positive control element extending from - 271 to - 253. INTRODUCTION Xenopus transcription factor IA (TFIIA) is a 40 kDa regulatory protein which specifically binds the SS RNA gene during oogenesis in Xenopus laevis and, in the presence of two additional factors, promotes transcription by RNA polymerase HI (1,2,3,4). TFIIIA requires zinc for specific DNA binding and promotion of transcription of the SS RNA gene in vitro (5). The binding
to its specific DNA site on the 5S gene ICR has a dissociation constant of about 10-9 M (6). TFIIIA also binds 5S RNA, forming a 7S particle in vivo (7,8). When TFIIIA is specifically bound to the 5S gene ICR, it influences the DNase I digestion pattern of the SS RNA gene at about nucleotides +45 to +98 on the non-coding strand and +43 to +96 on the coding strand (1,9). TFIIIA induces DNAse I hypersensitivity at the +43 region on the coding strand and at +63, +75, and +94 on the non-coding strand. The major contact points between TFIIIA and the ICR of the 5S RNA gene are located on the non-coding strand in a purine-rich tract on the 3' portion of the ICR (nucleotides 81-90, ref. 9). Protease as well as in vitro mutagenesis studies have established that TFIILA is oriented along the 5S gene with the N-terminal region
of the protein binding the 3' portion of the ICR and its C-terminal tail located near the 5' border of the ICR (10,11,12,13). The C-terminal tail of TFIIA, oriented on the ICR toward the + 1 start for transcription, is required for promotion of transcripiton of the 5S RNA gene (11). TFIIIA is present in prodigious amounts in immature oocytes (14). Understanding how this extraordinary level of expression is regulated is necessary for understanding ribosome biogenesis during oogenesis in Xenopus laevis. In addition, knowledge about the regulation of expression of eukaryotic transcription factor genes is necessary for understanding development. Because transcription initiation is a major gene regulatory step in eukaryotic cells, the identification of interactions between transacting factors and cis-acting regultory elements in the promoter regions of transcription factor genes will provide clues to their regulation. Both positive and negative cis-acting regulatory elements have been identified in the 5' flanking region of the TFIIIA gene (15,16). The present study reports the identification and characterization of a novel TFIIIA binding site on the 5' flanking region of the TFIIIA gene that overlaps the negative cis-acting regulatory element as well as one of the positive elements of this gene.
MATERIALS AND METHODS TFIIIA isolation Ovarian tissue from approximately 20 immature Xenopus laevis (4-5 cm, Nasco, WI) was homogenized in buffer A (50 mM Tris-HCl, pH 7.6, 50 mM KCI, 5 mM MgCl2, 0.2 mM phenylmethyl sulfonyl fluoride (PMSF), and 0.5 mM
WjS:a.i-es,SXr
2924 Nucleic Acids Research, Vol. 18, No. 10 dithiothreitol (DTT) and centrifuged at 6000 g for 15 min to remove cell debris. The supernatant was layered onto 10-30 % glycerol gradients (in buffer A minus the PMSF) and centrifuged 16 hrs at 34,000 rpm in a Beckman SW41 rotor. These procedures were performed at 4°C. The gradients were fractionated and assayed spectrophotometrically at A280. The 7S peak fraction (sedimenting slightly faster than hemoglobin) was further purified by ion exchange chromatograpghy on DEAE cellulose which results in a TFIHA purity in the 7S particle of 95% (6). Protein concentration was determined by the method of Bradford (17). For TFIIIA binding assays, the protein is liberated from the SS RNA in the 7S particle by extensive digestion with RNase A (6). Preparation of DNA templates The 6.5 kb EcoRI fragment containing the 5' flanking region as well as the first 4 exons and first 3 introns of the Xenopus laevis TFIIIA gene was kindly provided by J.Yun Tso and Laurence Korn (18). The BglII-PstI fragment containing sequences from -420 to +140 was subcloned between the BamH1-Pstl site of plasmid pT7-7, designated pT7-73AP (pT7-7 was kindly provided by Stanley Tabor, ref. 19). To label this TFIHA promoter fragment on the coding strand, the pT7-73AP plasmid was digested with EcoRI (site is 12 nucleotides upstream of BamHI site in polylinker) and the 5' overhang filled in using reverse transcriptase and [a32P] dATP (20). To label this fragment on the non-coding strand, the phosphate group of this 5' overhang was removed with bacterial alkaline phosphatase and labeled with [a!32P] ATP and polynucleotide kinase (20). In both cases, a 577 bp end-labeled fragment was generated by subsequent digestion with HindIIl (site located 9 bp downstream of PstI site in polylinker) and was purified by agarose gel electrophoresis. The coding strand of the Xenopus 5S RNA gene was end-labeled at an EcoRI site using reverse transcriptase and [a 32P] dATP; the 303 bp fragment containing the 120 bp SS RNA gene was subsequently isolated by agarose gel electrophoresis (20). The specific activities of the end-labeled DNA fragments (cpm/[DNA]) were determined by scintillation counting and absorbance at 260 nm (20). TFIIIA-DNA interactions DNase I footprinting (21) was used to examine the interaction of TFIIIA with the 5' flanking region of the Xenopus TFIIIA gene or with the Xenopus 5S RNA gene. Reactions (25 1d) contained template DNAs at a final concentration of 1 x 10-9 M (about 10,000 cpm) in 20 mM Tris-HCl, pH 7.5, 70 mM NH4Cl, 7 mM MgCl2, 0.5 mM DTT, 0.01 % Nonidet P-40. Purified TFIIIA-containing 7S particles (20 ytg/ml protein in 20 mM Tris-HCl, pH 7.5, 320 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT) were predigested with 10 p4g/ml RNase A for 30 min at 23°C. TFIIIA (final concentrations used are indicated in the Fig. legends) was incubated with template DNA in the footprinting reactions for 15 min at 23°C and then DNase I was added to a final concentration of 1 ,tg/ml for 1 min. DNase I was quenched by addition of 100 /tl of 10 mM Tris-HCl, pH 7.5, 0.2% SDS, 1 mM EDTA, 30 ytg/ml sonicated salmon sperm DNA. DNA was then ethanol precipitated, electrophoresed on DNA sequencing gels, and autoradiographed as described (20). The DNA sequence of the DNase I digestion pattern of the endlabeled (coding or non-coding strand), 557 bp promoter fragment of the TFIHA gene was determined by chemically sequencing the respective end-labeled fragments (22) and electrophoresing the sequencing ladders in adjacent lanes.
.
...
:. ..
*.:
*,:'' "i3Bm''
_
0
M
......
*:e'
*
_
..: ..
ijSj
.I:
_
..:.
.
...
.:.
::ii!;sE.'jl{t
....
.... .:.
:.
:.
