Vol. 188, No. 2, 1992 October 30, 1992
REGION
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS Pages 927-933
IDENTIFICATION OF A HIGHLY CONSERVED AT THE 5’ FLANK OF THE PHOSPHOLAMBAN
GENE
David C. Johns and Arthur M. Feldman’ The Peter Belfer Laboratory for the Molecular Biology of Heart Failure, Department of Medicine, The Johns Hopkins University School of Medicine, 720 Rutland Avenue, Baltimore, Maryland 21205 Received
September
22,
1992
Phospholamban is a protein that regulates the activity of the sarcoplasmic reticulum Ca*+-ATPase. The rat phospholamban gene contains a single intron of 6.5 kilobases which interrupts the 5’ untranslated region. Primer extension and nuclease mapping analysis identified a major transcription initiation site 87 nucleotides upstream of the first exon/intron junction. A highly conserved region was identified at the 5’ flank of the phospholamban gene. This region contained a TATA motif at position -52 which bound nuclear extract, and a consensus CAAT motif at position -76. This highly conserved region may be important in the regulation of basal transcriptional activity. 0 1992 Academic PESS,
Inc.
Phospholamban
is found in the sarcoplasmic reticulum of cardiac, slow twitch, and
smooth muscles (1,2) and serves as a substrate for kinase mediated phosphorylation
(3).
In the non-phosphorylated state, phospholamban inhibits cardiac muscle sarcoplasmic reticulum Ca**-ATPase (4) and therefore plays a regulatory role in the reuptake of Ca*’ during cardiac relaxation.
Cardiac hypertrophy is associated with slowing of relaxation
(5), abnormal Ca” transport by the sarcoplasmic reticulum (6), and substantial decreases in the mRNAs encoding Ca*+-ATPase and phospholamban (7). Therefore, both Ca*‘ATPase and phospholamban may be alternatively regulated at the transcriptional level during hypertrophy. Nucleotide sequence phospholamban
from
the genes encoding
have been recently published.
chicken
(8) and rabbit
The present study was performed
(9) to
identify regions of conservation within the 5’ flanking region of the phospholamban gene in mammals and to isolate the rat gene as a prerequisite to understanding the control of phospholamban
expression in rodent models of hypertrophy.
1To whom correspondence should be addressed.
927
0006-291X/92 $4.00 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
Vol.
188,
No.
2,
1992
BIOCHEMICAL
AND
BIOPHYSICAL
MATERIALS
AND METHODS
RESEARCH
COMMUNICATIONS
Preparation of mRNA Total RNA was isolated from left ventricular myocardium of Sprague Dawley rats (125-150 g, Charles River, Wilmington, MA) using the acid guanidinium thiocyanate/phenol/chloroform extraction (10). Poly(A)+ RNA was separated using oligo-dT cellulose (New England Biolabs Inc, Beverly, MA) and a 0.45 PM spin filter (Millipore Corp., Bedford, MA). The quantity of RNA was assessed spectrophotometrically. Isolation of Genomic DNA Ten pg of genomic DNA isolated from rat liver (11) was digested with different restriction endonucleases. The respective restriction fragments were electrophoretically separated in 0.8% agarose gel and transferred to Gene Screen The Southern blot was Plus (DuPont Co., Boston, MA) by alkaline blotting (12). hybridized (11) under high stringency conditions with a [a3’P]UTP-labeled RNA transcript synthesized using T7 polymerase (Promega Corp., Madison, WI) from a cDNA containing the 156 bp coding sequence of rat phospholamban (generously provided by Dr. Paul D. Kessler) and autoradiography was performed at -70°C with an intensifying screen (DuPont Co.). Cloning and Isolation of Genomic DNA Clones Rat genomic DNA (200 rg) was digested to completion with BgZ II and fractionated on a agarose gel. DNA (10-15 kb) was extracted from the gel using the Qiaex gel extraction kit (Qiagen Inc., Chatsworth, CA). The purified DNA (300 ng) was then ligated to Burn HI digested lambdaGEM(Promega Corp.) arms (600 ng) using T4 DNA ligase (Life Technologies, Inc., Gaithersburg, MD) at 12°C for 18 hrs and packaged into lambda phage particles using Gigapack gold (Stratagene Cloning Systems, La Jolla, CA) as recommended by the manufacturer. Primary screening by plaque hybridization using the 32P-riboprobe for rat phospholamban coding region resulted in identification of 6 positive clones. These clones were rescreened, positive clones were isolated, and DNA was prepared according to Malik et al (13). Fragments of interest were subcloned into pBluescript II KS’ (Stratagene Cloning Systems) and electroporated into DHlOB cells with a Cell porator with voltage booster (BRL) (14). Production of Deletion Clones Unidirectional deletions using Exe III nuclease followed by mung bean nuclease were performed as directed by the manufacturer (Stratagene Cloning Systems). Following ligation, the DNA was transformed into DHlOB cells and isolated. DNA Seauence Analvsis DNA sequencing was performed with the method of Sanger et al. (15) using a Sequenase 2.0 kit (United States Biochemical, Cleveland OH) and double stranded pBluescript templates. The initial