VIROLOGY
191,
533-540
Identification
(19%)
of a Binding
Protein to the X Gene Promoter
Region of Hepatitis
B Virus
IKUO NAKAMURA AND KATSURO KOIKE’ Department
of Gene Research, Cancer Institute, JFCR, Kami-lkebukuro, Toshima-ku, Received May 2 1I 1992; accepted August 10, 1992
Tokyo 170, Japan
The X protein of hepatitis B virus (HBV) is a transactivator to homologous and heterologous viral and cellular transcriptional regulatory elements. One sequence-specific binding protein, whose binding site located from nt 1102 to nt 1117 of HBV DNA, was identified by mobility shift assay and DNase I foot-printing analysis. A CAT assay experiment demonstrated this 16-bp binding site to have a promoter activity in the X gene transcription. The 58-bp DNA fragment (nt 1085 to nt 1142), which contains the above binding site, could be enhanced by the HBV enhancer. Mobility shift assay using the mutated 58-bp DNA fragments as probes, showed that the mutation, which damaged the palindrome structure between nt 1105 and nt 1112, resulted in loss of the binding activity. This mutation also remarkably reduced the promoter activity. The binding site differed from the target sequences of known transcriptional factors. This factor was thus concluded to be a binding protein to the X gene promoter (X-PBP) of HBV. A homology search demonstrated the binding site to be highly homologous to the promoter elements of human laminin receptor (2HBepitope) and lipoprotein receptor-related protein (LRP) genes. o 1992 Academic PUSS, h.
INTRODUCTION
as CYEBP, NF-1, AP-1, HBLF, EF-C, and eH-TF were found to interact with the HBV enhancer/X promoter region (Ben-Levy et al., 1989; Pate1 et al., 1989; Faktor et a/., 1990; Dikstein et a/., 1990a,b; Trujillo et a/., 1991). But there are noTATA nor GC boxsequences in the X promoter region. The 25-bp element in HBV enhancer was identified as an X-responsive element. The X protein may possibly alter the binding activity of CREB and ATF-2 to the X-responsive element by protein-protein interaction (Maguire et al., 1991) and its function(s) may also be expressed by interacting with AP-2 or C/EBP (Ungar and Shaul, 1990; Pei and Shih, 1990). However, an exact role of each factor in the transcription of X mRNA remains unclear (Ben-Levy et al., 1989; Pate1 et al., 1989; Faktor et al., 1990; Dikstein et a/., 1990a,b; Trujillo et a/., 1991). In the current study, search was made for a cellular factor for X gene transcription and a specific binding protein, whose binding site is located from nt 1 102 to nt 1117 of HBV DNA, was found. Mutation into the palindrome structure in the binding sequence resulted in loss of the binding activity of this factor and promoter activity as well. This binding protein would thus appear to be a promoter-binding protein (X-PBP) that binds specifically to the X gene promoter of HBV and is essential to the regulation of X gene transcription. The binding site of this X-PBP was found to be quite different from binding sites of known transcription factors and thus this factor may be one discovered here for the first time.
Hepatitis B virus (HBV) is a human DNA virus that causes acute and chronic hepatitis and is closely associated with hepatocarcinogenesis. The HBV X gene contains an open reading frame (ORF) that encodes 154 amino acids. This protein has been found to transactivate homologous and heterologous transcriptional regulatory elements of viral and cellular genes (Koike et a/., 1987,1989; Takada and Koike, 1990; Spandau and Lee, 1988; Seto et al., 1988, 1990; Siddiqui et a/., 1989; Twu and Robinson, 1989; Colgrove et al., 1989; Aufiero and Schneider, 1990; Hu et al., 1990; Ritter et al., 1991; Mahe et a/., 1991). There are two reports with regard to its functions. One indicated the X protein to possibly be a serine/threonine kinase (Wu et al., 1990) and the other predicted the X protein to contain a unique domain structure resembling a serine protease inhibitor (Takada and Koike, 1990). It also has transforming potential, according to studies using X geneintroduced NIH3T3 cells (Shirakata et al., 1989) and X gene-introduced transgenic mice (Kim et a/., 1991). However, the functions of X protein involved in HBV infection and HBV-induced hepatocarcinogenesis remains to be further elucidated. Contacts between DNA and protein and proteinprotein interactions are important for efficient and specific transcription (Ptashne, 1988; Sassone-Corsi eta/., 1988; Dynalacht et al., 1991). To date, little is known about such interactions involved in the X gene transcription of HBV. The X gene promoter re,gion and HBV enhancer element are located in a region about 140 bp upstream of the ATG codon of X ORF (Treinin and Laub, 1987; Siddiqui et al., 1987). Some factors, such
MATERIALS
AND METHODS
Cell lines HUH-~ and HepG2 were derived from human hepatocellular carcinoma and human hepatoblastoma, re-
’ To whom reprint requests should be addressed. 533
0042-6822192
55.00
Copyright 0 1992 by Academic Press. Inc. All rights of reproduction in any form reserved.
534
NAKAMURA
spectively. Both cell lines were negative for HBV integration. HeLa was from human uterus carcinoma and NIH3T3 from mouse fibroblasts. These cell lines were maintained in DM160 containing 10% fetal calf serum and 60 mg/ml aminoglycoside (Katsuta and Takaoka, 1976). Preparation assay
of nuclear
extract
and mobility
shift
AND KOIKE
gene into the HindIll site of the pSVOOCAT plasmid, which does not contain a promoter element (Araki et al., 1988). The plasmids constructed were named pX58pCAT and pX58pRCAT. The pXMbNcCAT plasmid was generated by inserting the synthetic DNA fragment (nt 1 140 to nt 1240) into the HindIll site of the pSVOOCAT plasmid. The pXStMbCAT was generated by inserting the StullA&ol fragment (nt 988 to nt 1136) of HBV DNA containing an enhancer sequence into the HindIll site of pSVOOCAT. Three kinds of mutant 58-bp DNA fragments with a 5- or 6-bp change were synthesized. Each mutant fragment was inserted into the vector plasmid and the resulting plasmids were named pX58pM 1CAT, pX58pM2CAT, and pX58pM3CAT. The plasmid pXStMbM2CAT was constructed by introducing the mutant 58-bp fragment (M2) into pXStM bCAT.
Nuclear extracts were prepared by the method of Dignam et al. (1983). Nuclear protein of 10 rg and the 5’end-labeled DNAfragment were incubated in 20 ~1of binding buffer (10 mM Tris-HCI, 1 mM EDTA, 1 mh/l dithiothreitol, 50 m&I NaCI, and 10 mg/ml sonicated salmon sperm DNA) at 25” for 30 min. The samples were loaded on 4% polyacrylamide gels equilibrated with 6.6 mh/lTris-HCI (pH 7.6) 1 mn/r EDTA, 3.3 mM sodium acetate. After electrophoresis, the gels were dried and autoradiographed. The 5’ends of StullBamHI fragment, StullSphl fragment, SphllBamHI fragment, and Ball/A&o1 fragment (nt 988 to nt 1284, nt 988 to nt 1110, nt 1110 to nt 1284, and nt 1090 to nt 1136, respectively) of HBV DNA and chemically synthesized 58-bp fragment (nt 1085 to nt 1142) on the HBV DNA (Kobayashi and Koike, 1984) and mutated 58-bp fragments (Ml, M2, and M3) were labeled and used as probes. In the competition experiments, a Balllllllbol fragment was used as a competitor. Competition experiments in the mobility shift assay using the DNA fragments including the binding sites of TEF-1 (Davidson et al., 1988) OTF-1 (Gerstner and Roeder, 1988) NFKB (Mitchell and Tjian, 1989) and AP-2 (Seto et a/., 1990) as the competitor were also carried out. TEF-1, OGT2-52 (5’ TCGGGCACCTGTGGAATGTGTGTC 3’); OTFl I (5’ ClTCACCTTAllTGCATAAGCG 3’); NFKB, (5’ GATCCAGAGGGGACTTTCCGAGAG 3’); and AP-2, (5’ GGTGTGGAAAGTCCCCAGGCTCCCCAGC 3’).
