Vaccine 32 (2014) 6115–6121

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Identification of a novel vaccine candidate by immunogenic screening of Vibrio parahaemolyticus outer membrane proteins Chuchu Li 1 , Zhicang Ye 1 , Liangyou Wen, Ran Chen, Lihua Tian, Fukun Zhao, Jianyi Pan ∗ Institute of Proteomics and Molecular Enzymology, School of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018, China

a r t i c l e

i n f o

Article history: Received 23 July 2014 Received in revised form 25 August 2014 Accepted 27 August 2014 Available online 16 September 2014 Keywords: Vibrio parahaemolyticus Outer membrane protein VP0802 Protective antigen Vaccine

a b s t r a c t Vibrio parahaemolyticus is an important halophilous pathogen that can cause not only a broad range of disease in aquatic animals but also serious seafood-borne illness in humans as a result of the consumption of seafood. To avoid the use of antibiotics, it is critical to identify protective antigens for developing highly effective vaccines against this pathogen. Outer membrane proteins (OMPs) have been suggested as potential vaccine candidates for conferring protection against infection. In this study, we identified novel immunogenic OMPs using an immune assay with serum antibodies from mice infected by V. parahaemolyticus combined with mass spectrometry analysis. Nine OMPs were identified to be immunogenic proteins, and four of these identified proteins with relatively low abundance in OMP profiles, LptD, VP0802, VP1243 and VP0966, were determined to have immunogenicity for the first time. One OMP of interest, VP0802, is highly conserved among major Vibrio species and was proposed to adopt a ␤-barrel conformation and to be a member of the OprD protein family by bioinformatic analysis. The immunogenicity and protective efficacy of VP0802 were further evaluated by bacterial challenge postimmunization in a mouse model. VP0802 was confirmed to be highly immunogenic and to offer strong protection against V. parahaemolyticus infection, with an RPS of at least 66.7. Efficient clearance of bacteria from the blood of vaccinated mice was also observed. Moreover, upregulation of VP0802 expression was found after bacteria were exposed to fresh sera. These data, taken together, suggest that VP0802 is a promising candidate for the development of a subunit vaccine to prevent V. parahaemolyticus infection. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Vibrio parahaemolyticus is a model marine pathogen with wide distribution in coastal marine waters and estuaries that can infect a broad spectrum of fish and mammals. It is not only a major causative agent of disease in aquatic animals but also a worldwide cause of seafood-borne illnesses, such as acute gastroenteritis, as a result of the consumption of raw or undercooked seafood [1]. Currently, the main measure to control the diseases caused by V. parahaemolyticus is the use of antibiotics, as well as wholecell killed bacteria vaccines [2]. Although antibiotics are currently still effective, the use of antibiotics and antibiotic resistance has become serious clinical problems. Meanwhile, species-specific vaccines have shown protection against a specific bacterial strain, but they cannot prevent infections caused by diverse pathogens and their complicated serotypes [3,4]. Therefore, the development of

∗ Corresponding author. Tel.: +86 571 86843748; fax: +86 571 86843745. E-mail address: [email protected] (J. Pan). 1 These authors contribute equally to this work. http://dx.doi.org/10.1016/j.vaccine.2014.08.077 0264-410X/© 2014 Elsevier Ltd. All rights reserved.

effective, versatile vaccines is required both for preventing bacterial infections and for avoiding the use of antibiotics in the aquaculture industry. Outer membrane proteins (OMPs), which are unique to Gramnegative bacteria, have been revealed to be highly immunogenic proteins and may represent good candidates for vaccine development against bacterial infection [5]. For this reason, research has focused in recent years on the determination of the immunogenic characteristics of OMPs. With regard to V. parahaemolyticus, there are several OMPs have been confirmed to be immunogenic, and some of them exhibit effective protection in laboratory trials and may be useful as vaccine candidates. Four OMPs, OmpW, OmpV, OmpU and OmpK, provided high levels of protection against V. parahaemolyticus zj2003 in large yellow croaker [6]. In another study of this bacterium, two iron-regulated OMPs, psuA and pvuA, were proven to be immunogenic and could produce synergistic effects during in vivo infection [7]. Moreover, Li et al. [8] demonstrated that five OMPs (VPA1435, VP0764, VPA1186, VP1061 and VP2850) provide immune protection against V. parahaemolyticus infection in crucian carp, and VP1061 and VP2850 were further determined to be potential polyvalent vaccine candidates that could be used