sequencing primer was a 30 bp oligonucleotide complementary to nt +221 - nt +250 of the rat phospholamban gene, a sequence 25 bp from the start of translation. Identification Primer extension of one fig of heat denatured mRNA from rat heart was carried out at 42°C for 2 hr with reverse transcriptase (Superscript RNase K, BRL). Two units RNasin and 100 ng of a 32P-labeled (or unlabeled) oligonucleotide complementary to nucleotide 55 - 25 from the translation initiation codon AUG of dog heart phospholamban mRNA (16) were present in the reaction mixture. The reverse transcription products were separated from primers and free nucleotides by ultrafiltration through Centricon 100 (Amicon, Beverly, MA) and amplified using the Rapid Amplification of cDNA Ends (RACE) technique (17,18). A poly A tail was added to the primer extension product with terminal deoxynucleotidyl transferase (BRL) and second strand synthesis was carried out using the RACE 1 primer consisting of a Poly T sequence and an 18 mer (GATGGATCCTGCAGAAGCT”). This product was then amplified by polymerase chain reaction (PCR) with Thermus aquuticu.r DNA polymerase (Taq polymerase, Boehringer Mannheim Corp., Indianapolis, IN) using the RACE 2 primer (GATGGATCCTGCAGAAGC) and a second primer complementary to nucleotides + 113 - + 143 of the rat genomic sequence. Polymerase chain amplifications were carried out for 30 cycles with a TempCycler (Coy Corp., Ann Arbor, MI). 928
Vol.
188,
No.
2, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
PCR products were electrophoretically separated, cloned into pBlueScript II ks’, and sequenced. The intron/exon boundary was found by comparing the sequence of genomic clones to that of the primer extension products for the 5’ untranslated regions. The exon/intron boundary was identified by comparing sequence data from exon 1 to genomic sequences containing the exon/intron junction. Primer Extension Analvsis Primer extension was performed using reverse transcriptase. Twenty pg of total RNA from adult rat heart was hybridized with 1 pmol of 32P-labeled oligonucleotide complementary to nucleotide sequences near the first exon/intron boundary of the phospholamban gene (nt +36 - + 62). The primer-extended products were separated on a 5% acrylamide, 8.3 M urea gel alongside a sequencing ladder of the appropriate template. RNAse Protection Assay A 220 bp, antisense, 32P-labeled riboprobe was synthesized from a subclone of pDJ7 containing nt -158 - +62 of the phospholamban gene. The riboprobe was purified on a 0.75 mm, 8 M urea/5 % acrylamide gel and eluted in buffer containing 0.5 M NH,OAc, 1 mM EDTA, and 0.2% SDS. The probe was then hybridized with 5 or 10 gg total heart RNA, followed by digestion with RNase (Ambion, Inc., Austin, TX) according to manufacturers instructions. Products were separated on 5% acrylamide and detected autoradiographically. Preoaration of cardiac nuclear extracts and eel shift assay Rat heart and liver nuclear extracts were prepared using a modification of the method described by Potter et al. (19). Modifications included homogenization of the ventricular myocardium with a Polytron (Brinkman Instruments Co., Inc., Westbury, NY) followed by a second homogenization using a Dounce homogenizer. Final protein concentration was approximately 5 mg/ml. Double stranded oligonucleotides were synthesized which represented the sequences surrounding 3 putative TATA motifs: GESS, nt -5 to + 11; GES3, nt -42 to -30; GESl, nt 56 to -43. Each oligonucleotide had 3’ recessed ends to facilitate radiolabeling with Klenow fragment of DNA polymerase and [o13’P]dCTP (11). Unincorporated label was removed with G25 spin column chromatography (Pharmacia, Milwaukee, WI). Gel shift assays were performed using 5, 10 or 15 pg of rat liver (or cardiac) nuclear extract in a total reaction volume of 20 ~1 as described by Peterson et al (20) at rt for 40 min. Reaction products were separated on a 5% non-denaturing acrylamide gel and the gel was dried and exposed Kodak XOMAT AR film with an intensifying screen at -70°C. Competition assays were performed with cold sequence specific oligonucleotides and nonspecific SPl oligonucleotide (Promega). RESULTS AND DISCUSSION The structure of the rat phospholamban
gene is seen in Fig 1.2 It shares a feature
with phospholamban
genes recently reported from chicken (8) and rabbit (9): a single large intron in its 5’untranslated region. An open reading frame beginning 196 bp downstream of the transcriptional start site contained substantial sequence identity with the coding regions of other species including rabbit (89%) (9) and chicken (77%) (8) with divergence occurring in the 5’ untranslated region. A high degree of homology (87%) exists within the first 113 base pairs of the 5’ flanking region of rat and rabbit phospholamban (Fig. 2); however, this region differed substantially from that in chicken. In contrast to this highly conserved region, little homology (46%) was seen in the first 845 bases of upstream sequence in the rat and rabbit genes.