This assay was performed several times each in duplicate according to the method of Gorman eta/. (1982) and quantitated by liquid scintillation counting after thin-layer chromatography. All assays were performed within a linear range.
DNase I footprinting
Preparation
The [32P]5’end-labeled StullBamHI fragment of HBV DNA and nuclear extract were incubated at 25” for 30 min, as described above. DNase I was then added to 1 mg/ml and the mixture was incubated at 25” for 10 min followed by electrophoresis on a 4% polyacrylamide gel. Protein-associated DNA and free DNA were eluted separately and analyzed on an 8% polyacrylamide gel containing 7 M urea as previously described (Galas and Schmitz, 1978).
RNA was prepared from DNA-transfected (pXStMbCAT or pXStMbM2CAT) Huh-7 cells by the guanidium-cesium chloride method (Chirgwin et a/., 1979). All RNA samples were electrophoresed on an agarose gel containing 2.2 Mformaldehyde and transferred to a nitrocellulose filter. The 570-bp Ball/Ball DNA fragment was labeled by the nick translation method and used as a probe in Northern blotting.
DNA transfection This was done by the calcium phosphate precipitation method (Graham and van der Eb, 1973) with 20 pg of plasmid DNA in the buffer (50 m/l/l HEPES, 280 mM NaCI, 10 ml\/l KCI, 1.5 m/W Na*HPO,-2H,O, 12 mM glucose). The HUH-~ cells were plated at a density of 3 X 1O6 per 1O-cm dish and incubated with DNA precipitates for 6 hr at 37”. Glycerol shock (15% glycerol/ DMl60) was then carried out for 3 min (Parker and Stark, 1979). Incubation at 37” was conducted for 48 hr. CAT assay
Nuclease Construction
of plasmid
DNAs
The synthetic 58-bp fragment (nt 1085 to nt 1142), bearing the binding site of cellular factor, was inserted in the right or reverse orientation upstream of the CAT
of RNA and Northern
blotting
Sl mapping
pXStMbCAT and pXStMbM2CAT were digested with Pvull and their 5’-ends were labeled by T4 polynucleotide kinase. The [32P]pVull/Bglll 0.3-kb fragment was then prepared by Bglll digestion and used as a
X PROMOTER
BINDING
C gJ i?iiz
5
competitor (w)
0
5
IO
50
FIG. 1. Identification of a specific binding factor to the upstream sequence of the HBV X gene. (A) Structure of the upstream region of the HBV X gene. Restriction map of the DNA are derived from HBV DNA (Kobayashi and Koike, 1984). A shaded area indicates a region containing upstream enhancer sequences. St, Sful; Bal, Ball; Sp, Sphl; Mb, Mbol; Barn. BarnHI. (B) Detection of a specific factor binding to the HBV enhancer/X promoter region by gel shift assay. The 5’ end labeled probe was prepared from the 287-bp StullBamHI fragment of HBV DNA, and the probe was used for binding reactions with each nuclear extract from HUH-~. HepG2, HeLa, or NIH3T3 cells, followed by electrophoresis on 4% polyacrylamide gel. The shorter bold line with an asterisk indicates the probe. The arrow indicates the discrete signal in the gel shift assay. (C) Competition assay. The unlabeled 47-bp Ball/A&o1 fragment was used as a competttor.
probe. Nuclease Sl mapping was done as previously described (Favaloro et al., 1980). The protected product was subjected to 7 M urea-contained polyactylamide gel electrophoresis and its size estimated and compared with those of markers of the 32P-labeled Hinfl-digested fragments of pBR322 DNA. RESULTS Sequence-specific binding of the cellular the upstream sequences of HBV X gene
factor to
To find a cellular factor which binds to upstream sequences of HBV X gene, a mobility shift assay was conducted using a 32P-labeled 287-bp StullBamHI fragment as the probe (Fig. 1A). This fragment was expected to contain both the promoter region and the HBV enhancer element (Treinin and Laub, 1987; Siddi-
PROTEIN OF HBV
535
qui et a/., 1987; this study). As shown in Fig. 1B, one major band was observed in all cases using nuclear extracts of HUH-~, HepG2, HeLa, and NIH3T3 cell lines in the presence of sonicated salmon sperm DNAas the nonspecific competitor. In contrast, several bands were observed when a double-stranded poly(dl-dC) was used instead of a sonicated salmon sperm DNA (data not shown), consistent with the previous indications that many cellular factors are known to interact with the enhancer region (Ben-Levy et a/., 1989). To show that this single binding is in sequence-specific manner, the BalllMbol DNA fragment was added as a competitor in the mobility shift assay (Fig. 1C). The binding of this factor to the StullBamHI fragment was found to be specific and ubiquitous. To determine the binding site of this factor, the mobility shift assay was carried out using a left- or right-half probe. When the StullSphl DNA fragment or Sphll BarnHI fragment of HBV DNA was used as the probe, the discrete band ceased to be detectable, as shown in Fig. 2A. The binding site of this factor may possibly be split into two parts at the Sphl restriction site. For confirmation of this, DNase I foot-printing experiments were carried out. The target site of this binding factor was shown to be located in a region between nt 1096 and nt 11 17 of HBV DNA (Fig. 2B). Loss of the binding activity of the cellular factor by introducing a mutation into the 58-bp fragment of HBV DNA To determine the sequence responsible for the protein binding, three different mutations (Ml, M2, and M3) were introduced into the 58-bp fragment of HBV DNA between nt 1085 and nt 1142 (including a Ball/ lVIbol fragment) by chemical synthesis (Fig. 2C). A mobility shift assay was then conducted using such mutant DNAs as probes. The binding activity of the cellular factor to the mutant 58-bp DNA fragment (M2) with a 6-bp change (nt 1106 to nt 11 11) in the palindrome structure (nt 1 105 to nt 1 112) was shown to be lost (Fig. 2D). Ml and M3 mutations had no inhibitory effect on the binding activity of the cellular factor to the 58-bp DNA fragment, indicating the binding site to be located in the 16-bp sequence from nt 1102 to nt 1117. Effect of binding motifs of the known transcriptional factors upon the binding activity of cellular factor to the 58-bp DNA fragment To examine this binding factor to be relevant to known factors, the competition experiments were carried out in the mobility shift assay using four DNA fragments containing known binding sites of TEF-1 (Davidson et al., 1988), OTF-1 (Gerstner and Roeder, 1988), NFKB (Mitchell and Tjian, 1989), and AP-2 (Seto et al., 1990), all partially homologous to the 58-bp DNA
536
NAKAMURA
A
I
Bal SP Mb
Barn
AND KOIKE
B SC
IhI sp Mb
earn
CF
Mb
FIG. 2. Analysis of the binding site of the cellular factor and sequences responsible for the protein binding in the 58-bp HBV DNA fragment. (A) Gel shift assay. The three different 32P-labeled DNA fragments were used as probes. The 287-bp SfullBamHI fragment(*), 123-bp SfullSphl fragment?*), and 164-bp SphllBamHI fragment(***) prepared from HBV DNA were incubated at 25” for 30 min followed by electrophoresis on a 4% polyacrylamide gel. (B) DNase I foot-printing. The 5’end of StullBamHI fragment of HBV DNA was 3zP-labeled only at the BarnHI site and used as the probe. The nuclear extract and this probe were incubated at 25” for 30 min as described under Materials and Methods. DNase I was then added to 1 mg/ml and the mixture was incubated at 25” for 10 min followed by electrophoresis on a 4% polyacrylamide gel. Protein-complexed DNA and free DNA were eluted separately and analyzed on an 8% polyacrylamide gel containing 7 IM. The binding site is indicated by the black box on the HBV genome. C, DNA-protein complex; F, free DNA. The bold line on the HBV map demonstrates the protected region in this experiment. (C) Schematic representation of the chemically synthesized 58-bp fragment of HBV DNA (nt 1085 to nt 1 142) and three different mutated 58.bp DNA fragments. The WT fragment is 58-bp fragment of HBV DNA from nt 1085 to nt 1142. The M 1 fragment is the 58-bp DNA fragment contained 5 bp change from nt 1097 to nt 110 1. The M2 fragment is the 58-bp fragment mutated from nt 1106 to 1 1 1 1, and the M3 fragment is the 58-bp fragment mutated from nt 1090 to nt 1095. FP indicates the protected region in Fig. 2B. (D) Elimination of binding activity by introducing a mutation into the 58-bp fragment of HBV. WT, Ml, M2, and M3 DNA fragments were subjected to the binding reaction using nuclear extract and analyzed by electrophoresis on a 4% polyacrylamide gel by the method in Fig. 1 B.
