RESEARCH ARTICLE
Identification of a Novel Dehydration Responsive Gene, drp10, From the African Clawed Frog, Xenopus laevis KYLE K. BIGGAR, YULIA BIGGAR, AND KENNETH B. STOREY* Institute of Biochemistry and Department of Biology, Carleton University, Ottawa, Ontario
ABSTRACT
J. Exp. Zool. 323A:375–381, 2015
During periods of environmental stress a number of different anuran species employ adaptive strategies to promote survival. Our study found that in response to dehydration (i.e., loss of total body water content), the African clawed frog (Xenopus laevis) increased the expression of a novel gene (drp10) that encodes a structural homolog of the freeze-responsive FR10 protein found in wood frogs. Similar to FR10, the DRP10 protein was found to also contain a highly conserved N-terminal cleavable signal peptide. Furthermore, DRP10 was found to have high structural homology to the available crystal structures of type A and E apolipoproteins in Homo sapiens, and a type IV LS-12 anti-freeze protein in the longhorn sculpin, Myoxocephalus octodecemspinosis. In response to dehydration, the transcript expression of drp10 was found to increase 1.52 0.16-fold and 1.97 0.11-fold in response to medium (15%) and high (30%) dehydration stresses in the liver tissue of X. laevis, respectively, while drp10 expression increased 2.12 0.12-fold and 1.46 0.16-fold in kidney tissue. Although the molecular function of both dehydration-responsive DRP10 and the freeze-responsive FR10 have just begun to be elucidated, it is likely that both are frog-specific proteins that likely share a similar purpose during water-related stresses. J. Exp. Zool. 323A:375–381, 2015. © 2015 Wiley Periodicals, Inc. How to cite this article: Biggar KK, Biggar Y, Storey KB. 2015. Identification of a novel dehydration responsive gene, drp10, from the African clawed frog, Xenopus laevis. J. Exp. Zool. 323A:375–381.
INTRODUCTION A number of different species have the ability to employ adaptive strategies to respond to, and survive, unfavourable environments. The most well-known of these adaptive strategies is the use of hypometabolism (also known as metabolic rate depression) to decrease cellular energetic demands until the stress is removed (Storey and Storey, '92; Storey, 2010). To date, the use of hypometabolism as an adaptive strategy during periods of environmental stress is most well-known in animals and stresses found within the Northern hemisphere, including: hibernation (i.e., bats and squirrels), freezing (i.e., invertebrates, frogs, and hatchling turtles), and anoxia (i.e., invertebrates, frogs, and adult turtles) (Storey and Storey, 2007; Roufayel et al., 2011; Biggar et al., 2012; Wu et al., 2013a; Zhang et al., 2013; Biggar and Storey, 2014; Wu et al., 2014). Although these stresses are commonly associated with low-temperature adaptation, high
temperatures during the summer (or during the dry season) can also impose similar habitat restrictions to those seen in the above stresses; namely, a characteristic reduction in water and nutrient availability that can easily threaten organism survival. To adapt to such environmental stress, the African clawed frog (Xenopus laevis) is an example of an animal that utilizes hypometabolism
Correspondence to: Kenneth B. Storey, Institute of Biochemistry and Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, ON, K1S 5B6. E-mail: [email protected] Received 30 January 2015; Revised 25 February 2015; Accepted 4 March 2015 DOI: 10.1002/jez.1930 Published online 10 April 2015 in Wiley Online Library (wileyonlinelibrary.com).
© 2015 WILEY PERIODICALS, INC.
376 as an adaptation to survive the dry months of Southern African summers (Malik and Storey, 2009). The X. laevis frog is almost exclusively aquatic and therefore must be able to adapt to the seasonal drying of its habitat, surviving by either: (1) migrating to a distant body of water, or (2) by borrowing into the soil and entering a state of aestivation that is characterized by a drastic desiccation of their body water content (30% water loss) (Alexander and Bellerby, '38; Romspert, '75). Previous research has found that during periods of aestivation, X. laevis plasma urea levels have been found to dramatically increase 30-fold, accompanied by an increase in hematocrit and plasma glucose levels (Malik and Storey, 2009). Importantly, the elevated urea levels are an adaptation response that results in an increased osmolality that functions to resist body fluid loss and promote extracellular water uptake (Storey and Storey, 2012). At the molecular level, studies have only just begun to examine the molecular response of dehydration in X. laevis and have documented changes in several mitogen activated protein kinases (MAPKs) and antioxidant defenses (Malik and Storey, 2009). Furthermore, a recent study from our lab has implicated a role for dehydration-responsive microRNA regulation during aestivation, with a number of microRNAs involved in the regulation of solute carrier proteins and several proteins involved in MAPK signaling (Wu et al., 2013b). Although studies have begun to explore the molecular mechanisms involved in adapting cells to dehydration in X. laevis, many of the molecular mechanisms that regulate dehydration stress-response in X. laevis remains largely unexplored, with little known about the mechanisms that regulate survival in a reversible manner. Similar to the known dehydration and hypoxia components of aestivation, major components of freezing also include hypoxia (ischemia) and cellular dehydration (a result of reduced cell volume due to water loss to extracellular ice masses) (Storey, 2004). The wood frog, Rana sylvatica, is the most extensively studied of the freeze tolerant vertebrates and is capable of surviving the conversion of approximately 65% of total body water into extracellular ice (Cai and Storey, '97). Previous studies looking at freeze-responsive gene expression in wood frogs identified several freeze-responsive genes, including one gene encoding for a novel 10 kDa protein designated fr10 (Cai and Storey, '97). Tissue and stress-specific (freezing, dehydration, and anoxia) response of fr10 have been elucidated, but its protein function has remained elusive (Sullivan et al., 2015). However, the transgenic expression of FR10 in freeze-intolerant BmN cells has been found to significantly increase cellular freeze survival, suggesting that the function of FR10 is not species specific per se (Biggar et al., 2013). Previous structural homology modeling have also revealed that the FR10 protein displayed similar structural characteristics to an unnamed protein from X. laevis (GenBank accession BAA28618.1; herein named drp10). Interestingly, although similar in protein structure, both genes displayed very little amino acid or nucleotide similarity to each other (Sullivan et al., 2015). J. Exp. Zool.
BIGGAR ET AL. The present study explores the possibility that the novel X. laevis protein, DRP10, plays a dehydration responsive role in X. laevis and aims to begin identifying possible structurally conserved roles for these proteins in stress survival. As both drp10 and fr10 are currently only found in frogs, it is possible that these anuran-specific proteins share a conserved function during water-related stress.