:.!::'b$::
(G) (T) 2 8 2 I(C) 64
.2 7
(
::
*
.giffik
i6"
F._am
:..
..
- 295
- - 3 09 3 --3 1 0 -3 16 --3 2 2
326 5,
(A) ( -r) (C) (C) (T) (A)
...... :'
...
Fig. 1. Interaction of TFEIIA with the non-coding strand of the 5' flanking region of the TFIIIA gene. TFIIIA isolation, DNA template preparation, DNase I footprinting, and acrylamide gel electrophoresis were performed as described in the METHODS. Footprinting reactions electrophoresed in lanes 1-4 contained l x 10-9 M DNA and 0, 0.25, 0.5, lOX10-8 M TFH_IA respectively. The nucleotide sequence markers aligned with specific bands lane 4 were obtained by chemically sequencing (ref. 22) the end-labeled fragment and are numbered relative to the presumed + 1 site for transcription initiation (16). Gel autoradiography was performed overnight with an intensifying screen.
RESULTS Interaction of TFIIIA with the 5' flanking region TFIIIA gene
of the
Since many autoregulatory phenomena exist in biological systems, it did not seem unreasonable to ask whether TFIItA could interact with the 5' flanking/promoter region of its own gene. To test initially whether TFIIIA could bind this DNA region, a gel retardation assay was performed with a 577 bp fragment
Nucleic Acids Research, Vol. 18, No. 10 2925 I9
3
(j
1
8
496 5' -271
+- 4 3
4Im
(T)
VW
"V :%.: -zzz.zX "I'll,:6 .II "6 An't
-:.:
-295 (T)
-303 (A) -
-
3 1 3 (G) 3 1 9 (G)
-325 (G) -3 3 1 (G) 3'
Fig. 2. Interaction of TFIILA with the coding strand of the 5' flanking region of the TFIILA gene. TFIIIA isolation, preparation of DNA templates (5S gene and TFIIIA 5' flanking region), DNase I footprinting, and gel electrophoresis were performed as described in METHODS. Footprinting reactions electrophoresed in lanes 1-4 contained 1 x 10-9 M Xenopus SS RNA gene (endlabeled on the coding strand) and 0, 0.5, 1.0, 2.0x 10-8 M TFIIIA respectively. The nucleotide markers aligned with lane 1 are from ref. 9. Reactions electrophoresed in lanes 5-8 contained 1 x 10-9 M of the 5' flanking template (577 bp, end-labeled on coding strand) and the same TFIILA concentrations as in lanes 1-4. The nucleotide sequence markers aligned with bands in lane 8 was obtained by chemically sequencing this end-labeled fragment and are relative to the + 1 site for transcription initiation.
containing the 5'flanking/promoter region of the TFIIIA gene (-420 to + 140, ref. 18). At a protein concentration of 1 x 10-8 M, a small but complete band shift was observed indicating binding of TFIIIA to this DNA fragment (gel not shown). To better examine the specificity and binding site(s) of TFIIIA on this 577 bp DNA fragment, DNase I footprinting experiments were performed with TFIIIA and this DNA template end-labeled
on its non-coding or coding strand. Fig. 1 exhibits the DNase I digestion pattern of the 577 bp fragment containing the 5' flanking region of the Xenopus laevis TFIIIA gene (end-labeled on the non-coding strand) in the presence of increasing concentrations of TFIIA (lanes 2-4); lane 1 exhibits the DNase I digestion pattern of this fragment in the absence of TFIIIA. In the presence of 1 x 10-8 M TFIIA (lane 4), a distinct DNase I digestion pattern is observed on the 5' flanking region from about nucleotide -326 (A) to -264 (G). A distinct region of TFIHA-dependent DNase I protection is observed between nucleotides -310 (C) and -282 (C) on the non-coding strand, especially from -303 (T) to -295 (A). Other characteristics of the TFUIA-dependent footprint pattern on the non- coding strand include DNase I protection at -326 (A) and 316 (C), from -282 (C) toward -270 (T), and from -270 (T) to -264 (G). Slight TFIIA-dependent DNase I hypersensitivity is observed at -322 (T), -282 (C), and -270 (T). Details of this interaction are also given in Fig. 5. A distinct pattern/region of TFIIIA-dependent, DNase I protection/enhancement was not observed in other regions of this fragment when the digestion products were electrophoresed for longer or shorter periods of time. Lanes 6-8 in Fig. 2 illustrate the DNase I digestion patterns of the 577 bp fragment (end-labeled on the coding strand) in the presence of increasing concentrations of TFIIIA (0.5, 1.0, 2.0x 10-8 M; reaction in lane 5 contained no TFIIIA). In lanes 7 and 8, a distinct TFIIIA-dependent DNase I digestion pattern (relative to lane 5) is observed from about nucleotide -331 (G) to -271 (T) of the coding strand. A major region of DNase I protection is observed between nucleotide -303 (A) and 271 (T). Within this protected region, a strong TFIIIA-dependent DNase I hypersensitive site is apparent around nucleotide -281 (A). Also apparent in these lanes is TFIIIA-dependent protection between nucleotides -303 (A) and -313 (G), and protections at nucleotides -331 (G) and 319 (G). Slight DNase I hypersensitivity is observed at nucleotide -325 (G) and -271 (T). As with the end-labeled non-coding strand, electrophoresis of this pattern for longer or shorter times did not reveal any other significant regions of TFIIIA interaction. Because the patterns are the same in lanes 7 and 8, saturation of TFIIIA binding is occuring at 1 x 10-8 M or slightly less. It is noted that at a TFIIIA concentration of 0.5 x 10-8 M (lane 6) binding is just beginning to be evident whereas at this TFIIIA concentration, binding saturation to the 5S RNA gene ICR (protection between nucleotides +43 to +96) has already occurred (lane 2, Fig. 2). The dissociation constant for TFIIA binding to the SS RNA gene has been approximated at about 0.1 x 10-8 M (8). Results in lanes 6-8 as well as those from previously described experiments would indicate the TFIIIA binding strength for this site on the 5' flanking region of the TFIIIA gene is less although within the same order of magnitude.
Characterization of the TFIIIA interaction with 5' flanking region of TFIIIA gene TFIIIA was the first gene regulatory protein shown to contain zinc and require the metal for specific DNA binding (5). The zinc in TFIIIA is loosely associated and easily removed by brief EDTA treatment under mild conditions (5). Such treatment results in an apo-protein unable to specifically bind the SS gene ICR although retaining the ability to bind DNA non-specifically (5). In order to test the zinc requirement and DNA binding specificity of the interaction between TFIIIA and the 5' flanking region of its own gene, we examined the effect of EDTA chelation of
_:.AM
2926 Nucleic Acids Research, Vol. 18, No. 10 .
Al
D
7
Oi:
:ss;
,!. 8.
+ , +.: .."