sequence. Figure 3 shows that the OTFl -binding motif exhibited no inhibitory effect at all on the binding activity of the cellular factor to the 58-bp fragment. The other DNA fragment containing the binding motif of TEF-1, NFKB, or AP2 also showed no competition under the conditions of the mobility shift assay (data not shown). Promoter activity of the 58-bp DNA fragment X gene transcription
in the
To examine the promoter activity of the 58-bp DNA fragment (nt 1085 to nt 1 142) in X gene transcription,
two plasmids, pX58pCAT and pX58pRCAT, each containing chloramphenicol acetyltransferase (CAT) gene controlled by the synthetic 58-bp DNA fragment in right or reverse orientation, respectively, were constructed. CAT assay using plasmids pX58pCAT and pX58pRCAT showed the 58-bp fragment to possess promoter activity (Figs. 4 and 5A). The ~~ollA/col DNA fragment had no promoter activity when examined- with pXMbNcCAT (Figs. 4 and 5A). The CAT assay using pXStMbCAT clearly showed HBV enhancer sequences in the SrullBall region to markedly stimulate the promoter activity of the 58-bp fragment of HBV
X PROMOTER competitor (nn)
0
BINDING
1 10 loo
537
PROTEIN OF HBV
c
A
L
(OTF- I )
3-K
*
B
FIG. 3. Effects of binding motifs of known transcriptional factors on the binding activity of the cellular factor. Competition experiments in the mobility shift assay using the DNA fragments containing the binding sites of TEF-1, OTF-1, NFkB, and AP-2. were carried out. The results of the competition experiment using the DNA fragment containing the binding site of OTFl are shown.
DNA (Figs. 4 and 5A). In the separate experiments promoter activity was detected in the BalllMbol DNA fragment, but not in the SrullBall DNA fragment, when ex-
pX58pCAT pXS8pRCAT pXMbNcCAT pXStMbCAT pX58pYl
CAT
pX.58pMXAT pX58phWCAT pXStMbM2CAT
FIG. 4. Regulatory function of the cellular factor in the X gene transcription. Schematic representation of plasmids containing the CAT gene controlled by the HBV DNA fragment or its mutant and CAT activity assay. pX58pCAT and pX58pRCAT were generated by inserting the synthetic 58-bp fragment into the HindIll site of the pSVOOCAT in right or reverse orientation. The pXMbNcCAT plasmid was generated by inserting the synthetic DNA fragment (nt 1140 to nt 1240) into the HindIll site of the pSVOOCAT plasmid. The pXStMbCAT was generated by inserting the SfullMbol fragment of HBV DNA, containing an enhancer sequence, into the HindIll site of pSVOOCAT. Three kinds of mutant 58-bp DNA fragments with a 5- or 6-bp change (Ml, M2, and M3) as described in Fig. 2C were inserted into the vector plasmid and resulting plasmids were named pX58pMlCAT. pX58pM2CAT, and pX58pM3CAT. The plasmid pXStMbM2CAT was constructed by introducing the mutant 58-bp fragment (M2) into pXStMbCAT as described in Fig. 2C. The values of CAT activity in transfected HUH-~ cells are given, relative to the activity expressed by pX58pCAT, taken as 1.
CAM-t FIG. 5. CAT activity assay of plasmids containing the CAT gene controlled by the HBV DNA fragment or its mutants. (A) CAT assay of lysates prepared from HUH-~ cells transfected with pSVOOCAT, pX58pCAT, pX58pRCAT, pXMbNcCAT, and pXStMbCAT. CAM indicates chloramphenicol, and ~-AC and ~-AC. acetylated forms of chloramphenicol. (B) CAT activity assay of pX58pCAT. pX58pMlCAT, pX58pM2CAT, and pX58pM3CAT. (C) CAT activity assay of pXStMbCAT and pXStMbM2CAT.
amined with pXBaMbCAT and pXStBaCAT, respectively (data not shown). Three different plasmids were controlled by the 58bp fragment with a 5- or 6-bp change (pX58pMl CAT, pX58pM2CAT, and pX58pM3CAT). pX58pM 1CAT and pX58pM3CAT had promoter activity as did also pX58pCAT, while pX58pM2CAT had almost no promoter activity (Figs. 4 and 58). To show that the marked reduction in binding and promoter activity was not due to unique structure lllllT, different mutation ATCGAT instead of lllllT was introduced and the same experiment was carried out. The ATCGAT mutation again greatly reduced the binding and promoter activity of the 58-bp DNA fragment (data not shown). A plasmid pXStMbM2CAT was subsequently constructed by introducing the mutant 58-bp fragment (M2) into pXStMbCAT. This plasmid (pXStMbM2CAT) showed below one-fifth the promoter activity of pXStMbCAT (Figs. 4 and 5C), indicating that most, if not all, of this activity to be due to the 16-bp sequence from nt 1 102 to nt 1 1 17 in the binding site of the cellular factor. Transcription
of pXStMbCAT
and pXStMbM2CAT
As shown in Fig. 6A, Northern blotting of transcripts from pXStMbCAT and pXStMbM2CAT showed two
NAKAMURA
538
A
and nt 1100 + 2) (Fig. 6B). Interaction between the cellular factor and palindrome structure (nt 1 105 to nt 1 1 12) would thus appear essential to the regulation of the X gene transcription. On the other hand, the transcription start site of pX58pCAT could hardly be determined because of the signal being about one-fortieth that of pXStMbCAT. Homology
7.5kb-
1.4kb-
AND KOIKE
=
FIG. 6. Transcription of pXStMbCAT and pXStMbM2CAT. (A) Northern blotting. RNA was prepared from HUH-~ cells transfected with pXStMbCAT DNA or pXStMbM2CAT DNA by the guanidiumcesium chloride method. The RNA samples were electrophoresed on an agarose gel containing 2.2 M formaldehyde and transferred to nitrocellulose filter. The 32P-labeled 570-bp Ball/Ball DNA fragment taken from pXStMbCAT by nick translation was used as a probe. The arrows indicate the signals of interest. Ori indicates the position of the well and positions of size marker are shown on the left of the autoradiographed picture. (El) Nuclease Sl mapping. pXStMbCAT and pXStMbM2CAT were digested with h/ull and their Y-ends were labeled by T4 polynucleotide kinase. The 32P-labeled PvulllBgllI 0.3. kb fragment was then prepared and used as the probe. The protected products were subjected to 7 M urea-contained polyacrylamide gel electrophoresis and size was estimated and compared with those of the markers of 32P-labeled Hinfl-digested fragments of pSR322 DNA. The symbol (+) or (-) indicates the presence or absence of RNA samples in the mixture. The right two lanes are the longer exposed picture of the middle two lanes (pXStMbM2CAT). Arrows indicate major signals.