MATERIALS AND METHODS Prediction of Protein Structure Structure prediction for DRP10 (GenBank accession BAA28618.1) was conducted using the QUARK method as outlined by Xu and Zhang (2012). QUARK is a top-ranked ab initio structure prediction program that uses atomic-level knowledge-based force field and replica-exchange Monte Carlo simulation to accurately generate protein structures. Following structure prediction, all protein models were protonated and optimized by energy minimization using the MMFF94s forcefield model in MOE software (v.2011.10) and validated using the ProQ-protein quality prediction server (Wallner and Elofsson, 2003). Solvent accessibility was determined using the PredictProtein server (Rost et al., 2004). Cellular localization of DRP10 was then predicted using PSORT II, a program that detects sorting signals in proteins and predicts their subcellular localization (Horton et al., 2007). Animal Treatment Procedures used for animal experiments were as previously described (Malik and Storey, 2009). Male X. laevis were received as donations from the University of Toronto, each with a body mass between 30 and 55 g. Control animals were kept in a dechlorinated water tank maintained at 22°C until use. For dehydration experiments, frogs were transferred to glass vacuum desiccators and placed on a sponge (to prevent contact with Silica-gel desiccant placed at the bottom) and water loss was monitored over 6–7 days until a target value of approximately either 15% (i.e., medium) or 30% (i.e., high) of total body water lost was reached. To determine water loss, frogs were removed from the buckets at intervals and quickly weighed. The percentage water loss of frogs was calculated as: % Changed ¼ ðWi Wd Þ=ðWi BWCi Þ 100% where Wi represents initial body weight, Wd represents dehydrated body weight, and BWCi represents mean body water content of frogs before experimentation in gram H2O per gram body mass. For tissue collections, control and dehydrated frogs were first euthanized by pithing. Both liver and kidney tissues were used in this study and were quickly dissected out of the frog, and placed in liquid nitrogen before long term storage at 80°C. Protocols for the care, experimentation, and euthanasia of the animals were approved by the Carleton University Animal
DEHYDRATION RESPONSIVE OF drp10 IN X. laevis
377
Care Committee in accordance with the guidelines established by the Canadian Council on Animal Care. RNA Isolation Briefly, 50 mg of tissue was homogenized in 1 mL of TrizolTm reagent using a Polytron PT1000 homogenizer, samples were then centrifuged at 10,000g for 15 min at 4°C. The aqueous layer containing total RNA was removed and transferred to an RNAsefree microcentrifuge tube and precipitated by the addition of 500 mL isopropanol. Samples were allowed to precipitate over a period of 10 min at RT, followed by a centrifugation at 10,000g for 15 min 4°C to pellet the RNA precipitant. RNA pellets were then washed twice with 70% ethanol, allowed to dry, then resuspended in 50 mL of RNAse-free ddH2O. RNA quality was assessed through by absorbance measurements at 260 and 280 nm, meanwhile RNA integrity were determined by RNA separation on 1% agarose gel stained with 2x SybrGreen I nucleic acid gel stain (Cat# S-7567, Life technologies) to visualize both 18S and 28S ribosomal RNA bands. Gene Expression A 5 mg aliquot of total RNA from each sample was diluted to 10 mL with RNAse-free ddH2O. For measurements of both drp10 and a-tubulin, 1 mL of 200 ng/mL oligo-dT (50 -TTTTTTTTTTTTTTTTTTTTTTV-30 ; V ¼A, G, or C) primer was added to each sample of diluted RNA. The samples were incubated in a thermal cycler for 5 min at 65°C. The mixture was then chilled on ice and to each sample, 4 mL of 5x first strand buffer (Cat# 28025-021, Invitrogen), 2 mL of 100 mM dithiothreitol (DTT) (Cat# 28025-021, Invitrogen), 1 mL of 25 mM dNTPs (Cat# DD0057, BioBasic), and 1 mL of M-MLV reverse transcriptase (Cat# 28025-021; Invitrogen) were added. Samples were then incubated for 45 min at 42°C for cDNA synthesis. The resulting cDNA was serial diluted to 103 and stored at 20°C. Following cDNA synthesis, PCR was used to amplify the drp10 and a-tubulin transcripts from each cDNA sample. Each PCR reaction consisted of 13.25 mL of RNAse-free ddH2O, 5 mL of diluted cDNA, 1.25 mL of 1.5 mM primer mixture (Table 1), 2.5 mL of 10 PCR buffer (Cat# N8080006, Invitrogen), 1.5 mL of 50 mM MgCl2, 0.5 mL of 25 mM dNTPs, and 1 mL of Taq polymerase, for a total volume of 25 mL. All PCR amplification cycles were as follows: an initial denaturation at 94°C for 7 min, followed by an
experimentally determined number of cycles; 94°C for 1 min, primer annealing at 60°C for 1 min, and elongation at 72°C for 1 min. The final elongation was at 72°C for 10 min. PCR products were held at 4°C after amplification. All PCR products were separated on 1% agarose gels stained with 2x SybrGreen I nucleic acid gel stain, visualized using the ChemiGenius imaging system under UV light and quantified using the associated GeneTools program (Syngene, Frederick, MD, USA). The bands from the most dilute cDNA sample that gave visible product were used for quantification purposes, ensuring that the products had not reached amplification saturation. The PCR products were then sequenced by BioBasic (Markham, ON). Statistics Band intensity was normalized against the intensity of the a-tubulin bands amplified from the same cDNA sample. Mean normalized band densities SEM were calculated for control and dehydrated samples and significance testing using an analysis of variance with a post hoc Student–Newman–Keuls test. Statistical difference was accepted if P < 0.05; all data are derived from multiple independent tissue extracts from different animals. All sequence alignments were carried out using DNAMAN (v.8) software.
RESULTS Sequence Conservation The DRP10 protein was first identified as a result of its 95.7% sequence identity, and 100% amino acid similarity (i.e., scoring based on amino acid properties), between amino acids 1 and 23 from the N-terminus of FR10 (consensus sequence: MKVLALVVLVIA þ SGLEAGVVKR). Alignment of the complete DRP10 amino acid sequence to FR10 found 36.7% sequence identity and 42.2% sequence similarity, whereas the nucleotide alignment was found to have 51.6% conservation (Fig. 1). Protein Structure Prediction Protein structure was predicted from the primary amino acid sequence present in GenBank accession BAA28618.1 (i.e., DRP10) from X. laevis using QUARK, and compared with the FR10 protein from R. sylvatica (Fig. 2) (Xu and Zhang, 2012; Biggar et al., 2013). The structure quality of the final DRP10 model was determined using the ProQ-protein quality
Table 1. Primers used in this study. Sequence (50 -30 )
Target gene drp10 a-tubulin
Forward Reverse Forward Reverse
GTCCCTGAGCTCATTCTATT TTTCCTCTGTCTGGGCTTTC AAGGAAGATGCTGCCAATAA GGTCACATTTCACCATCTGG
J. Exp. Zool.
378
BIGGAR ET AL.
