© 1992 Oxford University Press
Human Molecular Genetics, Vol. 1, No. 1 61—62
Identification of a new nonsense mutation in the von Willebrand factor gene in patients with von Willebrand disease type Z.P.Zhang12, G.Falk2, M.BIomback2, N.Egberg2 and M.Anvret1* department of Clinical Genetics and Clinical Chemistry and Blood Coagulation, Karolinska Hospital, Stockholm, Sweden Submitted November 13, 1991
These observations demonstrate that the vWD type HI in some cases depend on a mutation causing a translation^ stop signal (a nonsense mutation). Continuing application of the described
• To whom correspondence should be addressed
approach should provide further insights into the molecular defects underlying vWD type HI and facilitate a precise diagnosis of the disease. 1 2 3 4 5 6 7 8 9
653 bp \ 492 bp 161 bp
Figure 1. Human genomic DNA isolated from leukocytes was amplified with PCR using the primers, 5'ATGGTTCTGGATGTGGCGTTC3', and 5'GTATCTTGGCAGATGCATGTAGC3'. The PCR conditions were 0.7 jig genomic DNA in 100 pi of 1.5 mM MgCl2. 10 mM Tris pH 8.3, 25 mM KC1, 200 jiM of each dNTP, 20 pM of each primer and 2 units of Taq polymerase (Perkin Elmer); 94°C for 3 min, 35 step cycles of 94°C for 1 min, 60°C for 1 min and 72°C for 1 min with a final 7 min at 72°C in Perkin Elmer Thermocycle 480. 10% of the PCR products were cleaved by Ddel and analyzed on a 2% agarose gel. Lane 1: *X174/HaeIII markers; Lane 2: 123 bp ladder markers; Lanes 3 and 9: control individuals; Lanes 4 and 8: vWD type III patients (heterozygous); Lane 5: vWD type III patient (homozygous); Lanes 6 and 7: vWD type I; parents (heterozygous) of lane 7.
AGCT
AGCT
B
AGCT
A B C
Figure 2. Sequence showing the R1659 mutation (C—T) of the vWF gene. The sequencing primer used is 5'GTATCTTGGCAGATGCATGTAGC3' A: control individual, same as lane 3 in Fig. 1; B: vWD type III patient, heterozygous for the mutation, same as lane 4 in Fig. 1; C: vWD type III patient, homozygous for the mutation, same as lane 5 in Fig. 1.
Downloaded from http://hmg.oxfordjournals.org/ at Old Dominion University on May 25, 2014
The von Willebrand factor (vWF) is a large multimeric plasma glycoprotein that is synthesized in endothelial cells and megacaryocytes (1). It serves as a carrier for the coagulation factor VIII and is necessary for platelet adhesion to collagen in the basal membranes of damaged endothelium. The human vWF gene, located on chromosome 12, spans approximately 178 kilobases (kb) and contains 52 exons which vary in length from 40 to 1379 basepairs (bp) (2). The von Willebrand disease (vWD) is a common inherited bleeding disorder in humans. It results from qualitative (type H) and quantitative (type I and type HI) defects of the vWF. Patients with vWD type III have very low to undetectable levels of the vWF antigen and represent the most severe form of the disease (1). Today very few mutations have been reported in the vWF gene (4). Biochemical and linkage analyses suggest that type III patients represent a homozygous or double (compound) heterozygous form of type I abnormality (5). Exon 28 of the vWF gene was screened for mutations because it is the largest exon and codes for protein domains involved in platelets, collagen and heparin binding (1). The approach was to detect CpG—CpT mutation. A single base substitution (C —T) in the R1659 (arginine) codon in exon 28 of the vWF gene was detected. This results in a stop codon and a new restriction site for the enzyme Ddel. We have analyzed this region using the polymerase chain reaction (PCR) technique on genomic DNA isolated from 26 vWD type HI patients (52 chromosomes) and 10 normal individuals (20 chromosomes). PCR primers were constructed from the vWF gene sequence by Mancuso et al. (2) for selective amplification of DNA from the authentic gene to avoid interference of the pseudogene. A partial vWF pseudogene corresponding to the mid portion of vWF cDNA is present on chromosome 22 (3). The amplified DNA fragment has a length of 653 bp and cleavage with Ddel generates two fragments in the presence of the mutation, 492 bp and 161 bp, respectively. Four out of the 52 chromosomes analyzed carry the mutation (8%). Among the 26 investigated patients three were found to have this mutation; one is homozygous and two are heterozygous. The normal and mutant alleles are present in the father and the mother (heterozygous state) of the homozygous patient (Fig. 1). Sequencing of single-stranded PCR products confirmed the C—T mutation (Fig. 2)
62 Human Molecular Genetics, Vol. 1, No. 1 ACKNOWLEDGEMENTS This work was supported from Kabi Pharmacia, Magnus. Bergvall and Ake Wiberg Foundations and Swedish Medical Research Council (No 520). We thank Margareta Tapper-Persson for technical assistance.