bands, one major (2.9 kb) and the other minor (2.2 kb). The transcription was demonstrated to be much less efficient in the case of pXStMbM2CAT than that of pXStMbCAT. The reduction of CAT activity in pXStMbM2CAT in Figs. 4 and 5C would be due to decrease in transcription from pXStMbM2CAT. Sl nuclease analysis of the 5’ ends of the pXStMbCAT transcript showed the presence of two start sites (nt 1090 + 2 and nt 1100 4 2) upstream the palindrome structure (Fig. 6B). Similar start sites of X gene transcript were also previously mapped upstream the X promoter region (Ben-Levy et a/., 1989). To examine whether reduction in mRNA in the case of pXStMbM2CAT was the result of changing the start site of pXStMbM2CAT, Sl nuclease analysis was carried out. Although the start site of pXStMbM2CAT was not clearly demonstrated because of the signal being below one-fifth that of pXStMbCAT (Fig. 6A), the start sites of pXStMbCAT and pXStMbM2CAT did not differ much (nt 1090 + 2
search for the binding sequence
of X-PBP
As the 16-bp sequence (CGGCGCATGCGTGGAA) in the 58-bp region of X gene was shown to be an essential region for the protein binding, a search was made for homology using the DNA database. This sequence in the 58-bp region was found to be highly homologous to the promoter elements of human laminin receptor (2H5 epitope) gene (TCTGCGCGCATGCGTGGCA) (Wewer et a/., 1986) and of human lipoprotein receptor-related protein (LRP) gene (ATCGGCGCATGCG) (Kuett et a/., 1989). Perfect homology was observed in the 8-bp sequence (CGCATGCG) which forms the palindrome structure. The exact role of the 8-bp sequence has not been known in two cases, but the sequence may interact with same cellular protein which was designated as the X-PBP. DISCUSSION Examination was made of the characteristics of the binding of a novel cellular factor to the promoter region of HBV X gene, X-promoter binding protein (X-PBP). The binding site of this factor was found to be located in the 16-bp sequence from nt 1 102 to nt 1117. Previous studies indicated sequence motifs with homology to the binding sites of transcriptional factors such as C/EBP, AP-1, CREB/ATF, NF-1, HBLF, eH-TF, and EF-C to be located in the HBV enhancer/X-promoter region (Ben-Levy et al., 1989; Pate1 et a/., 1989; Faktor et a/., 1990; Dikstein et al., 1990a,b; Trujillo et a/., 1991). However, the binding site of X-PBP in this study differed from and was located downstream of any binding motifs of the above transcription factors. This is a novel factor capable of binding to the X-promoter region and is essential for initiation of X mRNA synthesis near the binding site. Mobility shift assay using the StullBamHI DNA probe (Fig. 1 B), containing the entire upstream region from the major start site previously reported (Siddiqui et al., 1987; Treinin and Laub, 1987; Trujillo et al., 1991; Saito et a/., 1986) (Fig. 2A), clearly demonstrated the existence of a binding factor. This shift assay using two shorter (123 and 164 bp) probes (Fig. 2A) and DNasel foot-printing (Fig. 2B) indicated the target sequence of this factor to possibly be from nt 1096 to nt 1 1 17. Mobility shift assay using three mutant probes (Fig. ZC), in
X PROMOTER
BINDING
which the 6-bp mutation had been introduced into the 58-bp DNA fragment (nt 1085 to nt 1142), showed the M2 mutant to lose the binding activity owing to elimination of the palindrome sequence from nt 1106 to nt 1111. The results of the CAT assay (Figs. 4, 5) indicated the 58-bp fragment to express promoter activity, but DNA sequences immediately downstream the palindrome sequence to have none. Data from this assay using pXStMbCAT and pXStMbM2CAT showed the promoter activity of the 58-bp fragment to be increased by the HBV enhancer. The mutation in the palindrome sequence reduced not only binding of the cellular factor but also promoter activity, thus showing the factor to likely be the promoter binding protein, X-PBP. Sequences associated with basal promoter activity of the X gene have been shown to locate in rather wide region between nt 1032 to nt 1 187, containing the binding motifs of NF-1, UEBP, CREB/ATF, AP-1, and eHTF (Trujillo et a/., 1991), but the present findings on the X gene transcription clearly restricted the promoter region within 58-bp DNA (nt 1085 to nt 1 142). To confirm that marked reduction in the promoter activity is due to reduction in transcription, Northern blot analysis of transcripts from pXStMbCAT and pXStMbM2CAT was performed. As shown in Fig. 6A, two transcripts, different in size, were detected in each CAT construct and the pXStMbCAT transcript had six times the intensity of that of pXStMbM2CAT. The reason that two different-sized transcripts could be detected in this and the previous study is not known (Siddiqui et a/., 1987). Sl analysis (Fig. 6B) showed the transcription start sites of pXStMbCAT and pXStMbM2CAT to be located in the same region from nt 1090 to nt 1 100. These sites are slightly upstream from previously reported start sites localized in the region from nt 1 1 15 to nt 1220 (Treinin and Laub, 1987; Siddiqui et al., 1987; Trujillo et al., 1991). This diversity may be due to a difference in stability of the 5’end of X mRNA in a different in vivo system, in which X mRNA is expressed. The transcription start site of pX58pCAT without enhancer sequences of HBV could hardly be detected because of the signal being about one-fortieth that of pXStMbCAT with its enhancer sequences (Figs. 4 and 5A). The binding site of X-promoter binding protein identified in this study differs from the binding sites of various transcription factors previously found to bind to the enhancer/X-promoter region of HBV and is located a region further downstream compared to targets of known factors involved in the regulation of X gene transcription. The competition experiments in the mobility shift assay using binding motifs of four different transcription factors, whose target sequences had a partial
PROTEIN OF HBV
539
homology to the target sequence of X-PBP, showed X-PBP to likely be a novel factor. Two putative physiological functions of X-PBP may be expected: (1) X-PBP is a component of the initiation complex: (2) X-PBP is involved in transcription by interacting with a certain component of the transcriptional apparatus. Although no sequence homology has been found between the X-PBP binding sequence and the known initiator sequences, the sequence stretch in X-PBP binding site could be an another type of initiator sequence. The experiment to clone the cDNA of X-PBP is in progress. The homology search on the binding site (CGGCGCATGCGTGGAA) of X-PBP indicated X-PBP to possibly be involved not only in X gene transcription, but the transcription of cellular genes as well, such as human laminin receptor (2H5epitope) and lipoprotein receptor-related protein (LRP) genes. The promoter element of laminin receptor (2H5 epitope) gene (TCTGCGCGCATGCGTGGCA) and promoter element of LRP gene (ATCGGCGCATGCG) were shown to contain the element possessing high homology to the binding site of X-PBP. X-PBP may be primarily involved in the transcription of cellular genes possibly related to hepatocarcinogenesis. Thus, the function and the cDNA structure of X-PBP, which is indispensable to the X gene transcription, must be understood. ACKNOWLEDGMENTS This study was supported by a Grant-in-Aid for Cancer Research from the Ministry of Education, Science and Culture and a Grant-inAid for the Comprehensive 1O-Year Strategy for Cancer Control from the Ministry of Health and Welfare, Japan to K.K.