Figure 1. Alignments between the (a) protein and (b) mRNA sequences of X. laevis DRP10 and R. sylvatica FR10. '|' represents conserved sequence, whereas ':' and '.' represent conservative and semi-conservative mutations, respectively. Alignments were carried out in DNAMAN (v.8).
J. Exp. Zool.
DEHYDRATION RESPONSIVE OF drp10 IN X. laevis
379
Figure 2. Predicted ab initio structure of novel stress-responsive proteins, (a) X. laevis DRP10 and (b) R. sylvatica FR10. (c) Both protein structures were aligned and overlaid to assess structural homology. Structures were predicted using Quark and optimized with MOE (v.2011.10).
prediction server, and found to have an LGscore of 2.32 (where LGscores > 1.5 indicate a good prediction) (Wallner and Elofsson, 2003). Finally, the DRP10 protein was protonated and optimized by energy minimization using MMFF94s forcefield model in MOE software (v.2011.10). Similar to previous findings for FR10, DRP10 was also predicted to contain a secretory signal peptide (residues 1–15), and have a high probability of an extracellular localization (77.8%) as estimated by PSORT II (Horton and Nakai, '97). Dehydration Response of drp10 Transcript Expression of drp10 transcripts were found to be dehydrationresponsive in both liver and kidney tissues (Fig. 3). When compared to control levels, the expression of drp10 transcripts increased significantly in liver tissue by 1.52 0.16 and 1.97 0.11-fold in response to medium and high dehydration, respectively (P < 0.05). In kidney tissue, the transcript expression of drp10 increased significantly to 2.21 0.12-fold in response to medium dehydration, when compared to control levels (P < 0.05). However, unlike liver, in kidney tissue drp10 expression was found to significantly decrease from medium dehydration levels, to only 1.46 0.16-fold higher than control levels in response to high dehydration, decreasing to 66% of medium dehydration expression levels (P < 0.05).
DISCUSSION Apart from X. laevis, many other anurans are able to survive various levels of dehydration stress that occur in response to changes in their habitat (Cannatella and de Sa, '93; Storey, 2012). For example, the chorus frog (Pseudacris triseriata), spring peeper (Pseudacris crucifer), and leopard frog (Rana pipiens) have all been documented to survive various length and severity of cellular dehydration (Churchill and Storey, '94; Hermes-Lima and Storey, '98; Edwards et al., 2004). In this regard, it is also well known that dehydration is a major component to freezing stress, resulting from the reduced cell volume due to water loss to extracellular ice masses. Previous studies into the freeze adaptation of the wood frog have identified several novel stress-responsive genes, namely fr10, fr47, and li16 (Cai and Storey, '97; McNally et al., 2002; McNally et al., 2003). These proteins were each found to respond to periods of freezing, as well as the component stresses of anoxia and dehydration. Furthermore, the transfection of either fr10 or li16 to freeze-intolerant insect BmN cells (from Bombyx mori) were found to impart freeze tolerance, suggesting a survival function for these proteins that was independent of the cell type or host species (Biggar et al., 2013). To date, no homologous proteins have been found to any of these novel R. sylvatica proteins, with the exception of a partial sequence homology to fr10 with an unnamed protein (identified in this study as DRP10) within X. laevis (Sullivan et al., 2015). J. Exp. Zool.
380
Figure 3. RT-PCR analysis showing the effects of medium (15%) and high (30%) dehydration on drp10 mRNA transcript levels in select tissues of the X. laevis. (a) Histogram shows mean values ( SEM, n ¼ 4–5 independent determinations) for drp10. (b) Representative drp10 and a-tubulin bands. Data were analyzed using analysis of variance with a post hoc Student–Newman– Keuls test where 'a' indicates significant difference between indicated stress and control, and 'b' indicates significant difference between medium and high dehydration stresses.
Following the structural modeling of FR10 in 2013, we began to explore the possibility of DRP10 also playing a stressresponsive role in X. laevis (Biggar et al., 2013). Interestingly, despite their low sequence homology, both FR10 and DRP10 were found to be stress-responsive frog proteins and are structural homologs (Fig. 2). Although uncommon, conserved protein structure regardless of sequence conservation is known to occur within the cell. For example, despite low sequence homology the p-Tyr binding SH2 domains are known to have similar structure and function (Kaneko et al., 2012). Regardless of low sequence similarity, nearly perfect conservation was identified for an N-terminal signal peptide present in both FR10 and DRP10 protein. This highly conserved peptide is thought to target proteins to the secretory pathway (Von Heijne, '85). Indeed, previous studies have supported this finding by documenting the extracellular presence of FR10 in transfected cells (Biggar et al., 2013). Furthermore, BLAST analysis of the signal peptide sequence also identified similar peptides within J. Exp. Zool.
BIGGAR ET AL. apolipoprotein A2 present in amphibians and reptiles. Importantly, the identification of this signal peptide within apolipoproteins may provide a clue into the function, or evolutionary past, of both FR10 and DRP10 proteins. In this regard, previous research had identified the structure of FR10 was similar to that of anti-freeze proteins (AFPs) and apolipoproteins (Sullivan et al., 2015). Results from this study have shown that DRP10 is closely aligned with that of FR10 and the type IV AFP LS-12. Additionally, DRP10 protein was found to be more structurally similar to apolipoproteins A and E, when compared to type 1, 2, 3, and 5 AFPs. When compared to DRP10, the rootmean-squared deviation (RMSD) was found to 0.28 Å for ApoE3 (H. sapiens), 0.30 Å for ApoE2 (H. sapiens), 0.57 Å for ApoA1 (H. sapiens), 0.39 Å for ApoA4 (H. sapiens), 0.27 Å for the type IV AFP LS-12 (M. octodecemspinosis), and 0.18 Å for FR10 (R. sylvatica) protein (Sullivan et al., 2015). Given the high degree of structural homology, it is possible that DRP10 and FR10 have similar function to apolipoproteins, or form similar homo-complexes to facilitate its dehydrationrelated function. To obtain information regarding the stress-response of drp10, mRNA levels were observed in X. laevis under either medium (15%) or high (30%) dehydration stress. Figure 3 shows that dehydration resulted in a tissue-specific increase in both liver and kidney tissues. In liver tissue, medium dehydration increased the transcript expression of drp10 by 1.5-fold, whereas high dehydration further increased expression by twofold compared to control values. Kidney tissue displayed a different stressresponsive pattern of drp10 expression; medium dehydration resulted in a 2.2-fold increase, whereas high dehydration decreased drp10 expression 34% from medium dehydration levels and approximately 1.5-fold greater than control values. Similar to drp10, fr10 transcription expression in R. sylvatica have also been shown to be responsive to dehydration stress in an organ-specific manner (Cai and Storey, '97). As hypothesized, the results clearly demonstrate that drp10 expression is dehydration-responsive in X. laevis, displaying expression patterns that are tissue specific. It is possible that drp10 expression may be a defensive response to deal with early onset of dehydration in a tissue-specific manner. Indeed the defense of organ water content during dehydration has been shown to be highly organ-specific (Constanzo et al., 1992). The overall function of novel X. laevis DRP10 protein still remains unknown, however, by examining its pattern of expression and structural features, several characteristics have become evident. The expression of drp10 is dehydrationresponsive, and likely has extracellular roles similar to that of FR10, or perhaps select apolipoproteins. Given that all anurans have wide tolerances to changes in body hydration and osmolality, perhaps these proteins represent a novel class of anuran proteins present in amphibians that function to defend water content in key organs, however further study would be
DEHYDRATION RESPONSIVE OF drp10 IN X. laevis required to obtain any true functional insight. In the future, it is possible that DRP10 will provide valuable insight to improve dehydration tolerance in human cells and organs.