III,, w
..
*'' t
:.
...
A.
.i
F
t; i
i
...
*RV .Aw now:: .7.X:X4 N,
..:
:Mri.i
%.
.72M.N.
MIMAK&., AW,
F
#
K
*.;..:' '.fS- -e
--27 1 -28 1
-295 -3 03 --3 13 -3 1 9
-325 -33 1
.0
*::1
W+5^;
A_.... W
:'
-.1I.
:4,1, ,h
Fig. 4. RNase digestion of 5S RNA in 7S particle is required for TFIIA interaction with 5' flanking region of TFIIIA gene. 7S particle purification, DNA template preparation (5' flanking region end-labeled on coding strand), DNase I footprinting, and gel electrophoresis were performed as described in METHODS. DNA and TFIIIA concentrations in lanes 1-7 are the same as described in the Fig. 3 legend; however, TFIIIA was liberated from 5S RNA in the 7S particle by RNase digestion
Fig. 3. EDTA chelation of TFIIIA inhibits specific interaction with 5' flanking region. Footprinting reactions were performed as in the Fig. 2 legend. Prior to addition to the footprinting reactions, TFIIIA (20 jig/ml in buffer C) was incubated 15 min at 23°C with or without 2 mM EDTA. Reactions in lanes 1-7 contained x 10-9 M 5' flanking template (end-labeled on the coding strand) and 1.0, 2.0, 3.0x O-8 M TFIIIA (lanes 2-4) or EDTA-treated TFIILA (lanes 5-7). Nucleotide markers aligned with bands in lane 7 are from Fig. 2.
in the footprinting reactions electrophoresed in lanes 2-4 but not those in lanes 5-7. Nucleotide markers aligned with bands in lane 7 were the same as in Fig. 2.
TFIIIA on its ability to footprint the -331 to -271 region on the TFIIIA promoter fragment (end-labeled on coding strand, Fig. 3). Lanes 2-4 in this figure exhibit the footprints afforded by untreated TFIIIA and lanes 5-7 exhibit the DNase I digestion patterns in the presence of EDTA-treated TFIIA (the reaction electrophoresed in lane 1 contained DNA but no TFIIIA). Untreated TFIIA gives a similar pattern observed previously (Fig. 2), hypersensitivity at -281, -325 and protection from -271 to -303, -303 to -313, and at -319 and -331. However, EDTA chelated TFIIIA is unable to bind specifically to the 5' flanking region of the TFIIA gene as evidenced by the lack of these characteristic alterations in the DNase I digestion pattern even in the presence of high concentrations of chelated TFIIIA (lanes 6 and 7; the sample in lane 5 was lost probably
during the ethanol precipitation step). These results indicate zinc is required for the TFIIIA-5' flanking region interaction and the interaction is specific. In immature oocytes, TFIA is found tightly bound to 5S RNA in the form of a 7S particle (7,8). TFIJIA apparently uses similar if not identical nucleic acid binding domain(s) in its interaction with the 5S gene or 5S RNA since 1) RNA removal from TFIJA in the 7S particle is required for subsequent binding to DNA, 2) free 5S RNA effectively competes with TFIA binding to the ICR of the 5S RNA gene (23). Is TFIIA using similar nucleic acid binding domain(s) for interaction with 5S RNA, 5S RNA gene, and the 5' flanking region of its own gene? To answer this question, the ability of TFIIIA bound with 5S RNA in the 7S particle to footprint the -271 to -331 region of the 5' flanking
Nucleic Acids Research, Vol. 18, No. 10 2927
-306 -326
5
-289 -
REGULATION
T1I
+REGULATION
-253
-II- 264
I
I
5' ACAGTTTCTCCAACACCAGCAGCTGCTGCACACCGTTTCCTCGGCTTCATGTATTATCACGTG 3 ' S
**
3' GTCAATGTCAAAGAGGTTGTGGTCGTCGACGACGTGTGGCAAAGGAGCCGAAGTACATAAT 5' -331 -313 -303 - 28 1 -271 Fig. 5. Nucleotide sequence of TFIIIA binding site on 5' flanking region of TFIILA gene. The sequence as well as protected regions (-) and DNase I hypersensitive sites (**, major; *, minor) were obtained from Figs. 1 and 2. The negative cis-acting element is from -306 to -289 (ref. 15) and a positive element is from -289 to -253 (15,16). Two major purine-rich tracts are in bold letters and underlined twice; the top strand is non-coding.
region of the TFIIA gene (end-labled on the coding strand) was examined (Fig. 4). Lanes 2-4 in this figure exhibit the TFIIAdependent footprint in this region (protein concentration in the 7S particle of 1.0, 2.0, and 3.Ox 10-8 M) when the 5S RNA in the 7S particle is digested extensively with RNase A (RNase itself does not alter the DNase I digestion pattern, not shown). Reactions electrophoresed in lanes 5-7 contained the same increasing concentrations of 7S particles but no RNA removal by RNase A treatment; the TFIIIA-dependent footprint is not observed as evidenced by the lack of the major DNase I hypersensitivity at -281, lack of DNase I protection between -303 and -281,- 303 and -313, and at -319 and -331 (lanes 5-7). This result indicates that TFHIA is using similar nucleic acid binding domain(s) for 5S RNA, the 5' flanking region, and the 5S RNA gene.
DISCUSSION Results presented indicate that TFEIA binds specifically to a site of approximately 60 bp on the 5' flanking region of the TFIIIA gene. Data supporting this conclusion are: 1) as determined by DNase I footprinting, highly purified TFIHA is able to interact from about nucleotide -264 to -326 on the non-coding strand of the 5' flanking region (Fig. 1); 2) TFIIA binds from nucleotide -271 to -331 on the coding strand as determined by DNase I footprinting (Fig. 2) thus significantly overlapping the binding site on the non-coding strand; 3) the binding affinity of TFIIA for this site on the 5' flanking region is less than that for the ICR of the 5S gene but within the same order of magnitude indicative of high affinity and specificity (Fig. 2); 4) brief treatment of TFIIIA with EDTA, a procedure which is known from previous studies to completely remove the zinc from the protein, abolishes the transcription factor's ability to bind to this site on the 5' flanking region as assayed by DNase I footprinting (Fig. 3), a result indicative of binding specificity for this interaction; 5) as judged by 5S RNA competition, TFIHA uses similar nucleic acid binding domain(s) for interaction with the 5S RNA gene, 5S RNA, and the 5' flanking region (Fig. 4). The TFIIA binding site on the 5' flanking region of the TFIIA gene is given in Fig. 5 (compilation of data from Figs. 1 and 2). The sequence listed is from -326 to -264 on the non-coding strand and -331 to -271 on the coding strand. There are no absolute sequence similarities between this site and the 5S RNA gene ICR. The main contact points between TFEIIA and the 5S gene ICR are clustered in a purine tract on the non-coding strand (+815'pGGATGGGAG-3'0H+90, ref. 9). Another purine-rich cluster exists from +46 to +61 on the non-coding strand (9).
