Infection, Genetics and Evolution 23 (2014) 176–181

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

Identification of a new HIV-1 BC circulating recombinant form (CRF60_BC) in Italian young men having sex with men Francesco Roberto Simonetti a, Alessia Lai a,⇑, Laura Monno b, Francesca Binda a, Gaetano Brindicci b, Grazia Punzi b, Giorgio Bozzi a, Michela Violin a, Massimo Galli a, Maurizio Zazzi c, Gioacchino Angarano b, Claudia Balotta a a b c

Department of Biomedical and Clinical Sciences, Infectious Diseases and Immunopathology Section, ‘‘L. Sacco’’ Hospital, University of Milan, Italy Department of Biomedical Science and Human Oncology, University of Bari, Bari, Italy Department of Biotechnology, Section of Microbiology, University of Siena, Siena, Italy

a r t i c l e

i n f o

Article history: Received 8 November 2013 Received in revised form 14 February 2014 Accepted 17 February 2014 Available online 3 March 2014 Keywords: CRF60_BC Italian young MSM Recombination analysis

a b s t r a c t HIV-1 recombination, reverse transcriptase (RT) low fidelity and high replication rate are the drivers of variability and evolution on the global scale. Only few of these HIV-1 chimeric forms have been characterized in Europe, despite 20% of infections are due to unique or circulating recombinant forms worldwide. An outbreak of BC recombinants has been recently described in a southern region of Italy, Apulia, in men having sex with men (MSM) seeking sexual partners on-line. We analyzed the full length genome of HIV-1 BC recombinants harbored by three recently infected subjects, two MSM and a heterosexual woman, with no evidence of epidemiological link. The recombination analysis showed a unique recombination pattern of a subtype C genome with 3 subtype B fragments corresponding to HXB2 positions: [1–463] in the 50 LTR , [2804–3037] in RT and [8662–9548] corresponding to the C-terminal segment of gp41, nef and most of 30 LTR. Phylogenetic analysis revealed the South American origin of the C subtype parental strain. A research conducted in an Italian nationwide database provided six additional similar sequences from other Italian regions with identical recombination pattern in pol gene; a further BLAST search retrieved one full length genome isolated in France with the same mosaic pattern, except an additional B subtype short fragment in the integrase region. These recombinant isolates, designated CRF60_BC, led to the identification of the first Italian circulating recombinant form, which gave rise to an epidemic burst mainly involving MSM. Ó 2014 Elsevier B.V. All rights reserved.

1. Introduction Recombination, together with high mutation and replication rates, represents one of the most important drivers leading to the extreme HIV-1 variability and rapid evolution over time (Hu and Hughes, 2012). Regarding the population level, in some areas like Central Africa, South America and South Eastern Asia different pure subtypes and circulating recombinant forms (CRFs) co-circulate. Such regions act as recombination hot-spots which constantly spawn new unique recombinant forms (URFs). When URFs spread onwards and gain epidemiological relevance, they would be identified as new CRFs (Hemelaar, 2012a). As a whole, such ⇑ Corresponding author. Address: Department of Biomedical and Clinical Sciences, Section of Infectious Diseases and Immunopathology, ‘‘L. Sacco’’ Hospital, University of Milan, Via G.B. Grassi, 74, 20157 Milan, Italy. Tel.: +39 02 503 19775; fax: +39 02 503 19768. E-mail address: [email protected] (A. Lai). http://dx.doi.org/10.1016/j.meegid.2014.02.007 1567-1348/Ó 2014 Elsevier B.V. All rights reserved.

recombinants are responsible for at least 20% of global HIV-1 infections (Tebit and Arts, 2011). Among the 55 CRFs identified so far, only a few have been detected in European subjects and have demonstrated a limited diffusion: CRF03_AB and CRF32_06A1 in Eastern Europe, CRF04_cpx in Greece and Cyprus, CRF14_BG and CRF47_BF in Spain, CRF05_DF and CRF42_BF in Belgium and Luxembourg (Adojaan et al., 2005; Delgado and Thomson, 2002; Fernández-García et al., 2010; Gao et al., 1998; Hemelaar, 2012a; Laukkanen et al., 2000; Liitsola et al., 1998). In non-African CRFs, subtype B is almost always one of the parental strains, with the BF recombination pattern being the most frequently detected (Tebit and Arts, 2011). Circulating and unique BC recombinants have been identified in China where CRF07_BC and CRF08_BC originated and spread from the Yunnan province (Li et al., 2012) and in Brazil where CRF31_BC diffused from the Rio Grande area in which pure subtype C and BC viral chimeras