LITERATURE CITED Alexander SS, Bellerby CW. 1938. Experimental studies on the sexual cycle of the South African clawed toad (Xenopus laevis). J Exp Biol 15:74–81. Biggar KK, Kornfeld SF, Storey KB. 2012. Suppression of muscle disuse atrophy during mammalian hibernation: microRNA regulation in the skeletal muscle of Myotis lucifugus. Genom Proteom Bioinform 10:295–301. Biggar KK, Kotani E, Furusawa T, Storey KB. 2013. Expression of freeze-responsive proteins, FR10 and Li16, from freeze-tolerant frogs enhances freezing survival of BmN insect cells. FASEB J 27:3376–3383. Biggar KK, Storey KB. 2014. Identification and expression of microRNA in the brain of hibernating bats, Myotis lucifugus. Gene 544:67–74. Cai Q, Storey KB. 1997. Upregulation of a novel gene by freezing exposure in the freeze-tolerant wood frog (Rana sylvatica). Gene 198:305–312. Cannatella DC, de Sa RO. 1993. Xenopus laevis as a model organism. Syst Biol 42:476–507. Churchill T, Storey KB. 1994. Effects of dehydration on organ metabolism in the frog Pseudacris crucifer: hyperglycemic responses to dehydration mimic freezing-induced cryoprotectant production. J Comp Physiol B 164:492–498. Edwards JR, Jenkins JL, Swanson DL. 2004. Seasonal effects of dehydration on glucose mobilization in freeze-tolerant chorus frogs (Pseudacris triseriata) and freeze-intolerant toads (Bufo woodhousii and B. cognatus). J Exp Zool A Comp Exp Biol 301:521–531. Hermes-Lima M, Storey KB. 1998. Role of antioxidant defenses in the tolerance of severe dehydration by anurans. The case of the leopard frog Rana pipiens. Mol Cell Biochem 189:79–89. Horton P, Nakai K. 1997. Better prediction of protein cellular localization sites with the k nearest neighbors classifier. Proc Int Conf Intell Syst Mol Biol 5:147–152. Horton P, Park KJ, Obayashi T, et al. 2007. WoLF PSORT: protein localization predictor. Nucleic Acids Res 35:585–587. Kaneko T, Joshi R, Feller SM, Li SSC. 2012. Phosphotyrosine recognition domains: the typical, the atypical and the versatile. Cell Commun Signal 10:32. Malik AI, Storey KB. 2009. Activation of extracellular signal-regulated kinases during dehydration in the African clawed frog, Xenopus laevis. J Exp Biol 212:2595–2603. McNally J, Wu S, Sturgeon C, Storey KB. 2002. Identification and characterization of a novel freeze-inducible gene, li16, in the wood frog, Rana sylvatica. FASEB J 16:902–904.
381 McNally J, Sturgeon C, Storey KB. 2003. Freeze-induced expression of a novel gene, fr47, in the liver of the freeze-tolerant wood frog, Rana sylvatica. Biochim Biophys Acta 1625:183–191. Romspert AP. 1975. Osmoregulation of the African clawed frog, Xenopus laevis, in hypersaline media. Comp Biochem Physiol 54A:207–210. Rost B, Yachdav G, Liu J. 2004. The PredictProtein server. Nucleic Acids Res 32:W321–W326. Roufayel R, Biggar KK, Storey KB. 2011. Regulation of cell cycle components during exposure to anoxic and dehydration stress in the wood frog, Rana sylvatica. J Exp Zool A 315:487–494. Storey KB. 2004. Strategies for exploration of freeze responsive gene expression: advances in vertebrate freeze tolerance. Cryobiology 48:134–145. Storey KB. 2010. Out cold: biochemical regulation of mammalian hibernation — a minireview. Gerontology 56:220–230. Storey KB, Storey JM. 1992. Natural freeze tolerance in ectothermic vertebrates. Annu Rev Physiol 54:916–937. Storey KB, Storey JM. 2007. Tribute to P.L. Lutz: putting life on ‘pause’ – molecular regulation of hypometabolism. J Exp Biol 210:1700–1714. Storey KB, Storey JM. 2012. Aestivation: signaling and hypometabolism. J Exp Biol 215:1425–1433. Sullivan KJ, Biggar KK, Storey KB. 2015. Transcript expression of the freeze responsive gene fr10 in Rana sylvatica during freezing, anoxia, dehydration, and development. Mol Cell Biochem 399: 17–25. Von Heijne G. 1985. Signal sequences: the limits of variation. J Mol Biol 184:99–105. Wallner B, Elofsson A. 2003. Can correct protein models be identified? Protein Sci 12:1073–1086. Wu CW, Biggar KK, Storey KB. 2013a. Biochemical adaptations of mammalian hibernation: exploring the thirteen-lined ground squirrel as a perspective model for naturally induced reversible insulin resistance. Braz J Med Biol Res 46:1–13. Wu CW, Biggar KK, Storey KB. 2013b. Dehydration mediated microRNA response in the African clawed frog Xenopus laevis. Gene 529:269–275. Wu CW, Biggar KK, Storey KB. 2014. Expression profiling and structural characterization of microRNAs in adipose tissues of hibernating ground squirrels. Genom Proteom Bioinform 12:284– 291. Xu D, Zhang Y. 2012. Ab initio protein structure assembly using continuous structure fragments and optimized knowledge-based force field. Proteins 80:1715–1735. Zhang J, Biggar KK, Storey KB. 2013. Regulation of p53 by reversible post-transcriptional and post translational mechanisms in liver and skeletal muscle of anoxia tolerant turtle, Trachemys scripta elegans. Gene 513:147–155.