2Submitted
to GenBank. 929
Vol.
188, No. 2, 1992
BIOCHEMICAL
12.5 2kb
Bgl II
-rl.SkbT ~1 kb-
X
kb APHLB
R
RESEARCH COMMUNICATIONS
-j
r1.5kb-r
1.3kb
R
HX R
AND BIOPHYSICAL
3.4kb
RH
RH
HRBg’
”
PW8 tyGi+-
i IpDl1:
w
$2
I
PDF
1
Fig. 1. Restriction map of rat phospholamban genomic clones. The lower lines represent the location of overlapping genomic clones which span the total length of the 12.5 kb lambda clone (lambda PHLB). The number of nucleotides spanning the various restriction sites are indicated. The transcription initiation site (T) and ATG initiation codon are as indicated. Exon I is indicated by the shaded area while the darkened block represents Exon II. X, XhoI; H, HindIII.
The major transcription initiation site was identified 87 bp upstream of the first exon/intron boundary using primer extension analysis (Fig. 3) and confirmed by nuclease protection assays (Fig. 4). This site differed from the transcription initiation site identified in the rabbit phospholamban gene (9) which was 9 bases closer to the exon/intron junction. Two possible TATA box sequences were identified in the conserved region: CATAA at position -52 and TAGAA at position -39. A third TATA motif was identified as the TATA motif in the rabbit phospholamban gene; however, in the rat gene it is located downstream of the transcriptional initiation site. To identify whether any of these sequences represents a binding site for a nuclear protein, gel shift assays were performed. As seen in Fig. 5, only the sequence at position -52 bound rat liver (or cardiac) nuclear extract. That the binding was specific for the putative TATA motif was demonstrated by the fact that binding was inhibited by the addition of cold oligonucleotide but not by the
RAT
5' - GTGATAAGAGCATGGCTAACCAATCACAGGTTGGGA-TTCCTATGTGATGTCATMG
III
IIIII
III1
IIIIIIIIII
I
II
II IIIII
lllll
lllllll
RABBIT 5' - GTGGTAAGACTATGGTTAACCAATCAGAACTTCAGAATTCCTGTGTGACATCATAAG RAT RABBIT
1+ - ACCTCCCTAGAATGCTTTTTCTCCTCCACCTACTGCAACTGTTCCCATAAACCTAGG 3'
IIIIlIlIlIlII
IIIIIIIIIIIIIIIIIIIIIIIIII
IIIIIIIIIIIII
II
- ACCTCCCTAGAATACTTTTTCTCCTCCACCTACTGC~CTATTCCCAT~CCT-GG 3' l+ Fig. 2. Alignment of proximal S-flanking regions of rat and rabbit phospholamban genes. The rabbit sequences are from Fujii et al. (9). The rat and rabbit transcriptional start sites are denoted by l+. The major TATA motif and the consensus CAAT motif are highlighted.
Vol.
188,
No.
2, 1992
BIOCHEMICAL
AND
A
BC
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
AGCT
Fig. 3. Primer extension analysis of the S-untranslated sequence of the rat phospholamban gene. Twenty pg (lane B) or 10 fig (lane C) of total RNA from adult rat heart was hybridized with a synthetic 32P-labeledoligonucleotide complementary to nucleotide sequence near the first exon/intron boundary of the phospholamban gene. Total RNA was not present in lane A. Using the same 32P-labeledprimer, a sequencing ladder was constructed with a clone (pDJ7) containing Exon 1 and 5’ flanking regions. The major primer extension product is denoted by the arrow.
addition of non-specific oligonucleotide
sequences including the SPl binding sequence.
Furthermore, an oligonucleotide including the first 67 bp upstream of the transcriptional start site bound purified TFIID in gel shift studies and this binding could be attenuated by appropriate competition. (data not presented) This TATA motif differed in sequence from the consensus TATA sequence by a single substitution; a C for a T at position 1. In addition to a TATA motif, a canonical CCAAT sequence was identified at position 76, within the highly conserved 113 bp region. The more 5’ upstream region of the phospholamban
gene includes a recognition
sequence at position -643 for binding of the ubiquitous protein NF-W2 (21), a group of putative muscle-specific promoter elements homologous to the core CANNTG sequence necessary for muscle-specific gene activation by the myogenic determination protein MyoD (22) (positions nt -272, -622, -728, -762, -859, -866, -878, -1116, and -1210), and a region at position -1238 (CCTTITAAGC) which displayed near complete identity with the consensus CArG element, another muscle specific cis-regulatory element (23). Further evaluations will be required to assessthe importance of both the highly conserved 113 bp region and the potential putative promoter elements to basal and regulated expression of phospholamban. 931
Vol.