177

F.R. Simonetti et al. / Infection, Genetics and Evolution 23 (2014) 176–181 Table 1 Characteristics of three unrelated patients subjected to full length genome amplification and sequencing. Patient code

Gender

Year of birth

Country of rigin

Risk factor

Date of first positive HIV-1 test

Sample date

CD4 count (cells/lL and%)

HIV-RNA load (log10 cp/ mL)

CDC stage

Accession number

BAV-499

M

1987

Italy

MSM

September 2009

428–29

4.7

A

KC899079

BAV-514

M

1991

Italy

MSM

November 2009

1200–28

4.5

A

KC899080

BAV-636

F

1988

Italy

HE

June 2011

September 2011 September 2011 December 2011

597–24

3.7

A

KC899081

accounts for 70% of infections (Santos et al., 2006; Rodrigues et al.,2010). Italy, as other European countries, was characterized by a clade B restricted epidemic; however, due to migratory waves and traveling, currently non-B subtypes and recombinants represent 11.4% and 0.5–5% of HIV-1 infections, respectively (Lai et al., 2010; Hemelaar, 2012b). A recent Italian study characterized a cluster of young subjects residing in Southern Italy, mostly men having sex with men (MSM) (82%), who were recently infected with a HIV-1 BC recombinant featuring a unique recombination pattern within the pol region (Monno et al., 2012). This outbreak involved 22 individuals diagnosed between 2009 and 2011 in Apulia, an entry area of immigrants mainly from the Mediterranean basin. (Monno et al., 2005). Herein, full length genome sequences from three epidemiologically unrelated patients included in this outbreak were analyzed and a novel CRF was definitely identified which further increases the heterogeneity of the HIV epidemic and its potential impact on cell biology, clinical management and vaccine design (Hemelaar, 2012b). 2. Materials and methods 2.1. Patients Three individuals were selected among HIV-1 recently-infected subjects. They had no direct epidemiological link, based on the interview of their recent exposure history. The estimated age of infection was calculated by computing the fraction of ambiguous nucleotides in the protease-RT population sequences, as previously reported (Kouyos et al., 2011). These patients belong to a cluster of 22 subjects carrying BC recombinants, identified by means of sequence analysis of protease, RT, and integrase regions of the pol gene for baseline screening of transmitted drug resistance. 2.2. HIV-1 DNA extraction, amplification and sequencing PBMCs were separated from whole blood by the Ficoll gradient protocol and cell-associated DNA was extracted from stored samples of 3x106 PBMCs with a QIAmp DNA extraction kit (Qiagen, Hilden, Germany). Two overlapping fragments (HXB2 positions 623–4687 and 4570–9632, respectively) of HIV-1 genome were amplified from DNA by using a X-Long PCR Kit (Roche, Inc, Indianapolis, USA): specific sets of primers, MSF12 (50 AAATCTCTAG CAGTGGCGCCCGAACAG30 ) and CR1 (50 GATTCTACTACTCCTTGACTT TGGGGATTGTAGGGA30 ) for fragment A, and JC4650 (50 GCAGGAAG ATGGCCAGTAAAAGTAATACA30 ) and MSR5 (50 GCACTCAAGGCAAGC TTTATTGAGGCT30 ) for fragment B, were used (Riva et al., 2008). Cycling conditions were optimized following manufacturer instructions. A third set of primers was used to perform a semi-nested PCR to amplify the 50 long terminal repeat (LTR) region (Forward outer P1. 50 -GGGCTAATTTACTCCCAACAAAG-30 HXB2 positions 6–28, Reverse outer P5 50 -CAGGGGGAAAGAAACATTAT-30 HXB2 positions 858–877, Reverse nested P4 50 -AACAGGGACTTGAAAGC-