Purine tracts have been previously proposed to constitute recognition sites for TFIIA and TFIIA-like proteins (24). Two major purine-rich tracts exist on the coding strand (bold letters, double underline, Fig. 5) within the TFIIIA binding site on the 5' flanking region, -2923'HO-CAAAGGAGp5' -285 and the partial direct repeat, -3233'HO-CAAAGAGGp5' -316; smaller purine-rich tracts are also present (e.g. in the -281 region). If purine tracts do represent TFIIIA contact regions, then TFIIIA would be predicted to bind the 5' flanking region in the Nterminal to C-terminal direction toward the + 1 transcription start site. TFIIA is apparently able to specifically recognize DNA of different absolute sequence. This observation might not be all that surprising as the protein specifically recognizes the doublestranded DNA ICR and the chemically different, single-stranded SS RNA. A number of other eukaryotic gene regulatory proteins can bind to degenerate sequences (25). The TFIIA interactions on the SS gene ICR and the 5' flanking region of the TFIIIA gene most likely have qualitative differences because the DNase I footprint patterns have different appearances (Fig. 2). Two previously identified regulatory regions are present in this TFIIA binding site (Fig. 5), a negative regulatory element from -306 to -289 (15) and a positive regulatory element from -289 to -253 (15,16). The TFIIIA binding site completely encompasses the negative regulatory element and overlaps the positive element. Other positive regulatory regions identified in the 5' flanking region of the TFIIIA gene include from -250 to -173 and -144 to -101 (15), regions downstream of this TFIIIA binding site. The ability of TFIIIA to bind specifically to a negative regulatory element as well as to a flanking positive element of its own gene suggests an autoregulatory role(s) for this protein. Potential roles include TFIIIA acting as a repressor, anti-repressor, and/or activator. We do note that the 3' border for this TFIIIA binding site just overlaps with the 5' border of a positive-acting site, namely -271 to -253, to which a protein related to adenovirus transcription factor USF binds (15). The C-tennmial tail of TFIIIA (that region possibly involved in proteinprotein interactions) might be in position to interact directly with this USF-like protein.
ACKNOWLEDGEMENTS This work was supported by a grant from the National Institute of General Medical Sciences and the National Science Foundation. The authors thank R. Littell for excellent technical assistance, C. Gaskins for preparation and purification of 7S particles from Xenopus laevis, and R. Steinberg and L. Unger for helpful discussions.
2928 Nucleic Acids Research, Vol. 18, No. 10
REFERENCES 1. Engelke, D.R., Ng. S.Y., Shastry, B.S., and Roeder, R.G. (1980) Cell 19, 717-728. 2. Lassar, A.B., Martin, P.L., and Roeder, R.G. (1983) Science 222, 740-748. 3. Sakonju, S., Bogenhagen, D.F., and Brown, D.D. (1980) Cell 19, 13-25. 4. Bogenhagen, D.F., Sakonju, S., and Brown, D.D. (1980) Cell 19, 27-35. 5. Hanas, J.S., Hazuda, D.J., Bogenhagen, D.F., Wu, F. Y.-H., and Wu, C.-W. (1983). J. Biol. Chem. 258, 14120-14125. 6. Hanas, J.S., Bogenhagen, D.F., and Wu, C.-W. (1983) Proc. Natl. Acad. Sci. USA 80, 2142-2145. 7. Pelham, H.R.B. and Brown, D.D. (1980) Proc. Natl. Acad. Sci. USA 77, 4170-4174. 8. Honda, B.M. and Roeder, R.G. (1980) Cell 22, 119-126. 9. Sakonju, S. and Brown, D.D. (1982) Cell 31, 395-405. 10. Miller, J., McLachlan, A.D., and Klug, A. (1985) EMBO J. 4, 1609- 1614. 11. Vrana, K.E., Churchill, M.E.A., Tullius, T.D., and Brown, D.D. (1988) Molec. Cell. Biol., 8, 1684-1696. 12. Fiser-Littell, R.M., Duke, A.L., Yanchick, J.S., and Hanas, J.S. (1988) J. Biol. Chem. 263, 1607-1610. 13. Hanas, J.S., Littell, R.M., Gaskins, C.J., and Zebrowski, R. (1989) Nucl. Acids Res. 17, 9861-9870. 14. Shastry, B.S., Honda, B.M., and Roeder, R.G. (1984) J. Biol. Chem. 259, 11373-11382. 15. Scotto, K.W., Kaulen, H., and Roeder, R.G. (1989) Genes & Develop. 3, 651 -662. 16. Matsumoto, Y. and Korn, L.J. (1988) Nucl. Acids Res. 11, 3801-3814. 17. Bradford, M.M. (1976) Anal. Biochem. 72, 248-254. 18. Tso, J.Y., Van Den Berg, D.J., and Korn, L.J. (1986) Nucl. Acids Res. 14, 2187-2200. 19. Tabor, S. and Richardson, C.C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1078. 20. Fiser-Littell, R.M. and Hanas, J.S. (1987) J. Biol. Chem. 262, 11916-11919. 21. Galas, D. and Schmitz, A. (1978) Nucl. Acids Res. 5, 3157-3170. 22. Maxam, A. and Gilbert, W. (1980) Meth. Enzymol. 65, 499-560. 23. Hanas, J.S., Bogenhagen, D.F., and Wu, C.-W. (1984) Nucl. Acids Res. 12, 2745-2758. 24. Rhodes, D. and Klug, A. (1986) Cell 46, 123-132. 25. Johnson, P.F. and McKnight, S.L. (1989) Ann. Rev. Biochem. 58, 799-839.