6116

C. Li et al. / Vaccine 32 (2014) 6115–6121

for the development of novel polyvalent vaccines against V. parahaemolyticus and other Gram-negative pathogens. Recently, LamB (maltoporin), another versatile vaccine candidate for the prevention of Vibriosis, was found in V. parahaemolyticus RIMD2210633 by Lun et al. [3]. Most interestingly, an enzyme called enolase, which is located on the surface of V. parahaemolyticus ATCC33847, was revealed to be a protective antigen [9]. In the present study, several OMPs, including LptD, VP0802, VP1243 and VP0966, were first identified as immunogenic proteins from V. parahaemolyticus RIMD2210633 using immunoproteomics approach. In addition, we systemically evaluated the protective efficacy of VP0802, and our data indicated that this protein may serve as a promising vaccine candidate for the development of a protective subunit vaccine against bacterial infection. 2. Materials and methods 2.1. Bacterial strain and growth conditions The V. parahaemolyticus RIMD 2210633, Escherichia coli DH5␣ and E. coli BL21 bacterial strains and pET-28a(+) plasmid vector were maintained in our laboratory. V. parahaemolyticus bacteria were grown in high salt LB medium (containing 3% NaCl) at 28 ◦ C. E. coli were routinely cultured at 37 ◦ C in LB broth or agar supplemented with 50 ␮g/mL kanamycin when needed. 2.2. Formalin-killed cell (FKC) preparation and immunization FKC V. parahaemolyticus vaccine was prepared as described previously [10] with slight modification. Briefly, the bacteria were cultured and harvested at an OD600 of 0.8 by centrifugation at 5000 × g for 10 min at 4 ◦ C. The bacterial pellets were washed twice in sterile PBS and then diluted to 1 × 107 CFU/mL with PBS. FKCs were prepared by the addition of formalin to a final concentration of 0.5% (v/v) and incubation at 4 ◦ C for 24 h. The inactivation was confirmed by the lack of growth on LB agar plates. Next, formalin was removed by centrifugation at 6000 × g for 10 min. The cell pellet was resuspended in PBS and used for immunization. ICR mice (3 mice per group) were immunized intraperitoneally (i.p.) with 300 ␮L of FKCs (experimental group) or with the same volume of PBS (control group) 4 times at intervals of 7 days. 2.3. Extraction of OMPs The OMPs of V. parahaemolyticus were extracted using sodium lauryl sarcosine (SLS) methods [11] with slight modification. In brief, bacteria were grown to an OD600 of 0.8 and then harvested and washed with 50 mM Tris–HCl, pH 7.4. The pellets were then resuspended in a lysis buffer (50 mM Tris–HCl, 150 mM NaCl, pH 7.4) and broken by ultrasonication on ice. Cell debris was removed by centrifugation at 12,000 × g for 15 min. Next, the supernatants were collected and ultracentrifuged at 100,000 × g for 1 h at 4 ◦ C. The pellets were resuspended in 2% SLS in 50 mM Tris–HCl, pH 7.5, and the protein samples were incubated at room temperature for 40 min. Samples were centrifuged again at 100,000 × g for 1 h at 4 ◦ C. The pellets corresponding to OMPs were resuspended in lysis buffer containing 1% Triton X-100 and stored at −20 ◦ C until use. 2.4. Antibody titer assay The presence of specific antibodies following immunization was determined by dot enzyme-linked immunosorbent assay (dotELISA). An aliquot of proteins (10 ␮g of outer membrane proteins or 2 ␮g of purified VP0802) was loaded onto PVDF membranes. After blocking in 5% bovine serum albumin (BSA), the proteins were probed with mouse antisera collected from both immunized and

control group mice as primary antibodies, and an HRP-rabbit antimouse antibody was used as the secondary antibody. The conjugate was stained using enhanced chemiluminescence reagent. 2.5. SDS-PAGE and Western blotting analysis SDS-PAGE and Western blotting analysis were carried out using a standard approach. Briefly, the OMP samples were run in 12% slab SDS-PAGE gels, and the protein bands were visualized by staining with Coomassie Brilliant Blue R-250. For Western blotting analysis, the proteins in gels were transferred to PVDF membranes. Next, the PVDF membranes were blocked overnight with 5% skim milk in TBST (25 mM Tris, 150 mM NaCl, and 0.05% (v/v) Tween20, pH 7.4) at 4 ◦ C. After washing three times with TBST, the PVDF membranes were incubated with mouse antibodies for 2 h at room temperature on a gentle shaker. The membranes were rinsed three times with TBST and incubated with anti-mouse secondary antibodies at a dilution of 1:1000 for 2 h at room temperature. The membranes were then washed, and the bands were stained using dimethylaminoazobenzene (DHB) as substrate or displayed using a Chemiluminscent imaging system (ChampChemiTM , SageCreation). 2.6. In-gel protein digestion and MALDI-TOF/TOF mass spectrometry analysis Protein bands separated by SDS-PAGE were finely excised, and the gel strips were treated using a procedure compatible with mass spectrometry as described in our previous work [12]. Proteins were identified by MALDI-TOF tandem mass spectrometry (4700 Proteomics Analyzer, Applied Biosystems). Mass spectra were analyzed using the GPS ExplorerTM Software, and peptide masses were searched against the V. parahaemolyticus database in NCBI using the Mascot search engine. Search parameters allowed for one missed tryptic cleavage site, the carbamidomethylation of cysteine, and the possible oxidation of methionine; the precursor ion mass tolerance was 50 ppm. 2.7. Bioinformatics analysis Homology searches of VP0802 were conducted using BLAST in UniProtKB (http://www.uniprot.org/uniprot) or OMPdb (http://aias.biol.uoa.gr/OMPdb). A phylogenetic analysis was performed using MEGA 6.0 [13] software and the neighbor-joining method. The signal peptide was predicted by the SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP). A three-dimensional model was generated using automated homology prediction through the SWISS-MODEL server (http://swissmodel.expasy.org/). 2.8. Cloning, expression and purification of VP0802 The gene encoding VP0802 was cloned, expressed and purified as previously described [14]. Briefly, the gene fragment was amplified by PCR using the following primer pair: F(GGAATTCCATATGATGGACAAATTTTTTAAGGT) and R(CCGCTCGAGTTAGTGGAAGCTGTAAGG) (underlined sequences are NdeI and XhoI restriction enzyme sites, respectively). The PCR products were cloned into the pET28a(+) plasmid and then transformed into E. coli DH5␣ cells. The positive recombinant transformants were selected using LB agar plates containing 50 ␮g/mL kanamycin and then cloned into E. coli BL21 cells. Recombinant VP0802 protein was induced in E. coli BL21 upon treatment with 1 mM isopropyl ␤-d-1-thiogalactopyranoside (IPTG). The expressed protein from insoluble inclusion bodies was solubilized with 8 M urea and purified using Ni2+ -NTA agarose (Qiagen) according to the manufacturer’s instructions. Concentrations of the purified proteins