GAAAG-30 HXB2 positions 645–666). In order to exclude carry-over of individual patient DNA, experimental amplification errors and to provide sufficient genomic material, each segment was separately cloned into TOPO-XL cloning vector (Invitrogen, Carlsbad, CA, USA). Amplified clones and plasmid DNA were purified with a QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and a PureYield™ Plasmid Miniprep System (Promega, Madison, WI, USA), respectively. Amplicons were then subjected to sequencing reactions using Big Dye Terminator (v3.1, Applied Biosystems, Foster City, CA, USA) labeled nucleotides in an ABI PRISM 3130 XL Genetic Analyser sequencer (Applied Biosystems, Foster City, CA, USA) following manufacturer’s instructions; sets of sequencing primers were used as previously described (Riva et al., 2008) or specifically designed, as needed to fill gaps to complete the sequencing of both DNA strands. 2.3. Editing, genotyping and phylogenetic analysis of HIV-1 recombinants BLAST tool (http://www.hiv.lanl.gov/content/sequence/BASIC_ BLAST/basic_blast.html) was used to retrieve sequences showing high similarity and the same BC mosaic pattern within the Los Alamos HIV Sequence Database. An additional survey for similar sequences in the Italian nationwide database ARCA (Antiretroviral Resistance Cohort Analysis, (ARCA, https://www.hivarca.net/) was also conducted. A full length genome sequence was assembled by overlapping amplicon sequences and merging them into one sequence by means of Seqscape (Applied Biosystems, Foster City, CA, USA) and Geneious sofware (v. 6.0.5; http://www. geneious.com) (Kearse et al., 2012). Final sequence data were trimmed to the same length and aligned to HXB2 reference using ClustalX/W (v2.1; [http://www. clustal.org/clustal2/]), and BioEdit (v7.1.11; [http://www.mbio. ncsu.edu/bioedit/bioedit.html]) for minor manual adjustment (insertions and deletions involving more than three nucleotides were removed). The alignment of a comprehensive list of reference sequences (A–D, F–H, J and K) was retrieved from the HIV database (www.hiv.lanl.gov). The monophyletic nature of the full-length genome was evaluated by means of the MrBayes program using a general-time reversible (GTR) model of nucleotide substitution, a proportion of invariant sites, and gamma distributed rates among sites (Huelsenbeck and Ronquist, 2001). ModelTest v. 3.6 (Posada and Crandall, 1998) was used to select the simplest evolutionary model that adequately fitted the sequence data. A Markov Chain Monte Carlo (MCMC) search was made for 5  106 generations using tree sampling every 100th generation and a burn-in fraction of 50%. Statistical support for specific clades was obtained by calculating the posterior probability of each monophyletic clade, and a posterior consensus tree was generated after a 50% burn-in. Similarity and bootscanning plots implemented in Simplot software v3.5.2 (http://sray.med.som.jhmi.edu/SCRoftware/simplot/) were used to reconstruct recombination pattern. Given the total length of HIV genome and the relatively short distance between

178

F.R. Simonetti et al. / Infection, Genetics and Evolution 23 (2014) 176–181

Fig. 1. Bayesian tree based on full length sequences obtained by MrBayes program. The tree clades belonging to distinct subtypes are displayed in different colors. The scale bar indicates 1% of nucleotide divergence. The tree was rooted using HIV-1K subtype as the outgroup. Only posterior probability >0.98 are showed along branches. Colored squares and circles highlighted the new CRF60_BC sequences and references of interest, respectively.

breakpoints observed in pol (Monno et al., 2012), the analysis was run with a window of 400 bp, moving in steps of 30 bp. The SplitsTree analysis was also performed as an additional verification of results (Koeppler and Huson 2008). Maximum Likelihood phylogenetic trees were constructed for individual segments identified within each breakpoint with bootstraping on 1000 replicates using MEGA program (v5.05) (Tamura et al., 2011). Tree figures were rendered using FigTree (v1.4.0) (http://tree.bio.ed.ac.uk/software/ figtree/). The MEGA program was used to evaluate the genetic distance between and within subtypes on the full length genome. 2.4. Ethics Statement The research did not require approval from the ethics committee, according to the Italian law, since it was performed as an observational study in the context of normal clinical routines (art.1, Low. decree 211/2003). However, all patients provided informed consent for the use of their data for research purposes. Blood samples were taken as part of standard patient care; DNA samples and data were previously anonymized, according to the requirements set by Italian Data protection Code (Low Decree 196/2003). 3. Results 3.1. Characteristics of patients The demographic, immune-virological and clinical data of patients subjected to HIV-1 full length analysis are shown in Table 1.

Patients were young Italian individuals who seroconverted within a narrow time frame. Behavioral and life-style information were collected by patient interviews. None of the patients had a last negative antibody assay before HIV-1 diagnosis that would allow dating their seroconversion. However, the fraction of ambiguous nucleotides was