Nucleic Acids Research, Vol. 18, No. 10 2923
Identification of a TFIIIA binding site region of the TFIIIA gene
on
the 5' flanking
Jay S.Hanas and James F.Smith Department of Biochemistry and Molecular Biology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73190, USA Received January 20, 1990; Revised and Accepted April 9, 1990
ABSTRACT Xenopus transcription factor IIIA (TFIIIA) regulates 5S ribosomal RNA gene transcription in a positive manner by binding to the internal control region (ICR) of the 5S RNA gene. The present study reports the identification of a TFIIIA binding site on the 5' flanking region of the Xenopus laevis gene that codes for the synthesis of this transcription factor. This TFIIIA binding site (deduced from TFIIIA-dependent alterations in DNase I protection patterns) extends on the 5' flanking region from about nucleotide - 326 to - 264 on the non-coding strand and from - 331 to - 271 on the coding strand. The affinity of TFIIIA for the 5' flanking region of its own gene is less than that for the 5S RNA gene but within the same order of magnitude. A sequence similarity between this newly identified binding site and the 5S gene ICR is the presence of purine-rich tracts. EDTA chelation of TFIIIA inhibits binding to this 5' flanking element indicating, as with the 5S RNA gene, zinc is required for DNA binding specificity. When TFIIIA is bound to 5S RNA in the 7S particle, the protein does not bind to this 5' flanking region, an observation similar to that observed with binding to the 5S RNA gene. These results indicate TFIIIA is using similar nucleic acid binding domain(s) for interaction with the 5S gene, 5S RNA, and the 5' flanking region of its own gene. This upstream DNA region to which TFIIIA binds has been previously shown to contain a negative and a positive regulatory element for transcription of the TFIIIA gene (Scotto, K.W., Kaulen, H., and Roeder, R.G., 1989, Genes & Develop. 3, 651 - 662). The present results indicate TFIIIA binds to the negative control element located at - 306 to - 289 and possibly interacts/interferes with another transcription factor which binds to the positive control element extending from - 271 to - 253. INTRODUCTION Xenopus transcription factor IA (TFIIA) is a 40 kDa regulatory protein which specifically binds the SS RNA gene during oogenesis in Xenopus laevis and, in the presence of two additional factors, promotes transcription by RNA polymerase HI (1,2,3,4). TFIIIA requires zinc for specific DNA binding and promotion of transcription of the SS RNA gene in vitro (5). The binding
to its specific DNA site on the 5S gene ICR has a dissociation constant of about 10-9 M (6). TFIIIA also binds 5S RNA, forming a 7S particle in vivo (7,8). When TFIIIA is specifically bound to the 5S gene ICR, it influences the DNase I digestion pattern of the SS RNA gene at about nucleotides +45 to +98 on the non-coding strand and +43 to +96 on the coding strand (1,9). TFIIIA induces DNAse I hypersensitivity at the +43 region on the coding strand and at +63, +75, and +94 on the non-coding strand. The major contact points between TFIIIA and the ICR of the 5S RNA gene are located on the non-coding strand in a purine-rich tract on the 3' portion of the ICR (nucleotides 81-90, ref. 9). Protease as well as in vitro mutagenesis studies have established that TFIILA is oriented along the 5S gene with the N-terminal region
of the protein binding the 3' portion of the ICR and its C-terminal tail located near the 5' border of the ICR (10,11,12,13). The C-terminal tail of TFIIA, oriented on the ICR toward the + 1 start for transcription, is required for promotion of transcripiton of the 5S RNA gene (11). TFIIIA is present in prodigious amounts in immature oocytes (14). Understanding how this extraordinary level of expression is regulated is necessary for understanding ribosome biogenesis during oogenesis in Xenopus laevis. In addition, knowledge about the regulation of expression of eukaryotic transcription factor genes is necessary for understanding development. Because transcription initiation is a major gene regulatory step in eukaryotic cells, the identification of interactions between transacting factors and cis-acting regultory elements in the promoter regions of transcription factor genes will provide clues to their regulation. Both positive and negative cis-acting regulatory elements have been identified in the 5' flanking region of the TFIIIA gene (15,16). The present study reports the identification and characterization of a novel TFIIIA binding site on the 5' flanking region of the TFIIIA gene that overlaps the negative cis-acting regulatory element as well as one of the positive elements of this gene.
MATERIALS AND METHODS TFIIIA isolation Ovarian tissue from approximately 20 immature Xenopus laevis (4-5 cm, Nasco, WI) was homogenized in buffer A (50 mM Tris-HCl, pH 7.6, 50 mM KCI, 5 mM MgCl2, 0.2 mM phenylmethyl sulfonyl fluoride (PMSF), and 0.5 mM
WjS:a.i-es,SXr
2924 Nucleic Acids Research, Vol. 18, No. 10 dithiothreitol (DTT) and centrifuged at 6000 g for 15 min to remove cell debris. The supernatant was layered onto 10-30 % glycerol gradients (in buffer A minus the PMSF) and centrifuged 16 hrs at 34,000 rpm in a Beckman SW41 rotor. These procedures were performed at 4°C. The gradients were fractionated and assayed spectrophotometrically at A280. The 7S peak fraction (sedimenting slightly faster than hemoglobin) was further purified by ion exchange chromatograpghy on DEAE cellulose which results in a TFIHA purity in the 7S particle of 95% (6). Protein concentration was determined by the method of Bradford (17). For TFIIIA binding assays, the protein is liberated from the SS RNA in the 7S particle by extensive digestion with RNase A (6). Preparation of DNA templates The 6.5 kb EcoRI fragment containing the 5' flanking region as well as the first 4 exons and first 3 introns of the Xenopus laevis TFIIIA gene was kindly provided by J.Yun Tso and Laurence Korn (18). The BglII-PstI fragment containing sequences from -420 to +140 was subcloned between the BamH1-Pstl site of plasmid pT7-7, designated pT7-73AP (pT7-7 was kindly provided by Stanley Tabor, ref. 19). To label this TFIHA promoter fragment on the coding strand, the pT7-73AP plasmid was digested with EcoRI (site is 12 nucleotides upstream of BamHI site in polylinker) and the 5' overhang filled in using reverse transcriptase and [a32P] dATP (20). To label this fragment on the non-coding strand, the phosphate group of this 5' overhang was removed with bacterial alkaline phosphatase and labeled with [a!32P] ATP and polynucleotide kinase (20). In both cases, a 577 bp end-labeled fragment was generated by subsequent digestion with HindIIl (site located 9 bp downstream of PstI site in polylinker) and was purified by agarose gel electrophoresis. The coding strand of the Xenopus 5S RNA gene was end-labeled at an EcoRI site using reverse transcriptase and [a 32P] dATP; the 303 bp fragment containing the 120 bp SS RNA gene was subsequently isolated by agarose gel electrophoresis (20). The specific activities of the end-labeled DNA fragments (cpm/[DNA]) were determined by scintillation counting and absorbance at 260 nm (20). TFIIIA-DNA interactions DNase I footprinting (21) was used to examine the interaction of TFIIIA with the 5' flanking region of the Xenopus TFIIIA gene or with the Xenopus 5S RNA gene. Reactions (25 1d) contained template DNAs at a final concentration of 1 x 10-9 M (about 10,000 cpm) in 20 mM Tris-HCl, pH 7.5, 70 mM NH4Cl, 7 mM MgCl2, 0.5 mM DTT, 0.01 % Nonidet P-40. Purified TFIIIA-containing 7S particles (20 ytg/ml protein in 20 mM Tris-HCl, pH 7.5, 320 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT) were predigested with 10 p4g/ml RNase A for 30 min at 23°C. TFIIIA (final concentrations used are indicated in the Fig. legends) was incubated with template DNA in the footprinting reactions for 15 min at 23°C and then DNase I was added to a final concentration of 1 ,tg/ml for 1 min. DNase I was quenched by addition of 100 /tl of 10 mM Tris-HCl, pH 7.5, 0.2% SDS, 1 mM EDTA, 30 ytg/ml sonicated salmon sperm DNA. DNA was then ethanol precipitated, electrophoresed on DNA sequencing gels, and autoradiographed as described (20). The DNA sequence of the DNase I digestion pattern of the endlabeled (coding or non-coding strand), 557 bp promoter fragment of the TFIHA gene was determined by chemically sequencing the respective end-labeled fragments (22) and electrophoresing the sequencing ladders in adjacent lanes.