REFERENCES
Downloaded from http://hmg.oxfordjournals.org/ at Old Dominion University on May 25, 2014
1. Ruggeri,Z.M and Zimmerman.T.S. (1987) Blood 70, 895-90*. 2. Mancuso.D.J., Tuley.E.A., Westfield.L.A., Worrall.N.K., SheltonInloes.B.B., SoraceJ.M., Alevy.Y.G. and Sadler J.E. (1989)7. Bioi. Oiem. 264, 19514-19527. 3. Mancuso.D.J., Tuley.E.A., Westfield.L.A., Lester-Mancuso.T.L., Le Beau.M.M., SoraceJ.M. and SadlerJ.E. (1991) Biochemistry yd, 253-269. 4. LavergneJ.M., Bahnak.B.R., Rothschild.C. and Meyer.D. (1991) Thromb. Haemostas 65, 1125. 5. Ajivret.M., Blomack.M., Lindstedt.M., S6derlind,E., Tapper-Persson,M. and Thelander,A.-C. (1992) Human Genet., in press.
Human Molecular Genetics, Vol. 1, No. 1 61—62
Identification of a new nonsense mutation in the von Willebrand factor gene in patients with von Willebrand disease type Z.P.Zhang12, G.Falk2, M.BIomback2, N.Egberg2 and M.Anvret1* department of Clinical Genetics and Clinical Chemistry and Blood Coagulation, Karolinska Hospital, Stockholm, Sweden Submitted November 13, 1991
These observations demonstrate that the vWD type HI in some cases depend on a mutation causing a translation^ stop signal (a nonsense mutation). Continuing application of the described
• To whom correspondence should be addressed
approach should provide further insights into the molecular defects underlying vWD type HI and facilitate a precise diagnosis of the disease. 1 2 3 4 5 6 7 8 9
653 bp \ 492 bp 161 bp
Figure 1. Human genomic DNA isolated from leukocytes was amplified with PCR using the primers, 5'ATGGTTCTGGATGTGGCGTTC3', and 5'GTATCTTGGCAGATGCATGTAGC3'. The PCR conditions were 0.7 jig genomic DNA in 100 pi of 1.5 mM MgCl2. 10 mM Tris pH 8.3, 25 mM KC1, 200 jiM of each dNTP, 20 pM of each primer and 2 units of Taq polymerase (Perkin Elmer); 94°C for 3 min, 35 step cycles of 94°C for 1 min, 60°C for 1 min and 72°C for 1 min with a final 7 min at 72°C in Perkin Elmer Thermocycle 480. 10% of the PCR products were cleaved by Ddel and analyzed on a 2% agarose gel. Lane 1: *X174/HaeIII markers; Lane 2: 123 bp ladder markers; Lanes 3 and 9: control individuals; Lanes 4 and 8: vWD type III patients (heterozygous); Lane 5: vWD type III patient (homozygous); Lanes 6 and 7: vWD type I; parents (heterozygous) of lane 7.