188, No. 2, 1992
AGCT =p ,A#
BIOCHEMICAL
A
B
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
C
,/ -+
A -+ 1(1
.‘” (_’
05
Fig. 4. RNase protection analysis of the S-untranslated sequence of the rat phospholamban gene. A 220 bp antisense 32P-riboprobe synthesized from a subclone of pDJ7, which included the putative transcriptional start site, was hybridized with either 5 fig (lane A) or 10 pg (lane B) of total rat heart RNA. After digestion of unprotected regions with RNase, the protected fragments were separated along side of a sequencing ladder by electrophoresis through a 5% gel. Lane C contained 1Opgof yeast tRNA in place of rat heart total RNA. The major protected fragment is indicated by an arrow. Fig. 5. Electrophoretic mobility shift assaysdemonstrating nuclear extract binding of 3 potential “TATA box” sequences of the rat phospholamban gene. Synthetic doublestranded oligonucleotides were constructed having the consensussequences and flanking nucleotides of 3 potential ‘TATA boxes”: GESl (lane l), GES3 (lane 2) and GESS (lane 3) as described in “Materials and Methods”. Oligonucleotides were 3’ 32P-endlabeled and incubated with 5 rg of rat liver nuclear extract and the reaction products were separated on a 5% gel. Control reactions (-) contained no nuclear extract.
Acknowlednments - This work was supported in part by grant #HL 39719 from the NHLBI and a grant from the W.W. Smith Charitable Trust. AMF is an Established Investigator of the American Heart Association. The authors gratefully thank Drs. Stephen Desiderio and Chi V. Dang for helpful discussions, James Potter for help in preparation of the nuclear extracts, and Elizabeth Bandell for preparation of the manuscript.
REFERENCES Inui, M., Kadoma, M., and Tada, M. (1985) J. Biol. Chem. 260,3708-3715. Jorgensen, A.O., and Jones, L.R. (1986) J. Biol. Chem. 261, 3775-3781. Simmerman, H.K.B., Colhns, J.H., Theibert, J.L., Wegener, AD., and Jones, L.R. (1986) J. Biol. Chem. 261, 13333-13341. James, P., Inui, M., Tada, M., Chiesi, M., and Carafoli, E. (1989) Nature 342, 9092. Grossman, W. (1991) N. Engl. J. Med. 325, 1557-1564. De la Bastie, D., Levitsky, D., Rappaport, L, Mercadier, J-J., Marotte, F., Wisnewsky, C., Brovkovich, V., Schwartz, K., and Lompre, A-M. (1990) Circ Res 66, 554-564. 932
Vol.
188,
No.
2,
1992
BIOCHEMICAL
AND
7.
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Nagai, R., Zarain-Herzberg, A., Brandl, C.J., Fujii, J., Tada, M., MacLerman, D.H., Alpert, N.R., and Periasamy, M. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 29662970. 8. Toyofuku, T., and Zak, R. (1991) J. Biol. Chem. 266, 53755383. 9. Fujii, J., Zarain-Herzberg, A, Willard, H.F., Tada, M., and MacLerman, D.H. (1991) J. Biol. Chem. 266, 11669-11675. 10. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159. 11. Maniatis, T., Fritsch, E.F., and Sambrook, J. Molecular CZoning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 12. Reed, K.C., and Mann D.A. (1985) Nucl. Acids. Res. 13, 7207-7221. 13. Malik, AN., McLean, P.M., Roberts, A., Barnett, P.S., Demaine, A.G., Banga, J.P., and McGregor, A.M. (1990) Nucl. Acids. Res. 18, 40314032. 14. Dower, W.J., Miller, J.F., and Ragsdale, C.W. (1988) Nucl. Acids Res. 16, 61276145. 15. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467. 16. Fujii, J., Ueno, A., Kitano, K., Tanaka, S., Kadoma, M., and Tada, M. (1987) J. Clin. Invest. 79, 301-304. 17. Frohman, MA., Dush, M.K., and Martin, G.R. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 8998-9002. 18. Loh, E.L., Elliott, J.F., Cwirla, S., Lanier, L.L., and Davis, M.M. (1989) Science 243, 217-220. 19. Potter, J.J., Mezey, E., Christy, R.J., Crabb, D.W., Stein, P.M., and Yang, V.W. (1991) Arch. Biochem. Biophys. 285, 246-251. 20. Peterson, M.G., Tanese, N., Pugh, B.F., and Tjian, R. (1990) Science 248, 16251630. 21. Dorn, A., Benoist, C., and Mathis, D. (1989) Mol. Cell. Biol. 9, 312-320. 22. Davis, R.L., and Cheng, P-F., Lassarm, A.B., Weintraub, H. (1990) Cell 60, 733746. 23. Minty, J.H., and Kedes L. (1986) Mol. Cell. Biol. 6, 2125-2136.