C. Li et al. / Vaccine 32 (2014) 6115–6121

6117

2.11. Bacteria treatment with sera and quantitative real-time PCR V. parahaemolyticus were incubated with fresh human sera (15%, v/v) for 1 h at 37 ◦ C. After incubation, the intact bacteria were harvested by centrifugation at 6000 × g for 10 min. Extraction of total RNA and real-time PCR analysis of the gene encoding VP0802 was conducted as described in our previous work [15]. Primers F (GACTTCTACGGTGTTGATGACGAT) and R (GCTAGCTTGCCGAAAGACTGGTT) were used for amplification of VP0802. The gene of 16S rRNA (Ac No.: HM771348.1) of V. parahaemolyticus was amplified simultaneously with the primers of F (GCCTTCGGGAACTCTGAGACAG) and R (GCTCGTTGCGGGACTTAACCCAA), and was used as an internal control. Real-time PCR was performed using a Bio-Rad real-time PCR amplification system and SYBR Premix Ex TaqTM kit (Takara). 2.12. Ethics statement All ICR mice used in this study were purchased from Center of Laboratory Animals of Zhejiang Chinese Medical University. Mice were housed and handled according to guidelines approved by Animal Care and Use Committee of Zhejiang Chinese Medical University. All mice were sacrificed under ether anesthesia and all efforts were made to minimize suffering. Fig. 1. Identification of immunogenic OMPs. (A) Titer of antisera against OMPs assayed by Dot-ELISA. Sera were collected from mice immunized with V. parahaemolyticus FKCs. (B) SDS-PAGE and Western blotting analysis of the OMPs of V. parahaemolyticus. M, Prestained marker for protein molecular weight. OMP, outer membrane proteins prepared by sodium lauryl sarcosine (SLS) methods.

were determined with the Bradford method, and the proteins were stored at −20 ◦ C until use. 2.9. Active immune protection assay ICR mice were used for examination of the protective efficacy of VP0802 antiserum. Animals were purchased from Center for animal research at Zhejiang Chinese Medical University, Hangzhou, China. The active protection experiments were performed as described in our previous work [15]. In brief, ICR mice (6 mice, 20–22 g) were immunized with 20 ␮g of purified VP0802 emulsified with complete Freund’s adjuvant. The same quantity of proteins emulsified with incomplete Freund’s adjuvant was used for three booster immunizations at intervals of 7 days. The control group mice (6 mice) were injected with PBS buffer mixed with incomplete Freund’s adjuvant. Seven days after the final immunization, 50 ␮L sera were collected from mice and used for the determination of antiserum titer. One week later, the immunized and control mice were both challenged i.p. with 2.5 × 107 CFU of V. parahaemolyticus, and challenged mice were observed daily for mortality. The mice were observed for 10 days after challenge, and mortality was recorded daily post-challenge. The relative percent survival (RPS) was calculated as [1-(mortality of vaccinated group/mortality of control group)] × 100. 2.10. In vivo serum bactericidal assay The in vivo bactericidal assay was carried out through tail vein injection of 106 CFU V. parahaemolyticus into two groups of mice (3 mice in each group), respectively. After 4 h of injection, 100 ␮l of blood was collected from tail vein of mice and added into 100 ␮l sterile PBS containing heparin. The bloods were spread on LB agar plates to enumerate the survival bacteria. A Student’s t-test was used for evaluation of the viable bacteria, and P values of