REFERENCES ARAKI, E., SHIMADA, F., SHICHIRI, M., MORI. M., and EEINA, Y. (1988). Low background CAT plasmid. Nucleic Acids Res. 16, 1627. AUFIERO, B., and SCHNEIDER,R. J. (1990). The hepatitis B virus X-gene product trans-activates both RNA polymerase II and III EMBO/. 9, 497404. BEN-LEW, R., FAKTOR. O., BERGER,I., and SHAUL. Y. (1989). Cellular factors that interact with the hepatitis B virus enhancer. Mol. Cell. No/. 9, 1804-l 809. CHIRGWIN.J. M., PRZYBYIA,A. E., MACDONALD, R. J., and RUITER, W. I. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294-5299. COLGROVE,R.. SINON, G., and GANEM, D. (1989). Transcriptional activation of homologous and heterologous genes by the hepatitis B virus X gene product in cells permissive for viral replication. J. Viral. 63,401 g-4026. DAVIDSON, I., XIAO, J. H., ROSALES, R.. STAUB, A., and CHAMBON, P. (1988). The HeLa cell protein TEF-1 binds specificaly and cooperatively to two SV40 enhancer motifs of unrelated sequence. Cell 54, 931-942. DIGNAM, J. D., LEBOVITZ, R. M., and REODER, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 14751489.
540
NAKAMURA
DIKSTEIN, R., FACTOR, O., BEN-LEVY, R., and SHAUL, Y. (1990a). Functional organization of the hepatitis B virus enhancer. iclol. Cell. Biol. 10, 3683-3689. DIKSTEIN,R., FACTOR,O., and SHAUL, Y. (1990b). Hierarchic and cooperative binding of rat liver nuclear protein C/EBP at the hepatitis B enhancer. Mol. Cell. Biol. 10, 4427-4430. DYNLACHT, B. D., HOEY, T., and TJIAN, R. (1991). Isolation of coactivators associated with the TATA-binding protein that mediates transcriptional activation. Cell 66, 563-576. FAKTOR, O., BUDLOVSKY,S., BEN-LEVY, R., and SHAUL, Y. (1990). A single element within the hepatitis B virus enhancer binds multiple proteins and responds to multiple stimuli. J. Viral. 64, 1861-l 863. FAVALORO, J., TREISMAN, R., and KAMEN, R. (1980). Transcription maps of polyoma virus-specific RNA: Analysis by two-dimensional nuclease St gel mapping. J. Viral. 65, 718-749. GALAS, D. J., and SCHMITZ, A. (1978). DNase foot-printing: A simple method for the detection of protein-DNA binding specificity. Nucleic Acids. Res. 5, 3157-3167. GERSTNER,T., and ROEDER, R. G. (1988). A herpes trans-activating protein interacts with transcription factor OTF-1 and other cellular proteins. Proc. Nat/ Acad. Sci. USA 85, 6347-635 1. GORMAN, C. M., MOFFAT, L. F., and HOWARD, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-1051. GRAHAM, F. L., and VAN DER Es, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52,456467. Hu, K.-Q., VIERLING,J. M., and SIDDIQUI. A. (1990). Trans.activation of HLA-DR gene by hepatitis B virus X gene product. Proc. Nat/. Acad. Sci. USA 87, 7 140-7 144. KATSUTA, H., and TAK~OK~, T. (1976). Improved synthetic media suitable for tissue culture of various mammalian cells. Methods Ce// Biol. 14, 145-l 58. KIM, C.-M., KOIKE, K., SAITO, I., MIYAMURA, T., and JAY, G. (1991). HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature 351, 317-320. KOBAYASHI,M., and KOIKE, K. (1984). Complete nucleotide sequence of hepatitis B virus DNA of subtype adr and its conserved gene organization. Gene 30, 227-232. KOIKE, K., KOBAYASHI, M., YAGINUMA, K., and SHIRAKATA, Y. (1987). Structure and function of integrated HBV DNA. In “Hepadna Viruses” (W. Robinson, K. Koike, and H. Will, Eds.). pp. 267-286. A. R. Liss. New York. KOIKE, K., SHIFIAKATA,Y., YAGINUMA, K., ARII, K., TAKADA, S., NAKAMURA, I., HAYASHI. Y., KAWADA, M., and KOBAYASHI,M. (1989). Oncogenic potential of hepatitis B virus. Mol. Biol. Med. 6, 151-l 60. KUET~, H. C., HERZ, J., and STANLEY, K. K. (1989). Structure of the low-density lipoprotein receptor-related protein (LRP) promoter. Biochim. Biophys. Acta 1009, 229-236. MAGUIRE, H. F., HOEFFLER,J. P.. and SIDDIQUI, A. (1991). HBV X protein alters the DNA binding specificity of CREB and ATF-2 by protein-protein interaction. Science 252, 842-844. MAHE. Y., MUKAIDA, N., KUNO, K., AKIYAMA, M., IKEDA, N., MATSUSHIMA, K., and MUFIAKAMI. S. (1991). Hepatitis B virus X protein transactivates human interleukin-8 gene through acting on nuclear factor kB and CCAAT/enhancer-binding protein-like cis-elements. 1. Biol. Chem. 266, 13759-l 3763. MITCHELL, P. J., and TJIAN, R. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245, 37 l-378. PARKER,B. A., and STARK, G. R. (1979). Regulation of similian virus 40 transcription: Sensitive analysis of the RNA species present early in infections by virus or viral RNA. J. Viral. 31, 360-365. PATEL, N. U.. JAMEEL, S., ISOM. H., and SIDDIQUI, A. (1989). Interac-
AND KOIKE tions between nuclear factors and hepatitis B virus enhancer. 1. Viral. 63, 5293-5301. PEI, D.. and SHIH, C. (1990). Transcriptional activation and repression by cellular DNA-binding protein C/EBP. 1. Viral. 64, 15171522. FTASHNE, M. (1988). How eukaryotic transcriptional activators work. Nature 335, 683-689. RITTER, S. E., WHITTEM, T. M., QUETS, A. T., and SCHLOEMER, R. H. (1991). An internal domain of the hepatitis B virus X antigen is necessary for transactivating activity. Virology 182, 841-845. SAITO, I., OVA, Y., and SHIMOJO, H. (1986). Novel RNAfamilystructure of hepatitis B virus expressed in human cells, using a helper-free adenovirus vector. J. Viral. 58, 554-560. SASSONE-CORSI,P., SISSON,J. C., and VERMA, I. M. (1988). Transcriptional autoregulation of the proto-oncogene fos. Nature 334, 314319. SETO. E., MITCHELL, P. J., and YEN, T. S. (1990). Transactivation by the hepatitis B virus X protein depends on AP-2 and other transcription factors. Nature 344, 72-74. SETO, E., YEN, T. S. B., PETERLIN,B. M., and Ou, J. (1988). Trans-activation of the human immunodeficiency virus long terminal repeat by the hepatitis B virus X protein. Proc. Nat/. Acad. Sci. USA 85, 8286-8290. SHIRAKATA,Y., KAWADA, M., FUJIKI,Y., SANO, H., ODA, M., YAGINUMA, K., KOBAYASHI,M., and KOIKE, K. (1989). The X gene of hepatitis B virus induced growth stimulation and tumorigenic transformation of mouse NIH3T3 cells. Jpn. J. Cancer Res. 80, 617-621. SIDDIQUI,A., GAYNOR, R., SRINIVASAN.A., MAPOLES,J., and FARR, R. W. (1989). Trans-activation of viral enhancers including long terminal repeat of the human immunodeficiency virus by the hepatitis B virus X protein. Virology 169, 479-484. SIDDIQUI, A., JAMEEL,S., and MAPOLES,J. (1987). Expression of hepatitis B virus X gene in mammalian cells. Proc. Nat/. Acad. Sci. USA 84, 2513-2517. SPANDAU, D. F., and LEE, C. (1988). Trans-activation of viral enhancers by the hepatitis B virus X protein. 1. Viral. 