.
...
:. ..
*.:
*,:'' "i3Bm''
_
0
M
......
*:e'
*
_
..: ..
ijSj
.I:
_
..:.
.
...
.:.
::ii!;sE.'jl{t
....
.... .:.
:.
:.
:.!::'b$::
(G) (T) 2 8 2 I(C) 64
.2 7
(
::
*
.giffik
i6"
F._am
:..
..
- 295
- - 3 09 3 --3 1 0 -3 16 --3 2 2
326 5,
(A) ( -r) (C) (C) (T) (A)
...... :'
...
Fig. 1. Interaction of TFEIIA with the non-coding strand of the 5' flanking region of the TFIIIA gene. TFIIIA isolation, DNA template preparation, DNase I footprinting, and acrylamide gel electrophoresis were performed as described in the METHODS. Footprinting reactions electrophoresed in lanes 1-4 contained l x 10-9 M DNA and 0, 0.25, 0.5, lOX10-8 M TFH_IA respectively. The nucleotide sequence markers aligned with specific bands lane 4 were obtained by chemically sequencing (ref. 22) the end-labeled fragment and are numbered relative to the presumed + 1 site for transcription initiation (16). Gel autoradiography was performed overnight with an intensifying screen.
RESULTS Interaction of TFIIIA with the 5' flanking region TFIIIA gene
of the
Since many autoregulatory phenomena exist in biological systems, it did not seem unreasonable to ask whether TFIItA could interact with the 5' flanking/promoter region of its own gene. To test initially whether TFIIIA could bind this DNA region, a gel retardation assay was performed with a 577 bp fragment
Nucleic Acids Research, Vol. 18, No. 10 2925 I9
3
(j
1
8
496 5' -271
+- 4 3
4Im
(T)
VW
"V :%.: -zzz.zX "I'll,:6 .II "6 An't
-:.:
-295 (T)
-303 (A) -
-
3 1 3 (G) 3 1 9 (G)
-325 (G) -3 3 1 (G) 3'
Fig. 2. Interaction of TFIILA with the coding strand of the 5' flanking region of the TFIILA gene. TFIIIA isolation, preparation of DNA templates (5S gene and TFIIIA 5' flanking region), DNase I footprinting, and gel electrophoresis were performed as described in METHODS. Footprinting reactions electrophoresed in lanes 1-4 contained 1 x 10-9 M Xenopus SS RNA gene (endlabeled on the coding strand) and 0, 0.5, 1.0, 2.0x 10-8 M TFIIIA respectively. The nucleotide markers aligned with lane 1 are from ref. 9. Reactions electrophoresed in lanes 5-8 contained 1 x 10-9 M of the 5' flanking template (577 bp, end-labeled on coding strand) and the same TFIILA concentrations as in lanes 1-4. The nucleotide sequence markers aligned with bands in lane 8 was obtained by chemically sequencing this end-labeled fragment and are relative to the + 1 site for transcription initiation.
containing the 5'flanking/promoter region of the TFIIIA gene (-420 to + 140, ref. 18). At a protein concentration of 1 x 10-8 M, a small but complete band shift was observed indicating binding of TFIIIA to this DNA fragment (gel not shown). To better examine the specificity and binding site(s) of TFIIIA on this 577 bp DNA fragment, DNase I footprinting experiments were performed with TFIIIA and this DNA template end-labeled
on its non-coding or coding strand. Fig. 1 exhibits the DNase I digestion pattern of the 577 bp fragment containing the 5' flanking region of the Xenopus laevis TFIIIA gene (end-labeled on the non-coding strand) in the presence of increasing concentrations of TFIIA (lanes 2-4); lane 1 exhibits the DNase I digestion pattern of this fragment in the absence of TFIIIA. In the presence of 1 x 10-8 M TFIIA (lane 4), a distinct DNase I digestion pattern is observed on the 5' flanking region from about nucleotide -326 (A) to -264 (G). A distinct region of TFIHA-dependent DNase I protection is observed between nucleotides -310 (C) and -282 (C) on the non-coding strand, especially from -303 (T) to -295 (A). Other characteristics of the TFUIA-dependent footprint pattern on the non- coding strand include DNase I protection at -326 (A) and 316 (C), from -282 (C) toward -270 (T), and from -270 (T) to -264 (G). Slight TFIIA-dependent DNase I hypersensitivity is observed at -322 (T), -282 (C), and -270 (T). Details of this interaction are also given in Fig. 5. A distinct pattern/region of TFIIIA-dependent, DNase I protection/enhancement was not observed in other regions of this fragment when the digestion products were electrophoresed for longer or shorter periods of time. Lanes 6-8 in Fig. 2 illustrate the DNase I digestion patterns of the 577 bp fragment (end-labeled on the coding strand) in the presence of increasing concentrations of TFIIIA (0.5, 1.0, 2.0x 10-8 M; reaction in lane 5 contained no TFIIIA). In lanes 7 and 8, a distinct TFIIIA-dependent DNase I digestion pattern (relative to lane 5) is observed from about nucleotide -331 (G) to -271 (T) of the coding strand. A major region of DNase I protection is observed between nucleotide -303 (A) and 271 (T). Within this protected region, a strong TFIIIA-dependent DNase I hypersensitive site is apparent around nucleotide -281 (A). Also apparent in these lanes is TFIIIA-dependent protection between nucleotides -303 (A) and -313 (G), and protections at nucleotides -331 (G) and 319 (G). Slight DNase I hypersensitivity is observed at nucleotide -325 (G) and -271 (T). As with the end-labeled non-coding strand, electrophoresis of this pattern for longer or shorter times did not reveal any other significant regions of TFIIIA interaction. Because the patterns are the same in lanes 7 and 8, saturation of TFIIIA binding is occuring at 1 x 10-8 M or slightly less. It is noted that at a TFIIIA concentration of 0.5 x 10-8 M (lane 6) binding is just beginning to be evident whereas at this TFIIIA concentration, binding saturation to the 5S RNA gene ICR (protection between nucleotides +43 to +96) has already occurred (lane 2, Fig. 2). The dissociation constant for TFIIA binding to the SS RNA gene has been approximated at about 0.1 x 10-8 M (8). Results in lanes 6-8 as well as those from previously described experiments would indicate the TFIIIA binding strength for this site on the 5' flanking region of the TFIIIA gene is less although within the same order of magnitude.