AGCT
AGCT
B
AGCT
A B C
Figure 2. Sequence showing the R1659 mutation (C—T) of the vWF gene. The sequencing primer used is 5'GTATCTTGGCAGATGCATGTAGC3' A: control individual, same as lane 3 in Fig. 1; B: vWD type III patient, heterozygous for the mutation, same as lane 4 in Fig. 1; C: vWD type III patient, homozygous for the mutation, same as lane 5 in Fig. 1.
Downloaded from http://hmg.oxfordjournals.org/ at Old Dominion University on May 25, 2014
The von Willebrand factor (vWF) is a large multimeric plasma glycoprotein that is synthesized in endothelial cells and megacaryocytes (1). It serves as a carrier for the coagulation factor VIII and is necessary for platelet adhesion to collagen in the basal membranes of damaged endothelium. The human vWF gene, located on chromosome 12, spans approximately 178 kilobases (kb) and contains 52 exons which vary in length from 40 to 1379 basepairs (bp) (2). The von Willebrand disease (vWD) is a common inherited bleeding disorder in humans. It results from qualitative (type H) and quantitative (type I and type HI) defects of the vWF. Patients with vWD type III have very low to undetectable levels of the vWF antigen and represent the most severe form of the disease (1). Today very few mutations have been reported in the vWF gene (4). Biochemical and linkage analyses suggest that type III patients represent a homozygous or double (compound) heterozygous form of type I abnormality (5). Exon 28 of the vWF gene was screened for mutations because it is the largest exon and codes for protein domains involved in platelets, collagen and heparin binding (1). The approach was to detect CpG—CpT mutation. A single base substitution (C —T) in the R1659 (arginine) codon in exon 28 of the vWF gene was detected. This results in a stop codon and a new restriction site for the enzyme Ddel. We have analyzed this region using the polymerase chain reaction (PCR) technique on genomic DNA isolated from 26 vWD type HI patients (52 chromosomes) and 10 normal individuals (20 chromosomes). PCR primers were constructed from the vWF gene sequence by Mancuso et al. (2) for selective amplification of DNA from the authentic gene to avoid interference of the pseudogene. A partial vWF pseudogene corresponding to the mid portion of vWF cDNA is present on chromosome 22 (3). The amplified DNA fragment has a length of 653 bp and cleavage with Ddel generates two fragments in the presence of the mutation, 492 bp and 161 bp, respectively. Four out of the 52 chromosomes analyzed carry the mutation (8%). Among the 26 investigated patients three were found to have this mutation; one is homozygous and two are heterozygous. The normal and mutant alleles are present in the father and the mother (heterozygous state) of the homozygous patient (Fig. 1). Sequencing of single-stranded PCR products confirmed the C—T mutation (Fig. 2)
62 Human Molecular Genetics, Vol. 1, No. 1 ACKNOWLEDGEMENTS This work was supported from Kabi Pharmacia, Magnus. Bergvall and Ake Wiberg Foundations and Swedish Medical Research Council (No 520). We thank Margareta Tapper-Persson for technical assistance.
REFERENCES
Downloaded from http://hmg.oxfordjournals.org/ at Old Dominion University on May 25, 2014
1. Ruggeri,Z.M and Zimmerman.T.S. (1987) Blood 70, 895-90*. 2. Mancuso.D.J., Tuley.E.A., Westfield.L.A., Worrall.N.K., SheltonInloes.B.B., SoraceJ.M., Alevy.Y.G. and Sadler J.E. (1989)7. Bioi. Oiem. 264, 19514-19527. 3. Mancuso.D.J., Tuley.E.A., Westfield.L.A., Lester-Mancuso.T.L., Le Beau.M.M., SoraceJ.M. and SadlerJ.E. (1991) Biochemistry yd, 253-269. 4. LavergneJ.M., Bahnak.B.R., Rothschild.C. and Meyer.D. (1991) Thromb. Haemostas 65, 1125. 5. Ajivret.M., Blomack.M., Lindstedt.M., S6derlind,E., Tapper-Persson,M. and Thelander,A.-C. (1992) Human Genet., in press.