62, 427-434. TAKADA, S., and KOIKE, K. (1990). Trans-activation function of 3’truncated X gene-cell fusion product from integrated hepatitis B virus DNA in chronic hepatitis tissues. Proc. Nat/. Acad. Sci. USA 87, 5628-5632. TAKADA, S., and KOIKE,K. (1990). X protein of hepatitis B virus resembles a serine protease inhibitor. Jpn. J. Cancer Res. 81, 11911194. TREININ. M., and LAuB, 0. (1987). Identification of a promoterelement located upstream from the hepatitis B virus X gene. Mol. Cell. Biol. 7,545-548. TRUJILLO, M. A., LETOVSKY,J., MAGUIRE, H. F., LOPEZ-CABRERA,M., and SIDDIQUI, A. (1991). Proc. Nat/. Acad. Sci. USA 88, 37973801. Twu, J., and ROBINSON, W. S. (1989). Hepatitis B virus X gene can transactivate heterologous viral sequences. Proc. Nat/. Acad. Sci. USA 86,2046-2050. UNGAR, T., and SHAUL, Y. (1990). The X protein of the hepatitis B virus acts as a transcription factor when targeted to its responsive element. EMBO 1. 9, 1889-l 895. WEWER, U. M., LIOITA, L. A., JAYE. M., RICCA, G. A., DROHAN, W. N., CLAYSMITH, A. P., RAO, C. N., WIRTH, P., COLIGAN, 1. E.. ALBRECHTSEN. R., MUDRYL, M., and SOBEL, M. E. (1986). Altered levels of laminin receptor mRNA in various human carcinoma cells that have different abilities to bind laminin. Proc. Nat/. Acad. Sci. USA 83, 7137-7141. Wu. J. Y., ZHOU, Z.-Y., JUDD, A., CARWRIGHT, C. A., and ROBINSON, W. S. (1990). The hepatitis B virual encoded transcriptional transactivator hbx appears to be a novel protein serine threonine kinase. Cell 63, 687-695.
191,
533-540
Identification
(19%)
of a Binding
Protein to the X Gene Promoter
Region of Hepatitis
B Virus
IKUO NAKAMURA AND KATSURO KOIKE’ Department
of Gene Research, Cancer Institute, JFCR, Kami-lkebukuro, Toshima-ku, Received May 2 1I 1992; accepted August 10, 1992
Tokyo 170, Japan
The X protein of hepatitis B virus (HBV) is a transactivator to homologous and heterologous viral and cellular transcriptional regulatory elements. One sequence-specific binding protein, whose binding site located from nt 1102 to nt 1117 of HBV DNA, was identified by mobility shift assay and DNase I foot-printing analysis. A CAT assay experiment demonstrated this 16-bp binding site to have a promoter activity in the X gene transcription. The 58-bp DNA fragment (nt 1085 to nt 1142), which contains the above binding site, could be enhanced by the HBV enhancer. Mobility shift assay using the mutated 58-bp DNA fragments as probes, showed that the mutation, which damaged the palindrome structure between nt 1105 and nt 1112, resulted in loss of the binding activity. This mutation also remarkably reduced the promoter activity. The binding site differed from the target sequences of known transcriptional factors. This factor was thus concluded to be a binding protein to the X gene promoter (X-PBP) of HBV. A homology search demonstrated the binding site to be highly homologous to the promoter elements of human laminin receptor (2HBepitope) and lipoprotein receptor-related protein (LRP) genes. o 1992 Academic PUSS, h.
INTRODUCTION
as CYEBP, NF-1, AP-1, HBLF, EF-C, and eH-TF were found to interact with the HBV enhancer/X promoter region (Ben-Levy et al., 1989; Pate1 et al., 1989; Faktor et a/., 1990; Dikstein et a/., 1990a,b; Trujillo et a/., 1991). But there are noTATA nor GC boxsequences in the X promoter region. The 25-bp element in HBV enhancer was identified as an X-responsive element. The X protein may possibly alter the binding activity of CREB and ATF-2 to the X-responsive element by protein-protein interaction (Maguire et al., 1991) and its function(s) may also be expressed by interacting with AP-2 or C/EBP (Ungar and Shaul, 1990; Pei and Shih, 1990). However, an exact role of each factor in the transcription of X mRNA remains unclear (Ben-Levy et al., 1989; Pate1 et al., 1989; Faktor et al., 1990; Dikstein et a/., 1990a,b; Trujillo et a/., 1991). In the current study, search was made for a cellular factor for X gene transcription and a specific binding protein, whose binding site is located from nt 1 102 to nt 1117 of HBV DNA, was found. Mutation into the palindrome structure in the binding sequence resulted in loss of the binding activity of this factor and promoter activity as well. This binding protein would thus appear to be a promoter-binding protein (X-PBP) that binds specifically to the X gene promoter of HBV and is essential to the regulation of X gene transcription. The binding site of this X-PBP was found to be quite different from binding sites of known transcription factors and thus this factor may be one discovered here for the first time.
Hepatitis B virus (HBV) is a human DNA virus that causes acute and chronic hepatitis and is closely associated with hepatocarcinogenesis. The HBV X gene contains an open reading frame (ORF) that encodes 154 amino acids. This protein has been found to transactivate homologous and heterologous transcriptional regulatory elements of viral and cellular genes (Koike et a/., 1987,1989; Takada and Koike, 1990; Spandau and Lee, 1988; Seto et al., 1988, 1990; Siddiqui et a/., 1989; Twu and Robinson, 1989; Colgrove et al., 1989; Aufiero and Schneider, 1990; Hu et al., 1990; Ritter et al., 1991; Mahe et a/., 1991). There are two reports with regard to its functions. One indicated the X protein to possibly be a serine/threonine kinase (Wu et al., 1990) and the other predicted the X protein to contain a unique domain structure resembling a serine protease inhibitor (Takada and Koike, 1990). It also has transforming potential, according to studies using X geneintroduced NIH3T3 cells (Shirakata et al., 1989) and X gene-introduced transgenic mice (Kim et a/., 1991). However, the functions of X protein involved in HBV infection and HBV-induced hepatocarcinogenesis remains to be further elucidated. Contacts between DNA and protein and proteinprotein interactions are important for efficient and specific transcription (Ptashne, 1988; Sassone-Corsi eta/., 1988; Dynalacht et al., 1991). To date, little is known about such interactions involved in the X gene transcription of HBV. The X gene promoter re,gion and HBV enhancer element are located in a region about 140 bp upstream of the ATG codon of X ORF (Treinin and Laub, 1987; Siddiqui et al., 1987). Some factors, such
MATERIALS
AND METHODS
Cell lines HUH-~ and HepG2 were derived from human hepatocellular carcinoma and human hepatoblastoma, re-
’ To whom reprint requests should be addressed. 533
0042-6822192
55.00
Copyright 0 1992 by Academic Press. Inc. All rights of reproduction in any form reserved.