Characterization of the TFIIIA interaction with 5' flanking region of TFIIIA gene TFIIIA was the first gene regulatory protein shown to contain zinc and require the metal for specific DNA binding (5). The zinc in TFIIIA is loosely associated and easily removed by brief EDTA treatment under mild conditions (5). Such treatment results in an apo-protein unable to specifically bind the SS gene ICR although retaining the ability to bind DNA non-specifically (5). In order to test the zinc requirement and DNA binding specificity of the interaction between TFIIIA and the 5' flanking region of its own gene, we examined the effect of EDTA chelation of
_:.AM
2926 Nucleic Acids Research, Vol. 18, No. 10 .
Al
D
7
Oi:
:ss;
,!. 8.
+ , +.: .."
III,, w
..
*'' t
:.
...
A.
.i
F
t; i
i
...
*RV .Aw now:: .7.X:X4 N,
..:
:Mri.i
%.
.72M.N.
MIMAK&., AW,
F
#
K
*.;..:' '.fS- -e
--27 1 -28 1
-295 -3 03 --3 13 -3 1 9
-325 -33 1
.0
*::1
W+5^;
A_.... W
:'
-.1I.
:4,1, ,h
Fig. 4. RNase digestion of 5S RNA in 7S particle is required for TFIIA interaction with 5' flanking region of TFIIIA gene. 7S particle purification, DNA template preparation (5' flanking region end-labeled on coding strand), DNase I footprinting, and gel electrophoresis were performed as described in METHODS. DNA and TFIIIA concentrations in lanes 1-7 are the same as described in the Fig. 3 legend; however, TFIIIA was liberated from 5S RNA in the 7S particle by RNase digestion
Fig. 3. EDTA chelation of TFIIIA inhibits specific interaction with 5' flanking region. Footprinting reactions were performed as in the Fig. 2 legend. Prior to addition to the footprinting reactions, TFIIIA (20 jig/ml in buffer C) was incubated 15 min at 23°C with or without 2 mM EDTA. Reactions in lanes 1-7 contained x 10-9 M 5' flanking template (end-labeled on the coding strand) and 1.0, 2.0, 3.0x O-8 M TFIIIA (lanes 2-4) or EDTA-treated TFIILA (lanes 5-7). Nucleotide markers aligned with bands in lane 7 are from Fig. 2.
in the footprinting reactions electrophoresed in lanes 2-4 but not those in lanes 5-7. Nucleotide markers aligned with bands in lane 7 were the same as in Fig. 2.
TFIIIA on its ability to footprint the -331 to -271 region on the TFIIIA promoter fragment (end-labeled on coding strand, Fig. 3). Lanes 2-4 in this figure exhibit the footprints afforded by untreated TFIIIA and lanes 5-7 exhibit the DNase I digestion patterns in the presence of EDTA-treated TFIIA (the reaction electrophoresed in lane 1 contained DNA but no TFIIIA). Untreated TFIIA gives a similar pattern observed previously (Fig. 2), hypersensitivity at -281, -325 and protection from -271 to -303, -303 to -313, and at -319 and -331. However, EDTA chelated TFIIIA is unable to bind specifically to the 5' flanking region of the TFIIA gene as evidenced by the lack of these characteristic alterations in the DNase I digestion pattern even in the presence of high concentrations of chelated TFIIIA (lanes 6 and 7; the sample in lane 5 was lost probably
during the ethanol precipitation step). These results indicate zinc is required for the TFIIIA-5' flanking region interaction and the interaction is specific. In immature oocytes, TFIA is found tightly bound to 5S RNA in the form of a 7S particle (7,8). TFIJIA apparently uses similar if not identical nucleic acid binding domain(s) in its interaction with the 5S gene or 5S RNA since 1) RNA removal from TFIJA in the 7S particle is required for subsequent binding to DNA, 2) free 5S RNA effectively competes with TFIA binding to the ICR of the 5S RNA gene (23). Is TFIIA using similar nucleic acid binding domain(s) for interaction with 5S RNA, 5S RNA gene, and the 5' flanking region of its own gene? To answer this question, the ability of TFIIIA bound with 5S RNA in the 7S particle to footprint the -271 to -331 region of the 5' flanking
Nucleic Acids Research, Vol. 18, No. 10 2927
-306 -326
5
-289 -
REGULATION
T1I
+REGULATION
-253
-II- 264
I
I
5' ACAGTTTCTCCAACACCAGCAGCTGCTGCACACCGTTTCCTCGGCTTCATGTATTATCACGTG 3 ' S
**
3' GTCAATGTCAAAGAGGTTGTGGTCGTCGACGACGTGTGGCAAAGGAGCCGAAGTACATAAT 5' -331 -313 -303 - 28 1 -271 Fig. 5. Nucleotide sequence of TFIIIA binding site on 5' flanking region of TFIILA gene. The sequence as well as protected regions (-) and DNase I hypersensitive sites (**, major; *, minor) were obtained from Figs. 1 and 2. The negative cis-acting element is from -306 to -289 (ref. 15) and a positive element is from -289 to -253 (15,16). Two major purine-rich tracts are in bold letters and underlined twice; the top strand is non-coding.
region of the TFIIA gene (end-labled on the coding strand) was examined (Fig. 4). Lanes 2-4 in this figure exhibit the TFIIAdependent footprint in this region (protein concentration in the 7S particle of 1.0, 2.0, and 3.Ox 10-8 M) when the 5S RNA in the 7S particle is digested extensively with RNase A (RNase itself does not alter the DNase I digestion pattern, not shown). Reactions electrophoresed in lanes 5-7 contained the same increasing concentrations of 7S particles but no RNA removal by RNase A treatment; the TFIIIA-dependent footprint is not observed as evidenced by the lack of the major DNase I hypersensitivity at -281, lack of DNase I protection between -303 and -281,- 303 and -313, and at -319 and -331 (lanes 5-7). This result indicates that TFHIA is using similar nucleic acid binding domain(s) for 5S RNA, the 5' flanking region, and the 5S RNA gene.