J. Exp. Zool.
Identification of a Novel Dehydration Responsive Gene, drp10, From the African Clawed Frog, Xenopus laevis KYLE K. BIGGAR, YULIA BIGGAR, AND KENNETH B. STOREY* Institute of Biochemistry and Department of Biology, Carleton University, Ottawa, Ontario
ABSTRACT
J. Exp. Zool. 323A:375–381, 2015
During periods of environmental stress a number of different anuran species employ adaptive strategies to promote survival. Our study found that in response to dehydration (i.e., loss of total body water content), the African clawed frog (Xenopus laevis) increased the expression of a novel gene (drp10) that encodes a structural homolog of the freeze-responsive FR10 protein found in wood frogs. Similar to FR10, the DRP10 protein was found to also contain a highly conserved N-terminal cleavable signal peptide. Furthermore, DRP10 was found to have high structural homology to the available crystal structures of type A and E apolipoproteins in Homo sapiens, and a type IV LS-12 anti-freeze protein in the longhorn sculpin, Myoxocephalus octodecemspinosis. In response to dehydration, the transcript expression of drp10 was found to increase 1.52 0.16-fold and 1.97 0.11-fold in response to medium (15%) and high (30%) dehydration stresses in the liver tissue of X. laevis, respectively, while drp10 expression increased 2.12 0.12-fold and 1.46 0.16-fold in kidney tissue. Although the molecular function of both dehydration-responsive DRP10 and the freeze-responsive FR10 have just begun to be elucidated, it is likely that both are frog-specific proteins that likely share a similar purpose during water-related stresses. J. Exp. Zool. 323A:375–381, 2015. © 2015 Wiley Periodicals, Inc. How to cite this article: Biggar KK, Biggar Y, Storey KB. 2015. Identification of a novel dehydration responsive gene, drp10, from the African clawed frog, Xenopus laevis. J. Exp. Zool. 323A:375–381.
INTRODUCTION A number of different species have the ability to employ adaptive strategies to respond to, and survive, unfavourable environments. The most well-known of these adaptive strategies is the use of hypometabolism (also known as metabolic rate depression) to decrease cellular energetic demands until the stress is removed (Storey and Storey, '92; Storey, 2010). To date, the use of hypometabolism as an adaptive strategy during periods of environmental stress is most well-known in animals and stresses found within the Northern hemisphere, including: hibernation (i.e., bats and squirrels), freezing (i.e., invertebrates, frogs, and hatchling turtles), and anoxia (i.e., invertebrates, frogs, and adult turtles) (Storey and Storey, 2007; Roufayel et al., 2011; Biggar et al., 2012; Wu et al., 2013a; Zhang et al., 2013; Biggar and Storey, 2014; Wu et al., 2014). Although these stresses are commonly associated with low-temperature adaptation, high
temperatures during the summer (or during the dry season) can also impose similar habitat restrictions to those seen in the above stresses; namely, a characteristic reduction in water and nutrient availability that can easily threaten organism survival. To adapt to such environmental stress, the African clawed frog (Xenopus laevis) is an example of an animal that utilizes hypometabolism
Correspondence to: Kenneth B. Storey, Institute of Biochemistry and Department of Biology, Carleton University, 1125 Colonel By Drive, Ottawa, ON, K1S 5B6. E-mail: [email protected] Received 30 January 2015; Revised 25 February 2015; Accepted 4 March 2015 DOI: 10.1002/jez.1930 Published online 10 April 2015 in Wiley Online Library (wileyonlinelibrary.com).
© 2015 WILEY PERIODICALS, INC.
376 as an adaptation to survive the dry months of Southern African summers (Malik and Storey, 2009). The X. laevis frog is almost exclusively aquatic and therefore must be able to adapt to the seasonal drying of its habitat, surviving by either: (1) migrating to a distant body of water, or (2) by borrowing into the soil and entering a state of aestivation that is characterized by a drastic desiccation of their body water content (30% water loss) (Alexander and Bellerby, '38; Romspert, '75). Previous research has found that during periods of aestivation, X. laevis plasma urea levels have been found to dramatically increase 30-fold, accompanied by an increase in hematocrit and plasma glucose levels (Malik and Storey, 2009). Importantly, the elevated urea levels are an adaptation response that results in an increased osmolality that functions to resist body fluid loss and promote extracellular water uptake (Storey and Storey, 2012). At the molecular level, studies have only just begun to examine the molecular response of dehydration in X. laevis and have documented changes in several mitogen activated protein kinases (MAPKs) and antioxidant defenses (Malik and Storey, 2009). Furthermore, a recent study from our lab has implicated a role for dehydration-responsive microRNA regulation during aestivation, with a number of microRNAs involved in the regulation of solute carrier proteins and several proteins involved in MAPK signaling (Wu et al., 2013b). Although studies have begun to explore the molecular mechanisms involved in adapting cells to dehydration in X. laevis, many of the molecular mechanisms that regulate dehydration stress-response in X. laevis remains largely unexplored, with little known about the mechanisms that regulate survival in a reversible manner. Similar to the known dehydration and hypoxia components of aestivation, major components of freezing also include hypoxia (ischemia) and cellular dehydration (a result of reduced cell volume due to water loss to extracellular ice masses) (Storey, 2004). The wood frog, Rana sylvatica, is the most extensively studied of the freeze tolerant vertebrates and is capable of surviving the conversion of approximately 65% of total body water into extracellular ice (Cai and Storey, '97). Previous studies looking at freeze-responsive gene expression in wood frogs identified several freeze-responsive genes, including one gene encoding for a novel 10 kDa protein designated fr10 (Cai and Storey, '97). Tissue and stress-specific (freezing, dehydration, and anoxia) response of fr10 have been elucidated, but its protein function has remained elusive (Sullivan et al., 2015). However, the transgenic expression of FR10 in freeze-intolerant BmN cells has been found to significantly increase cellular freeze survival, suggesting that the function of FR10 is not species specific per se (Biggar et al., 2013). Previous structural homology modeling have also revealed that the FR10 protein displayed similar structural characteristics to an unnamed protein from X. laevis (GenBank accession BAA28618.1; herein named drp10). Interestingly, although similar in protein structure, both genes displayed very little amino acid or nucleotide similarity to each other (Sullivan et al., 2015). J. Exp. Zool.
BIGGAR ET AL. The present study explores the possibility that the novel X. laevis protein, DRP10, plays a dehydration responsive role in X. laevis and aims to begin identifying possible structurally conserved roles for these proteins in stress survival. As both drp10 and fr10 are currently only found in frogs, it is possible that these anuran-specific proteins share a conserved function during water-related stress.