534
NAKAMURA
spectively. Both cell lines were negative for HBV integration. HeLa was from human uterus carcinoma and NIH3T3 from mouse fibroblasts. These cell lines were maintained in DM160 containing 10% fetal calf serum and 60 mg/ml aminoglycoside (Katsuta and Takaoka, 1976). Preparation assay
of nuclear
extract
and mobility
shift
AND KOIKE
gene into the HindIll site of the pSVOOCAT plasmid, which does not contain a promoter element (Araki et al., 1988). The plasmids constructed were named pX58pCAT and pX58pRCAT. The pXMbNcCAT plasmid was generated by inserting the synthetic DNA fragment (nt 1 140 to nt 1240) into the HindIll site of the pSVOOCAT plasmid. The pXStMbCAT was generated by inserting the StullA&ol fragment (nt 988 to nt 1136) of HBV DNA containing an enhancer sequence into the HindIll site of pSVOOCAT. Three kinds of mutant 58-bp DNA fragments with a 5- or 6-bp change were synthesized. Each mutant fragment was inserted into the vector plasmid and the resulting plasmids were named pX58pM 1CAT, pX58pM2CAT, and pX58pM3CAT. The plasmid pXStMbM2CAT was constructed by introducing the mutant 58-bp fragment (M2) into pXStM bCAT.
Nuclear extracts were prepared by the method of Dignam et al. (1983). Nuclear protein of 10 rg and the 5’end-labeled DNAfragment were incubated in 20 ~1of binding buffer (10 mM Tris-HCI, 1 mM EDTA, 1 mh/l dithiothreitol, 50 m&I NaCI, and 10 mg/ml sonicated salmon sperm DNA) at 25” for 30 min. The samples were loaded on 4% polyacrylamide gels equilibrated with 6.6 mh/lTris-HCI (pH 7.6) 1 mn/r EDTA, 3.3 mM sodium acetate. After electrophoresis, the gels were dried and autoradiographed. The 5’ends of StullBamHI fragment, StullSphl fragment, SphllBamHI fragment, and Ball/A&o1 fragment (nt 988 to nt 1284, nt 988 to nt 1110, nt 1110 to nt 1284, and nt 1090 to nt 1136, respectively) of HBV DNA and chemically synthesized 58-bp fragment (nt 1085 to nt 1142) on the HBV DNA (Kobayashi and Koike, 1984) and mutated 58-bp fragments (Ml, M2, and M3) were labeled and used as probes. In the competition experiments, a Balllllllbol fragment was used as a competitor. Competition experiments in the mobility shift assay using the DNA fragments including the binding sites of TEF-1 (Davidson et al., 1988) OTF-1 (Gerstner and Roeder, 1988) NFKB (Mitchell and Tjian, 1989) and AP-2 (Seto et a/., 1990) as the competitor were also carried out. TEF-1, OGT2-52 (5’ TCGGGCACCTGTGGAATGTGTGTC 3’); OTFl I (5’ ClTCACCTTAllTGCATAAGCG 3’); NFKB, (5’ GATCCAGAGGGGACTTTCCGAGAG 3’); and AP-2, (5’ GGTGTGGAAAGTCCCCAGGCTCCCCAGC 3’).
This assay was performed several times each in duplicate according to the method of Gorman eta/. (1982) and quantitated by liquid scintillation counting after thin-layer chromatography. All assays were performed within a linear range.
DNase I footprinting
Preparation
The [32P]5’end-labeled StullBamHI fragment of HBV DNA and nuclear extract were incubated at 25” for 30 min, as described above. DNase I was then added to 1 mg/ml and the mixture was incubated at 25” for 10 min followed by electrophoresis on a 4% polyacrylamide gel. Protein-associated DNA and free DNA were eluted separately and analyzed on an 8% polyacrylamide gel containing 7 M urea as previously described (Galas and Schmitz, 1978).
RNA was prepared from DNA-transfected (pXStMbCAT or pXStMbM2CAT) Huh-7 cells by the guanidium-cesium chloride method (Chirgwin et a/., 1979). All RNA samples were electrophoresed on an agarose gel containing 2.2 Mformaldehyde and transferred to a nitrocellulose filter. The 570-bp Ball/Ball DNA fragment was labeled by the nick translation method and used as a probe in Northern blotting.
DNA transfection This was done by the calcium phosphate precipitation method (Graham and van der Eb, 1973) with 20 pg of plasmid DNA in the buffer (50 m/l/l HEPES, 280 mM NaCI, 10 ml\/l KCI, 1.5 m/W Na*HPO,-2H,O, 12 mM glucose). The HUH-~ cells were plated at a density of 3 X 1O6 per 1O-cm dish and incubated with DNA precipitates for 6 hr at 37”. Glycerol shock (15% glycerol/ DMl60) was then carried out for 3 min (Parker and Stark, 1979). Incubation at 37” was conducted for 48 hr. CAT assay
Nuclease Construction
of plasmid
DNAs
The synthetic 58-bp fragment (nt 1085 to nt 1142), bearing the binding site of cellular factor, was inserted in the right or reverse orientation upstream of the CAT
of RNA and Northern
blotting
Sl mapping
pXStMbCAT and pXStMbM2CAT were digested with Pvull and their 5’-ends were labeled by T4 polynucleotide kinase. The [32P]pVull/Bglll 0.3-kb fragment was then prepared by Bglll digestion and used as a
X PROMOTER
BINDING
C gJ i?iiz
5
competitor (w)
0
5
IO
50
FIG. 1. Identification of a specific binding factor to the upstream sequence of the HBV X gene. (A) Structure of the upstream region of the HBV X gene. Restriction map of the DNA are derived from HBV DNA (Kobayashi and Koike, 1984). A shaded area indicates a region containing upstream enhancer sequences. St, Sful; Bal, Ball; Sp, Sphl; Mb, Mbol; Barn. BarnHI. (B) Detection of a specific factor binding to the HBV enhancer/X promoter region by gel shift assay. The 5’ end labeled probe was prepared from the 287-bp StullBamHI fragment of HBV DNA, and the probe was used for binding reactions with each nuclear extract from HUH-~. HepG2, HeLa, or NIH3T3 cells, followed by electrophoresis on 4% polyacrylamide gel. The shorter bold line with an asterisk indicates the probe. The arrow indicates the discrete signal in the gel shift assay. (C) Competition assay. The unlabeled 47-bp Ball/A&o1 fragment was used as a competttor.