DISCUSSION Results presented indicate that TFEIA binds specifically to a site of approximately 60 bp on the 5' flanking region of the TFIIIA gene. Data supporting this conclusion are: 1) as determined by DNase I footprinting, highly purified TFIHA is able to interact from about nucleotide -264 to -326 on the non-coding strand of the 5' flanking region (Fig. 1); 2) TFIIA binds from nucleotide -271 to -331 on the coding strand as determined by DNase I footprinting (Fig. 2) thus significantly overlapping the binding site on the non-coding strand; 3) the binding affinity of TFIIA for this site on the 5' flanking region is less than that for the ICR of the 5S gene but within the same order of magnitude indicative of high affinity and specificity (Fig. 2); 4) brief treatment of TFIIIA with EDTA, a procedure which is known from previous studies to completely remove the zinc from the protein, abolishes the transcription factor's ability to bind to this site on the 5' flanking region as assayed by DNase I footprinting (Fig. 3), a result indicative of binding specificity for this interaction; 5) as judged by 5S RNA competition, TFIHA uses similar nucleic acid binding domain(s) for interaction with the 5S RNA gene, 5S RNA, and the 5' flanking region (Fig. 4). The TFIIA binding site on the 5' flanking region of the TFIIA gene is given in Fig. 5 (compilation of data from Figs. 1 and 2). The sequence listed is from -326 to -264 on the non-coding strand and -331 to -271 on the coding strand. There are no absolute sequence similarities between this site and the 5S RNA gene ICR. The main contact points between TFEIIA and the 5S gene ICR are clustered in a purine tract on the non-coding strand (+815'pGGATGGGAG-3'0H+90, ref. 9). Another purine-rich cluster exists from +46 to +61 on the non-coding strand (9).
Purine tracts have been previously proposed to constitute recognition sites for TFIIA and TFIIA-like proteins (24). Two major purine-rich tracts exist on the coding strand (bold letters, double underline, Fig. 5) within the TFIIIA binding site on the 5' flanking region, -2923'HO-CAAAGGAGp5' -285 and the partial direct repeat, -3233'HO-CAAAGAGGp5' -316; smaller purine-rich tracts are also present (e.g. in the -281 region). If purine tracts do represent TFIIIA contact regions, then TFIIIA would be predicted to bind the 5' flanking region in the Nterminal to C-terminal direction toward the + 1 transcription start site. TFIIA is apparently able to specifically recognize DNA of different absolute sequence. This observation might not be all that surprising as the protein specifically recognizes the doublestranded DNA ICR and the chemically different, single-stranded SS RNA. A number of other eukaryotic gene regulatory proteins can bind to degenerate sequences (25). The TFIIA interactions on the SS gene ICR and the 5' flanking region of the TFIIIA gene most likely have qualitative differences because the DNase I footprint patterns have different appearances (Fig. 2). Two previously identified regulatory regions are present in this TFIIA binding site (Fig. 5), a negative regulatory element from -306 to -289 (15) and a positive regulatory element from -289 to -253 (15,16). The TFIIIA binding site completely encompasses the negative regulatory element and overlaps the positive element. Other positive regulatory regions identified in the 5' flanking region of the TFIIIA gene include from -250 to -173 and -144 to -101 (15), regions downstream of this TFIIIA binding site. The ability of TFIIIA to bind specifically to a negative regulatory element as well as to a flanking positive element of its own gene suggests an autoregulatory role(s) for this protein. Potential roles include TFIIIA acting as a repressor, anti-repressor, and/or activator. We do note that the 3' border for this TFIIIA binding site just overlaps with the 5' border of a positive-acting site, namely -271 to -253, to which a protein related to adenovirus transcription factor USF binds (15). The C-tennmial tail of TFIIIA (that region possibly involved in proteinprotein interactions) might be in position to interact directly with this USF-like protein.
ACKNOWLEDGEMENTS This work was supported by a grant from the National Institute of General Medical Sciences and the National Science Foundation. The authors thank R. Littell for excellent technical assistance, C. Gaskins for preparation and purification of 7S particles from Xenopus laevis, and R. Steinberg and L. Unger for helpful discussions.
2928 Nucleic Acids Research, Vol. 18, No. 10
REFERENCES 1. Engelke, D.R., Ng. S.Y., Shastry, B.S., and Roeder, R.G. (1980) Cell 19, 717-728. 2. Lassar, A.B., Martin, P.L., and Roeder, R.G. (1983) Science 222, 740-748. 3. Sakonju, S., Bogenhagen, D.F., and Brown, D.D. (1980) Cell 19, 13-25. 4. Bogenhagen, D.F., Sakonju, S., and Brown, D.D. (1980) Cell 19, 27-35. 5. Hanas, J.S., Hazuda, D.J., Bogenhagen, D.F., Wu, F. Y.-H., and Wu, C.-W. (1983). J. Biol. Chem. 258, 14120-14125. 6. Hanas, J.S., Bogenhagen, D.F., and Wu, C.-W. (1983) Proc. Natl. Acad. Sci. USA 80, 2142-2145. 7. Pelham, H.R.B. and Brown, D.D. (1980) Proc. Natl. Acad. Sci. USA 77, 4170-4174. 8. Honda, B.M. and Roeder, R.G. (1980) Cell 22, 119-126. 9. Sakonju, S. and Brown, D.D. (1982) Cell 31, 395-405. 10. Miller, J., McLachlan, A.D., and Klug, A. (1985) EMBO J. 4, 1609- 1614. 11. Vrana, K.E., Churchill, M.E.A., Tullius, T.D., and Brown, D.D. (1988) Molec. Cell. Biol., 8, 1684-1696. 12. Fiser-Littell, R.M., Duke, A.L., Yanchick, J.S., and Hanas, J.S. (1988) J. Biol. Chem. 263, 1607-1610. 13. Hanas, J.S., Littell, R.M., Gaskins, C.J., and Zebrowski, R. (1989) Nucl. Acids Res. 17, 9861-9870. 14. Shastry, B.S., Honda, B.M., and Roeder, R.G. (1984) J. Biol. Chem. 259, 11373-11382. 15. Scotto, K.W., Kaulen, H., and Roeder, R.G. (1989) Genes & Develop. 3, 651 -662. 16. Matsumoto, Y. and Korn, L.J. (1988) Nucl. Acids Res. 11, 3801-3814. 17. Bradford, M.M. (1976) Anal. Biochem. 72, 248-254. 18. Tso, J.Y., Van Den Berg, D.J., and Korn, L.J. (1986) Nucl. Acids Res. 14, 2187-2200. 19. Tabor, S. and Richardson, C.C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1078. 20. Fiser-Littell, R.M. and Hanas, J.S. (1987) J. Biol. Chem. 262, 11916-11919. 21. Galas, D. and Schmitz, A. (1978) Nucl. Acids Res. 5, 3157-3170. 22. Maxam, A. and Gilbert, W. (1980) Meth. Enzymol. 65, 499-560. 23. Hanas, J.S., Bogenhagen, D.F., and Wu, C.-W. (1984) Nucl. Acids Res. 12, 2745-2758. 24. Rhodes, D. and Klug, A. (1986) Cell 46, 123-132. 25. Johnson, P.F. and McKnight, S.L. (1989) Ann. Rev. Biochem. 58, 799-839.