MATERIALS AND METHODS Prediction of Protein Structure Structure prediction for DRP10 (GenBank accession BAA28618.1) was conducted using the QUARK method as outlined by Xu and Zhang (2012). QUARK is a top-ranked ab initio structure prediction program that uses atomic-level knowledge-based force field and replica-exchange Monte Carlo simulation to accurately generate protein structures. Following structure prediction, all protein models were protonated and optimized by energy minimization using the MMFF94s forcefield model in MOE software (v.2011.10) and validated using the ProQ-protein quality prediction server (Wallner and Elofsson, 2003). Solvent accessibility was determined using the PredictProtein server (Rost et al., 2004). Cellular localization of DRP10 was then predicted using PSORT II, a program that detects sorting signals in proteins and predicts their subcellular localization (Horton et al., 2007). Animal Treatment Procedures used for animal experiments were as previously described (Malik and Storey, 2009). Male X. laevis were received as donations from the University of Toronto, each with a body mass between 30 and 55 g. Control animals were kept in a dechlorinated water tank maintained at 22°C until use. For dehydration experiments, frogs were transferred to glass vacuum desiccators and placed on a sponge (to prevent contact with Silica-gel desiccant placed at the bottom) and water loss was monitored over 6–7 days until a target value of approximately either 15% (i.e., medium) or 30% (i.e., high) of total body water lost was reached. To determine water loss, frogs were removed from the buckets at intervals and quickly weighed. The percentage water loss of frogs was calculated as: % Changed ¼ ðWi Wd Þ=ðWi BWCi Þ 100% where Wi represents initial body weight, Wd represents dehydrated body weight, and BWCi represents mean body water content of frogs before experimentation in gram H2O per gram body mass. For tissue collections, control and dehydrated frogs were first euthanized by pithing. Both liver and kidney tissues were used in this study and were quickly dissected out of the frog, and placed in liquid nitrogen before long term storage at 80°C. Protocols for the care, experimentation, and euthanasia of the animals were approved by the Carleton University Animal
DEHYDRATION RESPONSIVE OF drp10 IN X. laevis
377
Care Committee in accordance with the guidelines established by the Canadian Council on Animal Care. RNA Isolation Briefly, 50 mg of tissue was homogenized in 1 mL of TrizolTm reagent using a Polytron PT1000 homogenizer, samples were then centrifuged at 10,000g for 15 min at 4°C. The aqueous layer containing total RNA was removed and transferred to an RNAsefree microcentrifuge tube and precipitated by the addition of 500 mL isopropanol. Samples were allowed to precipitate over a period of 10 min at RT, followed by a centrifugation at 10,000g for 15 min 4°C to pellet the RNA precipitant. RNA pellets were then washed twice with 70% ethanol, allowed to dry, then resuspended in 50 mL of RNAse-free ddH2O. RNA quality was assessed through by absorbance measurements at 260 and 280 nm, meanwhile RNA integrity were determined by RNA separation on 1% agarose gel stained with 2x SybrGreen I nucleic acid gel stain (Cat# S-7567, Life technologies) to visualize both 18S and 28S ribosomal RNA bands. Gene Expression A 5 mg aliquot of total RNA from each sample was diluted to 10 mL with RNAse-free ddH2O. For measurements of both drp10 and a-tubulin, 1 mL of 200 ng/mL oligo-dT (50 -TTTTTTTTTTTTTTTTTTTTTTV-30 ; V ¼A, G, or C) primer was added to each sample of diluted RNA. The samples were incubated in a thermal cycler for 5 min at 65°C. The mixture was then chilled on ice and to each sample, 4 mL of 5x first strand buffer (Cat# 28025-021, Invitrogen), 2 mL of 100 mM dithiothreitol (DTT) (Cat# 28025-021, Invitrogen), 1 mL of 25 mM dNTPs (Cat# DD0057, BioBasic), and 1 mL of M-MLV reverse transcriptase (Cat# 28025-021; Invitrogen) were added. Samples were then incubated for 45 min at 42°C for cDNA synthesis. The resulting cDNA was serial diluted to 103 and stored at 20°C. Following cDNA synthesis, PCR was used to amplify the drp10 and a-tubulin transcripts from each cDNA sample. Each PCR reaction consisted of 13.25 mL of RNAse-free ddH2O, 5 mL of diluted cDNA, 1.25 mL of 1.5 mM primer mixture (Table 1), 2.5 mL of 10 PCR buffer (Cat# N8080006, Invitrogen), 1.5 mL of 50 mM MgCl2, 0.5 mL of 25 mM dNTPs, and 1 mL of Taq polymerase, for a total volume of 25 mL. All PCR amplification cycles were as follows: an initial denaturation at 94°C for 7 min, followed by an
experimentally determined number of cycles; 94°C for 1 min, primer annealing at 60°C for 1 min, and elongation at 72°C for 1 min. The final elongation was at 72°C for 10 min. PCR products were held at 4°C after amplification. All PCR products were separated on 1% agarose gels stained with 2x SybrGreen I nucleic acid gel stain, visualized using the ChemiGenius imaging system under UV light and quantified using the associated GeneTools program (Syngene, Frederick, MD, USA). The bands from the most dilute cDNA sample that gave visible product were used for quantification purposes, ensuring that the products had not reached amplification saturation. The PCR products were then sequenced by BioBasic (Markham, ON). Statistics Band intensity was normalized against the intensity of the a-tubulin bands amplified from the same cDNA sample. Mean normalized band densities SEM were calculated for control and dehydrated samples and significance testing using an analysis of variance with a post hoc Student–Newman–Keuls test. Statistical difference was accepted if P < 0.05; all data are derived from multiple independent tissue extracts from different animals. All sequence alignments were carried out using DNAMAN (v.8) software.
RESULTS Sequence Conservation The DRP10 protein was first identified as a result of its 95.7% sequence identity, and 100% amino acid similarity (i.e., scoring based on amino acid properties), between amino acids 1 and 23 from the N-terminus of FR10 (consensus sequence: MKVLALVVLVIA þ SGLEAGVVKR). Alignment of the complete DRP10 amino acid sequence to FR10 found 36.7% sequence identity and 42.2% sequence similarity, whereas the nucleotide alignment was found to have 51.6% conservation (Fig. 1). Protein Structure Prediction Protein structure was predicted from the primary amino acid sequence present in GenBank accession BAA28618.1 (i.e., DRP10) from X. laevis using QUARK, and compared with the FR10 protein from R. sylvatica (Fig. 2) (Xu and Zhang, 2012; Biggar et al., 2013). The structure quality of the final DRP10 model was determined using the ProQ-protein quality
Table 1. Primers used in this study. Sequence (50 -30 )
Target gene drp10 a-tubulin
Forward Reverse Forward Reverse
GTCCCTGAGCTCATTCTATT TTTCCTCTGTCTGGGCTTTC AAGGAAGATGCTGCCAATAA GGTCACATTTCACCATCTGG
J. Exp. Zool.
378
BIGGAR ET AL.