933
REGION
BIOCHEMICAL
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS Pages 927-933
IDENTIFICATION OF A HIGHLY CONSERVED AT THE 5’ FLANK OF THE PHOSPHOLAMBAN
GENE
David C. Johns and Arthur M. Feldman’ The Peter Belfer Laboratory for the Molecular Biology of Heart Failure, Department of Medicine, The Johns Hopkins University School of Medicine, 720 Rutland Avenue, Baltimore, Maryland 21205 Received
September
22,
1992
Phospholamban is a protein that regulates the activity of the sarcoplasmic reticulum Ca*+-ATPase. The rat phospholamban gene contains a single intron of 6.5 kilobases which interrupts the 5’ untranslated region. Primer extension and nuclease mapping analysis identified a major transcription initiation site 87 nucleotides upstream of the first exon/intron junction. A highly conserved region was identified at the 5’ flank of the phospholamban gene. This region contained a TATA motif at position -52 which bound nuclear extract, and a consensus CAAT motif at position -76. This highly conserved region may be important in the regulation of basal transcriptional activity. 0 1992 Academic PESS,
Inc.
Phospholamban
is found in the sarcoplasmic reticulum of cardiac, slow twitch, and
smooth muscles (1,2) and serves as a substrate for kinase mediated phosphorylation
(3).
In the non-phosphorylated state, phospholamban inhibits cardiac muscle sarcoplasmic reticulum Ca**-ATPase (4) and therefore plays a regulatory role in the reuptake of Ca*’ during cardiac relaxation.
Cardiac hypertrophy is associated with slowing of relaxation
(5), abnormal Ca” transport by the sarcoplasmic reticulum (6), and substantial decreases in the mRNAs encoding Ca*+-ATPase and phospholamban (7). Therefore, both Ca*‘ATPase and phospholamban may be alternatively regulated at the transcriptional level during hypertrophy. Nucleotide sequence phospholamban
from
the genes encoding
have been recently published.
chicken
(8) and rabbit
The present study was performed
(9) to
identify regions of conservation within the 5’ flanking region of the phospholamban gene in mammals and to isolate the rat gene as a prerequisite to understanding the control of phospholamban
expression in rodent models of hypertrophy.
1To whom correspondence should be addressed.
927
0006-291X/92 $4.00 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
Vol.
188,
No.
2,
1992
BIOCHEMICAL
AND
BIOPHYSICAL
MATERIALS
AND METHODS
RESEARCH
COMMUNICATIONS
Preparation of mRNA Total RNA was isolated from left ventricular myocardium of Sprague Dawley rats (125-150 g, Charles River, Wilmington, MA) using the acid guanidinium thiocyanate/phenol/chloroform extraction (10). Poly(A)+ RNA was separated using oligo-dT cellulose (New England Biolabs Inc, Beverly, MA) and a 0.45 PM spin filter (Millipore Corp., Bedford, MA). The quantity of RNA was assessed spectrophotometrically. Isolation of Genomic DNA Ten pg of genomic DNA isolated from rat liver (11) was digested with different restriction endonucleases. The respective restriction fragments were electrophoretically separated in 0.8% agarose gel and transferred to Gene Screen The Southern blot was Plus (DuPont Co., Boston, MA) by alkaline blotting (12). hybridized (11) under high stringency conditions with a [a3’P]UTP-labeled RNA transcript synthesized using T7 polymerase (Promega Corp., Madison, WI) from a cDNA containing the 156 bp coding sequence of rat phospholamban (generously provided by Dr. Paul D. Kessler) and autoradiography was performed at -70°C with an intensifying screen (DuPont Co.). Cloning and Isolation of Genomic DNA Clones Rat genomic DNA (200 rg) was digested to completion with BgZ II and fractionated on a agarose gel. DNA (10-15 kb) was extracted from the gel using the Qiaex gel extraction kit (Qiagen Inc., Chatsworth, CA). The purified DNA (300 ng) was then ligated to Burn HI digested lambdaGEM(Promega Corp.) arms (600 ng) using T4 DNA ligase (Life Technologies, Inc., Gaithersburg, MD) at 12°C for 18 hrs and packaged into lambda phage particles using Gigapack gold (Stratagene Cloning Systems, La Jolla, CA) as recommended by the manufacturer. Primary screening by plaque hybridization using the 32P-riboprobe for rat phospholamban coding region resulted in identification of 6 positive clones. These clones were rescreened, positive clones were isolated, and DNA was prepared according to Malik et al (13). Fragments of interest were subcloned into pBluescript II KS’ (Stratagene Cloning Systems) and electroporated into DHlOB cells with a Cell porator with voltage booster (BRL) (14). Production of Deletion Clones Unidirectional deletions using Exe III nuclease followed by mung bean nuclease were performed as directed by the manufacturer (Stratagene Cloning Systems). Following ligation, the DNA was transformed into DHlOB cells and isolated. DNA Seauence Analvsis DNA sequencing was performed with the method of Sanger et al. (15) using a Sequenase 2.0 kit (United States Biochemical, Cleveland OH) and double stranded pBluescript templates. The initial sequencing primer was