Figure 1. Alignments between the (a) protein and (b) mRNA sequences of X. laevis DRP10 and R. sylvatica FR10. '|' represents conserved sequence, whereas ':' and '.' represent conservative and semi-conservative mutations, respectively. Alignments were carried out in DNAMAN (v.8).
J. Exp. Zool.
DEHYDRATION RESPONSIVE OF drp10 IN X. laevis
379
Figure 2. Predicted ab initio structure of novel stress-responsive proteins, (a) X. laevis DRP10 and (b) R. sylvatica FR10. (c) Both protein structures were aligned and overlaid to assess structural homology. Structures were predicted using Quark and optimized with MOE (v.2011.10).
prediction server, and found to have an LGscore of 2.32 (where LGscores > 1.5 indicate a good prediction) (Wallner and Elofsson, 2003). Finally, the DRP10 protein was protonated and optimized by energy minimization using MMFF94s forcefield model in MOE software (v.2011.10). Similar to previous findings for FR10, DRP10 was also predicted to contain a secretory signal peptide (residues 1–15), and have a high probability of an extracellular localization (77.8%) as estimated by PSORT II (Horton and Nakai, '97). Dehydration Response of drp10 Transcript Expression of drp10 transcripts were found to be dehydrationresponsive in both liver and kidney tissues (Fig. 3). When compared to control levels, the expression of drp10 transcripts increased significantly in liver tissue by 1.52 0.16 and 1.97 0.11-fold in response to medium and high dehydration, respectively (P < 0.05). In kidney tissue, the transcript expression of drp10 increased significantly to 2.21 0.12-fold in response to medium dehydration, when compared to control levels (P < 0.05). However, unlike liver, in kidney tissue drp10 expression was found to significantly decrease from medium dehydration levels, to only 1.46 0.16-fold higher than control levels in response to high dehydration, decreasing to 66% of medium dehydration expression levels (P < 0.05).
DISCUSSION Apart from X. laevis, many other anurans are able to survive various levels of dehydration stress that occur in response to changes in their habitat (Cannatella and de Sa, '93; Storey, 2012). For example, the chorus frog (Pseudacris triseriata), spring peeper (Pseudacris crucifer), and leopard frog (Rana pipiens) have all been documented to survive various length and severity of cellular dehydration (Churchill and Storey, '94; Hermes-Lima and Storey, '98; Edwards et al., 2004). In this regard, it is also well known that dehydration is a major component to freezing stress, resulting from the reduced cell volume due to water loss to extracellular ice masses. Previous studies into the freeze adaptation of the wood frog have identified several novel stress-responsive genes, namely fr10, fr47, and li16 (Cai and Storey, '97; McNally et al., 2002; McNally et al., 2003). These proteins were each found to respond to periods of freezing, as well as the component stresses of anoxia and dehydration. Furthermore, the transfection of either fr10 or li16 to freeze-intolerant insect BmN cells (from Bombyx mori) were found to impart freeze tolerance, suggesting a survival function for these proteins that was independent of the cell type or host species (Biggar et al., 2013). To date, no homologous proteins have been found to any of these novel R. sylvatica proteins, with the exception of a partial sequence homology to fr10 with an unnamed protein (identified in this study as DRP10) within X. laevis (Sullivan et al., 2015). J. Exp. Zool.
380
Figure 3. RT-PCR analysis showing the effects of medium (15%) and high (30%) dehydration on drp10 mRNA transcript levels in select tissues of the X. laevis. (a) Histogram shows mean values ( SEM, n ¼ 4–5 independent determinations) for drp10. (b) Representative drp10 and a-tubulin bands. Data were analyzed using analysis of variance with a post hoc Student–Newman– Keuls test where 'a' indicates significant difference between indicated stress and control, and 'b' indicates significant difference between medium and high dehydration stresses.
Following the structural modeling of FR10 in 2013, we began to explore the possibility of DRP10 also playing a stressresponsive role in X. laevis (Biggar et al., 2013). Interestingly, despite their low sequence homology, both FR10 and DRP10 were found to be stress-responsive frog proteins and are structural homologs (Fig. 2). Although uncommon, conserved protein structure regardless of sequence conservation is known to occur within the cell. For example, despite low sequence homology the p-Tyr binding SH2 domains are known to have similar structure and function (Kaneko et al., 2012). Regardless of low sequence similarity, nearly perfect conservation was identified for an N-terminal signal peptide present in both FR10 and DRP10 protein. This highly conserved peptide is thought to target proteins to the secretory pathway (Von Heijne, '85). Indeed, previous studies have supported this finding by documenting the extracellular presence of FR10 in transfected cells (Biggar et al., 2013). Furthermore, BLAST analysis of the signal peptide sequence also identified similar peptides within J. Exp. Zool.
BIGGAR ET AL. apolipoprotein A2 present in amphibians and reptiles. Importantly, the identification of this signal peptide within apolipoproteins may provide a clue into the function, or evolutionary past, of both FR10 and DRP10 proteins. In this regard, previous research had identified the structure of FR10 was similar to that of anti-freeze proteins (AFPs) and apolipoproteins (Sullivan et al., 2015). Results from this study have shown that DRP10 is closely aligned with that of FR10 and the type IV AFP LS-12. Additionally, DRP10 protein was found to be more structurally similar to apolipoproteins A and E, when compared to type 1, 2, 3, and 5 AFPs. When compared to DRP10, the rootmean-squared deviation (RMSD) was found to 0.28 Å for ApoE3 (H. sapiens), 0.30 Å for ApoE2 (H. sapiens), 0.57 Å for ApoA1 (H. sapiens), 0.39 Å for ApoA4 (H. sapiens), 0.27 Å for the type IV AFP LS-12 (M. octodecemspinosis), and 0.18 Å for FR10 (R. sylvatica) protein (Sullivan et al., 2015). Given the high degree of structural homology, it is possible that DRP10 and FR10 have similar function to apolipoproteins, or form similar homo-complexes to facilitate its dehydrationrelated function. To obtain information regarding the stress-response of drp10, mRNA levels were observed in X. laevis under either medium (15%) or high (30%) dehydration stress. Figure 3 shows that dehydration resulted in a tissue-specific increase in both liver and kidney tissues. In liver tissue, medium dehydration increased the transcript expression of drp10 by 1.5-fold, whereas high dehydration further increased expression by twofold compared to control values. Kidney tissue displayed a different stressresponsive pattern of drp10 expression; medium dehydration resulted in a 2.2-fold increase, whereas high dehydration decreased drp10 expression 34% from medium dehydration levels and approximately 1.5-fold greater than control values. Similar to drp10, fr10 transcription expression in R. sylvatica have also been shown to be responsive to dehydration stress in an organ-specific manner (Cai and Storey, '97). As hypothesized, the results clearly demonstrate that drp10 expression is dehydration-responsive in X. laevis, displaying expression patterns that are tissue specific. It is possible that drp10 expression may be a defensive response to deal with early onset of dehydration in a tissue-specific manner. Indeed the defense of organ water content during dehydration has been shown to be highly organ-specific (Constanzo et al., 1992). The overall function of novel X. laevis DRP10 protein still remains unknown, however, by examining its pattern of expression and structural features, several characteristics have become evident. The expression of drp10 is dehydrationresponsive, and likely has extracellular roles similar to that of FR10, or perhaps select apolipoproteins. Given that all anurans have wide tolerances to changes in body hydration and osmolality, perhaps these proteins represent a novel class of anuran proteins present in amphibians that function to defend water content in key organs, however further study would be
DEHYDRATION RESPONSIVE OF drp10 IN X. laevis required to obtain any true functional insight. In the future, it is possible that DRP10 will provide valuable insight to improve dehydration tolerance in human cells and organs.