a 30 bp oligonucleotide complementary to nt +221 - nt +250 of the rat phospholamban gene, a sequence 25 bp from the start of translation. Identification Primer extension of one fig of heat denatured mRNA from rat heart was carried out at 42°C for 2 hr with reverse transcriptase (Superscript RNase K, BRL). Two units RNasin and 100 ng of a 32P-labeled (or unlabeled) oligonucleotide complementary to nucleotide 55 - 25 from the translation initiation codon AUG of dog heart phospholamban mRNA (16) were present in the reaction mixture. The reverse transcription products were separated from primers and free nucleotides by ultrafiltration through Centricon 100 (Amicon, Beverly, MA) and amplified using the Rapid Amplification of cDNA Ends (RACE) technique (17,18). A poly A tail was added to the primer extension product with terminal deoxynucleotidyl transferase (BRL) and second strand synthesis was carried out using the RACE 1 primer consisting of a Poly T sequence and an 18 mer (GATGGATCCTGCAGAAGCT”). This product was then amplified by polymerase chain reaction (PCR) with Thermus aquuticu.r DNA polymerase (Taq polymerase, Boehringer Mannheim Corp., Indianapolis, IN) using the RACE 2 primer (GATGGATCCTGCAGAAGC) and a second primer complementary to nucleotides + 113 - + 143 of the rat genomic sequence. Polymerase chain amplifications were carried out for 30 cycles with a TempCycler (Coy Corp., Ann Arbor, MI). 928
Vol.
188,
No.
2, 1992
BIOCHEMICAL
AND
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
PCR products were electrophoretically separated, cloned into pBlueScript II ks’, and sequenced. The intron/exon boundary was found by comparing the sequence of genomic clones to that of the primer extension products for the 5’ untranslated regions. The exon/intron boundary was identified by comparing sequence data from exon 1 to genomic sequences containing the exon/intron junction. Primer Extension Analvsis Primer extension was performed using reverse transcriptase. Twenty pg of total RNA from adult rat heart was hybridized with 1 pmol of 32P-labeled oligonucleotide complementary to nucleotide sequences near the first exon/intron boundary of the phospholamban gene (nt +36 - + 62). The primer-extended products were separated on a 5% acrylamide, 8.3 M urea gel alongside a sequencing ladder of the appropriate template. RNAse Protection Assay A 220 bp, antisense, 32P-labeled riboprobe was synthesized from a subclone of pDJ7 containing nt -158 - +62 of the phospholamban gene. The riboprobe was purified on a 0.75 mm, 8 M urea/5 % acrylamide gel and eluted in buffer containing 0.5 M NH,OAc, 1 mM EDTA, and 0.2% SDS. The probe was then hybridized with 5 or 10 gg total heart RNA, followed by digestion with RNase (Ambion, Inc., Austin, TX) according to manufacturers instructions. Products were separated on 5% acrylamide and detected autoradiographically. Preoaration of cardiac nuclear extracts and eel shift assay Rat heart and liver nuclear extracts were prepared using a modification of the method described by Potter et al. (19). Modifications included homogenization of the ventricular myocardium with a Polytron (Brinkman Instruments Co., Inc., Westbury, NY) followed by a second homogenization using a Dounce homogenizer. Final protein concentration was approximately 5 mg/ml. Double stranded oligonucleotides were synthesized which represented the sequences surrounding 3 putative TATA motifs: GESS, nt -5 to + 11; GES3, nt -42 to -30; GESl, nt 56 to -43. Each oligonucleotide had 3’ recessed ends to facilitate radiolabeling with Klenow fragment of DNA polymerase and [o13’P]dCTP (11). Unincorporated label was removed with G25 spin column chromatography (Pharmacia, Milwaukee, WI). Gel shift assays were performed using 5, 10 or 15 pg of rat liver (or cardiac) nuclear extract in a total reaction volume of 20 ~1 as described by Peterson et al (20) at rt for 40 min. Reaction products were separated on a 5% non-denaturing acrylamide gel and the gel was dried and exposed Kodak XOMAT AR film with an intensifying screen at -70°C. Competition assays were performed with cold sequence specific oligonucleotides and nonspecific SPl oligonucleotide (Promega). RESULTS AND DISCUSSION The structure of the rat phospholamban
gene is seen in Fig 1.2 It shares a feature
with phospholamban
genes recently reported from chicken (8) and rabbit (9): a single large intron in its 5’untranslated region. An open reading frame beginning 196 bp downstream of the transcriptional start site contained substantial sequence identity with the coding regions of other species including rabbit (89%) (9) and chicken (77%) (8) with divergence occurring in the 5’ untranslated region. A high degree of homology (87%) exists within the first 113 base pairs of the 5’ flanking region of rat and rabbit phospholamban (Fig. 2); however, this region differed substantially from that in chicken. In contrast to this highly conserved region, little homology (46%) was seen in the first 845 bases of upstream sequence in the rat and rabbit genes.
2Submitted
to GenBank. 929
Vol.
188, No. 2, 1992
BIOCHEMICAL
12.5 2kb
Bgl II
-rl.SkbT ~1 kb-
X
kb APHLB
R
RESEARCH COMMUNICATIONS
-j
r1.5kb-r
1.3kb
R
HX R
AND BIOPHYSICAL
3.4kb
RH
RH
HRBg’
”
PW8 tyGi+-
i IpDl1:
w
$2
I
1
Fig. 1. Restriction map of rat phospholamban genomic clones. The lower lines represent the location of overlapping genomic clones which span the total length of the 12.5 kb lambda clone (lambda PHLB). The number of nucleotides spanning the various restriction sites are indicated. The transcription initiation site (T) and ATG initiation codon are as indicated. Exon I is indicated by the shaded area while the darkened block represents Exon II. X, XhoI; H, HindIII.
The major transcription initiation site was identified 87 bp upstream of the first exon/intron boundary using primer extension analysis (Fig. 3) and confirmed by nuclease protection assays (Fig. 4). This site differed from the transcription initiation site identified in the rabbit phospholamban gene (9) which was 9 bases closer to the exon/intron junction. Two possible TATA box sequences were identified in the conserved region: CATAA at position -52 and TAGAA at position -39. A third TATA motif was identified as the TATA motif in the rabbit phospholamban gene; however, in the rat gene it is located downstream of the transcriptional initiation site. To identify whether any of these sequences represents a binding site for a nuclear protein, gel shift assays were performed. As seen in Fig. 5, only the sequence at position -52 bound rat liver (or cardiac) nuclear extract. That the binding was specific for the putative TATA motif was demonstrated by the fact that binding was inhibited by the addition of cold oligonucleotide but not by the
RAT
5' - GTGATAAGAGCATGGCTAACCAATCACAGGTTGGGA-TTCCTATGTGATGTCATMG
III
IIIII
III1
IIIIIIIIII
I
II
II IIIII
lllll
lllllll
RABBIT 5' - GTGGTAAGACTATGGTTAACCAATCAGAACTTCAGAATTCCTGTGTGACATCATAAG RAT RABBIT
1+ - ACCTCCCTAGAATGCTTTTTCTCCTCCACCTACTGCAACTGTTCCCATAAACCTAGG 3'
IIIIlIlIlIlII
IIIIIIIIIIIIIIIIIIIIIIIIII
IIIIIIIIIIIII
II
- ACCTCCCTAGAATACTTTTTCTCCTCCACCTACTGC~CTATTCCCAT~CCT-GG 3' l+ Fig. 2. Alignment of proximal S-flanking regions of rat and rabbit phospholamban genes. The rabbit sequences are from Fujii et al. (9). The rat and rabbit transcriptional start sites are denoted by l+. The major TATA motif and the consensus CAAT motif are highlighted.
Vol.
188,
No.
2, 1992
BIOCHEMICAL
AND
A
BC
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
AGCT
Fig. 3. Primer extension analysis of the S-untranslated sequence of the rat phospholamban gene. Twenty pg (lane B) or 10 fig (lane C) of total RNA from adult rat heart was hybridized with a synthetic 32P-labeledoligonucleotide complementary to nucleotide sequence near the first exon/intron boundary of the phospholamban gene. Total RNA was not present in lane A. Using the same 32P-labeledprimer, a sequencing ladder was constructed with a clone (pDJ7) containing Exon 1 and 5’ flanking regions. The major primer extension product is denoted by the arrow.
addition of non-specific oligonucleotide
sequences including the SPl binding sequence.
Furthermore, an oligonucleotide including the first 67 bp upstream of the transcriptional start site bound purified TFIID in gel shift studies and this binding could be attenuated by appropriate competition. (data not presented) This TATA motif differed in sequence from the consensus TATA sequence by a single substitution; a C for a T at position 1. In addition to a TATA motif, a canonical CCAAT sequence was identified at position 76, within the highly conserved 113 bp region. The more 5’ upstream region of the phospholamban
gene includes a recognition
sequence at position -643 for binding of the ubiquitous protein NF-W2 (21), a group of putative muscle-specific promoter elements homologous to the core CANNTG sequence necessary for muscle-specific gene activation by the myogenic determination protein MyoD (22) (positions nt -272, -622, -728, -762, -859, -866, -878, -1116, and -1210), and a region at position -1238 (CCTTITAAGC) which displayed near complete identity with the consensus CArG element, another muscle specific cis-regulatory element (23). Further evaluations will be required to assessthe importance of both the highly conserved 113 bp region and the potential putative promoter elements to basal and regulated expression of phospholamban. 931
Vol.