LITERATURE CITED Alexander SS, Bellerby CW. 1938. Experimental studies on the sexual cycle of the South African clawed toad (Xenopus laevis). J Exp Biol 15:74–81. Biggar KK, Kornfeld SF, Storey KB. 2012. Suppression of muscle disuse atrophy during mammalian hibernation: microRNA regulation in the skeletal muscle of Myotis lucifugus. Genom Proteom Bioinform 10:295–301. Biggar KK, Kotani E, Furusawa T, Storey KB. 2013. Expression of freeze-responsive proteins, FR10 and Li16, from freeze-tolerant frogs enhances freezing survival of BmN insect cells. FASEB J 27:3376–3383. Biggar KK, Storey KB. 2014. Identification and expression of microRNA in the brain of hibernating bats, Myotis lucifugus. Gene 544:67–74. Cai Q, Storey KB. 1997. Upregulation of a novel gene by freezing exposure in the freeze-tolerant wood frog (Rana sylvatica). Gene 198:305–312. Cannatella DC, de Sa RO. 1993. Xenopus laevis as a model organism. Syst Biol 42:476–507. Churchill T, Storey KB. 1994. Effects of dehydration on organ metabolism in the frog Pseudacris crucifer: hyperglycemic responses to dehydration mimic freezing-induced cryoprotectant production. J Comp Physiol B 164:492–498. Edwards JR, Jenkins JL, Swanson DL. 2004. Seasonal effects of dehydration on glucose mobilization in freeze-tolerant chorus frogs (Pseudacris triseriata) and freeze-intolerant toads (Bufo woodhousii and B. cognatus). J Exp Zool A Comp Exp Biol 301:521–531. Hermes-Lima M, Storey KB. 1998. Role of antioxidant defenses in the tolerance of severe dehydration by anurans. The case of the leopard frog Rana pipiens. Mol Cell Biochem 189:79–89. Horton P, Nakai K. 1997. Better prediction of protein cellular localization sites with the k nearest neighbors classifier. Proc Int Conf Intell Syst Mol Biol 5:147–152. Horton P, Park KJ, Obayashi T, et al. 2007. WoLF PSORT: protein localization predictor. Nucleic Acids Res 35:585–587. Kaneko T, Joshi R, Feller SM, Li SSC. 2012. Phosphotyrosine recognition domains: the typical, the atypical and the versatile. Cell Commun Signal 10:32. Malik AI, Storey KB. 2009. Activation of extracellular signal-regulated kinases during dehydration in the African clawed frog, Xenopus laevis. J Exp Biol 212:2595–2603. McNally J, Wu S, Sturgeon C, Storey KB. 2002. Identification and characterization of a novel freeze-inducible gene, li16, in the wood frog, Rana sylvatica. FASEB J 16:902–904.
381 McNally J, Sturgeon C, Storey KB. 2003. Freeze-induced expression of a novel gene, fr47, in the liver of the freeze-tolerant wood frog, Rana sylvatica. Biochim Biophys Acta 1625:183–191. Romspert AP. 1975. Osmoregulation of the African clawed frog, Xenopus laevis, in hypersaline media. Comp Biochem Physiol 54A:207–210. Rost B, Yachdav G, Liu J. 2004. The PredictProtein server. Nucleic Acids Res 32:W321–W326. Roufayel R, Biggar KK, Storey KB. 2011. Regulation of cell cycle components during exposure to anoxic and dehydration stress in the wood frog, Rana sylvatica. J Exp Zool A 315:487–494. Storey KB. 2004. Strategies for exploration of freeze responsive gene expression: advances in vertebrate freeze tolerance. Cryobiology 48:134–145. Storey KB. 2010. Out cold: biochemical regulation of mammalian hibernation — a minireview. Gerontology 56:220–230. Storey KB, Storey JM. 1992. Natural freeze tolerance in ectothermic vertebrates. Annu Rev Physiol 54:916–937. Storey KB, Storey JM. 2007. Tribute to P.L. Lutz: putting life on ‘pause’ – molecular regulation of hypometabolism. J Exp Biol 210:1700–1714. Storey KB, Storey JM. 2012. Aestivation: signaling and hypometabolism. J Exp Biol 215:1425–1433. Sullivan KJ, Biggar KK, Storey KB. 2015. Transcript expression of the freeze responsive gene fr10 in Rana sylvatica during freezing, anoxia, dehydration, and development. Mol Cell Biochem 399: 17–25. Von Heijne G. 1985. Signal sequences: the limits of variation. J Mol Biol 184:99–105. Wallner B, Elofsson A. 2003. Can correct protein models be identified? Protein Sci 12:1073–1086. Wu CW, Biggar KK, Storey KB. 2013a. Biochemical adaptations of mammalian hibernation: exploring the thirteen-lined ground squirrel as a perspective model for naturally induced reversible insulin resistance. Braz J Med Biol Res 46:1–13. Wu CW, Biggar KK, Storey KB. 2013b. Dehydration mediated microRNA response in the African clawed frog Xenopus laevis. Gene 529:269–275. Wu CW, Biggar KK, Storey KB. 2014. Expression profiling and structural characterization of microRNAs in adipose tissues of hibernating ground squirrels. Genom Proteom Bioinform 12:284– 291. Xu D, Zhang Y. 2012. Ab initio protein structure assembly using continuous structure fragments and optimized knowledge-based force field. Proteins 80:1715–1735. Zhang J, Biggar KK, Storey KB. 2013. Regulation of p53 by reversible post-transcriptional and post translational mechanisms in liver and skeletal muscle of anoxia tolerant turtle, Trachemys scripta elegans. Gene 513:147–155.
J. Exp. Zool.