188, No. 2, 1992
AGCT =p ,A#
BIOCHEMICAL
A
B
AND BIOPHYSICAL
RESEARCH COMMUNICATIONS
C
,/ -+
A -+ 1(1
.‘” (_’
05
Fig. 4. RNase protection analysis of the S-untranslated sequence of the rat phospholamban gene. A 220 bp antisense 32P-riboprobe synthesized from a subclone of pDJ7, which included the putative transcriptional start site, was hybridized with either 5 fig (lane A) or 10 pg (lane B) of total rat heart RNA. After digestion of unprotected regions with RNase, the protected fragments were separated along side of a sequencing ladder by electrophoresis through a 5% gel. Lane C contained 1Opgof yeast tRNA in place of rat heart total RNA. The major protected fragment is indicated by an arrow. Fig. 5. Electrophoretic mobility shift assaysdemonstrating nuclear extract binding of 3 potential “TATA box” sequences of the rat phospholamban gene. Synthetic doublestranded oligonucleotides were constructed having the consensussequences and flanking nucleotides of 3 potential ‘TATA boxes”: GESl (lane l), GES3 (lane 2) and GESS (lane 3) as described in “Materials and Methods”. Oligonucleotides were 3’ 32P-endlabeled and incubated with 5 rg of rat liver nuclear extract and the reaction products were separated on a 5% gel. Control reactions (-) contained no nuclear extract.
Acknowlednments - This work was supported in part by grant #HL 39719 from the NHLBI and a grant from the W.W. Smith Charitable Trust. AMF is an Established Investigator of the American Heart Association. The authors gratefully thank Drs. Stephen Desiderio and Chi V. Dang for helpful discussions, James Potter for help in preparation of the nuclear extracts, and Elizabeth Bandell for preparation of the manuscript.
REFERENCES Inui, M., Kadoma, M., and Tada, M. (1985) J. Biol. Chem. 260,3708-3715. Jorgensen, A.O., and Jones, L.R. (1986) J. Biol. Chem. 261, 3775-3781. Simmerman, H.K.B., Colhns, J.H., Theibert, J.L., Wegener, AD., and Jones, L.R. (1986) J. Biol. Chem. 261, 13333-13341. James, P., Inui, M., Tada, M., Chiesi, M., and Carafoli, E. (1989) Nature 342, 9092. Grossman, W. (1991) N. Engl. J. Med. 325, 1557-1564. De la Bastie, D., Levitsky, D., Rappaport, L, Mercadier, J-J., Marotte, F., Wisnewsky, C., Brovkovich, V., Schwartz, K., and Lompre, A-M. (1990) Circ Res 66, 554-564. 932
Vol.
188,
No.
2,
1992
BIOCHEMICAL
AND
7.
BIOPHYSICAL
RESEARCH
COMMUNICATIONS
Nagai, R., Zarain-Herzberg, A., Brandl, C.J., Fujii, J., Tada, M., MacLerman, D.H., Alpert, N.R., and Periasamy, M. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 29662970. 8. Toyofuku, T., and Zak, R. (1991) J. Biol. Chem. 266, 53755383. 9. Fujii, J., Zarain-Herzberg, A, Willard, H.F., Tada, M., and MacLerman, D.H. (1991) J. Biol. Chem. 266, 11669-11675. 10. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159. 11. Maniatis, T., Fritsch, E.F., and Sambrook, J. Molecular CZoning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 12. Reed, K.C., and Mann D.A. (1985) Nucl. Acids. Res. 13, 7207-7221. 13. Malik, AN., McLean, P.M., Roberts, A., Barnett, P.S., Demaine, A.G., Banga, J.P., and McGregor, A.M. (1990) Nucl. Acids. Res. 18, 40314032. 14. Dower, W.J., Miller, J.F., and Ragsdale, C.W. (1988) Nucl. Acids Res. 16, 61276145. 15. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467. 16. Fujii, J., Ueno, A., Kitano, K., Tanaka, S., Kadoma, M., and Tada, M. (1987) J. Clin. Invest. 79, 301-304. 17. Frohman, MA., Dush, M.K., and Martin, G.R. (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 8998-9002. 18. Loh, E.L., Elliott, J.F., Cwirla, S., Lanier, L.L., and Davis, M.M. (1989) Science 243, 217-220. 19. Potter, J.J., Mezey, E., Christy, R.J., Crabb, D.W., Stein, P.M., and Yang, V.W. (1991) Arch. Biochem. Biophys. 285, 246-251. 20. Peterson, M.G., Tanese, N., Pugh, B.F., and Tjian, R. (1990) Science 248, 16251630. 21. Dorn, A., Benoist, C., and Mathis, D. (1989) Mol. Cell. Biol. 9, 312-320. 22. Davis, R.L., and Cheng, P-F., Lassarm, A.B., Weintraub, H. (1990) Cell 60, 733746. 23. Minty, J.H., and Kedes L. (1986) Mol. Cell. Biol. 6, 2125-2136.
933