probe. Nuclease Sl mapping was done as previously described (Favaloro et al., 1980). The protected product was subjected to 7 M urea-contained polyactylamide gel electrophoresis and its size estimated and compared with those of markers of the 32P-labeled Hinfl-digested fragments of pBR322 DNA. RESULTS Sequence-specific binding of the cellular the upstream sequences of HBV X gene
factor to
To find a cellular factor which binds to upstream sequences of HBV X gene, a mobility shift assay was conducted using a 32P-labeled 287-bp StullBamHI fragment as the probe (Fig. 1A). This fragment was expected to contain both the promoter region and the HBV enhancer element (Treinin and Laub, 1987; Siddi-
PROTEIN OF HBV
535
qui et a/., 1987; this study). As shown in Fig. 1B, one major band was observed in all cases using nuclear extracts of HUH-~, HepG2, HeLa, and NIH3T3 cell lines in the presence of sonicated salmon sperm DNAas the nonspecific competitor. In contrast, several bands were observed when a double-stranded poly(dl-dC) was used instead of a sonicated salmon sperm DNA (data not shown), consistent with the previous indications that many cellular factors are known to interact with the enhancer region (Ben-Levy et a/., 1989). To show that this single binding is in sequence-specific manner, the BalllMbol DNA fragment was added as a competitor in the mobility shift assay (Fig. 1C). The binding of this factor to the StullBamHI fragment was found to be specific and ubiquitous. To determine the binding site of this factor, the mobility shift assay was carried out using a left- or right-half probe. When the StullSphl DNA fragment or Sphll BarnHI fragment of HBV DNA was used as the probe, the discrete band ceased to be detectable, as shown in Fig. 2A. The binding site of this factor may possibly be split into two parts at the Sphl restriction site. For confirmation of this, DNase I foot-printing experiments were carried out. The target site of this binding factor was shown to be located in a region between nt 1096 and nt 11 17 of HBV DNA (Fig. 2B). Loss of the binding activity of the cellular factor by introducing a mutation into the 58-bp fragment of HBV DNA To determine the sequence responsible for the protein binding, three different mutations (Ml, M2, and M3) were introduced into the 58-bp fragment of HBV DNA between nt 1085 and nt 1142 (including a Ball/ lVIbol fragment) by chemical synthesis (Fig. 2C). A mobility shift assay was then conducted using such mutant DNAs as probes. The binding activity of the cellular factor to the mutant 58-bp DNA fragment (M2) with a 6-bp change (nt 1106 to nt 11 11) in the palindrome structure (nt 1 105 to nt 1 112) was shown to be lost (Fig. 2D). Ml and M3 mutations had no inhibitory effect on the binding activity of the cellular factor to the 58-bp DNA fragment, indicating the binding site to be located in the 16-bp sequence from nt 1102 to nt 1117. Effect of binding motifs of the known transcriptional factors upon the binding activity of cellular factor to the 58-bp DNA fragment To examine this binding factor to be relevant to known factors, the competition experiments were carried out in the mobility shift assay using four DNA fragments containing known binding sites of TEF-1 (Davidson et al., 1988), OTF-1 (Gerstner and Roeder, 1988), NFKB (Mitchell and Tjian, 1989), and AP-2 (Seto et al., 1990), all partially homologous to the 58-bp DNA
536
NAKAMURA
A
I
Bal SP Mb
Barn
AND KOIKE
B SC
IhI sp Mb
earn
CF
Mb
FIG. 2. Analysis of the binding site of the cellular factor and sequences responsible for the protein binding in the 58-bp HBV DNA fragment. (A) Gel shift assay. The three different 32P-labeled DNA fragments were used as probes. The 287-bp SfullBamHI fragment(*), 123-bp SfullSphl fragment?*), and 164-bp SphllBamHI fragment(***) prepared from HBV DNA were incubated at 25” for 30 min followed by electrophoresis on a 4% polyacrylamide gel. (B) DNase I foot-printing. The 5’end of StullBamHI fragment of HBV DNA was 3zP-labeled only at the BarnHI site and used as the probe. The nuclear extract and this probe were incubated at 25” for 30 min as described under Materials and Methods. DNase I was then added to 1 mg/ml and the mixture was incubated at 25” for 10 min followed by electrophoresis on a 4% polyacrylamide gel. Protein-complexed DNA and free DNA were eluted separately and analyzed on an 8% polyacrylamide gel containing 7 IM. The binding site is indicated by the black box on the HBV genome. C, DNA-protein complex; F, free DNA. The bold line on the HBV map demonstrates the protected region in this experiment. (C) Schematic representation of the chemically synthesized 58-bp fragment of HBV DNA (nt 1085 to nt 1 142) and three different mutated 58.bp DNA fragments. The WT fragment is 58-bp fragment of HBV DNA from nt 1085 to nt 1142. The M 1 fragment is the 58-bp DNA fragment contained 5 bp change from nt 1097 to nt 110 1. The M2 fragment is the 58-bp fragment mutated from nt 1106 to 1 1 1 1, and the M3 fragment is the 58-bp fragment mutated from nt 1090 to nt 1095. FP indicates the protected region in Fig. 2B. (D) Elimination of binding activity by introducing a mutation into the 58-bp fragment of HBV. WT, Ml, M2, and M3 DNA fragments were subjected to the binding reaction using nuclear extract and analyzed by electrophoresis on a 4% polyacrylamide gel by the method in Fig. 1 B.
sequence. Figure 3 shows that the OTFl -binding motif exhibited no inhibitory effect at all on the binding activity of the cellular factor to the 58-bp fragment. The other DNA fragment containing the binding motif of TEF-1, NFKB, or AP2 also showed no competition under the conditions of the mobility shift assay (data not shown). Promoter activity of the 58-bp DNA fragment X gene transcription
in the
To examine the promoter activity of the 58-bp DNA fragment (nt 1085 to nt 1 142) in X gene transcription,
two plasmids, pX58pCAT and pX58pRCAT, each containing chloramphenicol acetyltransferase (CAT) gene controlled by the synthetic 58-bp DNA fragment in right or reverse orientation, respectively, were constructed. CAT assay using plasmids pX58pCAT and pX58pRCAT showed the 58-bp fragment to possess promoter activity (Figs. 4 and 5A). The ~~ollA/col DNA fragment had no promoter activity when examined- with pXMbNcCAT (Figs. 4 and 5A). The CAT assay using pXStMbCAT clearly showed HBV enhancer sequences in the SrullBall region to markedly stimulate the promoter activity of the 58-bp fragment of HBV
X PROMOTER competitor (nn)
0
BINDING
1 10 loo
537
PROTEIN OF HBV
c
A
L
(OTF- I )
3-K
*
B
FIG. 3. Effects of binding motifs of known transcriptional factors on the binding activity of the cellular factor. Competition experiments in the mobility shift assay using the DNA fragments containing the binding sites of TEF-1, OTF-1, NFkB, and AP-2. were carried out. The results of the competition experiment using the DNA fragment containing the binding site of OTFl are shown.
DNA (Figs. 4 and 5A). In the separate experiments promoter activity was detected in the BalllMbol DNA fragment, but not in the SrullBall DNA fragment, when ex-
pX58pCAT pXS8pRCAT pXMbNcCAT pXStMbCAT pX58pYl
CAT
pX.58pMXAT pX58phWCAT pXStMbM2CAT
FIG. 4. Regulatory function of the cellular factor in the X gene transcription. Schematic representation of plasmids containing the CAT gene controlled by the HBV DNA fragment or its mutant and CAT activity assay. pX58pCAT and pX58pRCAT were generated by inserting the synthetic 58-bp fragment into the HindIll site of the pSVOOCAT in right or reverse orientation. The pXMbNcCAT plasmid was generated by inserting the synthetic DNA fragment (nt 1140 to nt 1240) into the HindIll site of the pSVOOCAT plasmid. The pXStMbCAT was generated by inserting the SfullMbol fragment of HBV DNA, containing an enhancer sequence, into the HindIll site of pSVOOCAT. Three kinds of mutant 58-bp DNA fragments with a 5- or 6-bp change (Ml, M2, and M3) as described in Fig. 2C were inserted into the vector plasmid and resulting plasmids were named pX58pMlCAT. pX58pM2CAT, and pX58pM3CAT. The plasmid pXStMbM2CAT was constructed by introducing the mutant 58-bp fragment (M2) into pXStMbCAT as described in Fig. 2C. The values of CAT activity in transfected HUH-~ cells are given, relative to the activity expressed by pX58pCAT, taken as 1.
CAM-t FIG. 5. CAT activity assay of plasmids containing the CAT gene controlled by the HBV DNA fragment or its mutants. (A) CAT assay of lysates prepared from HUH-~ cells transfected with pSVOOCAT, pX58pCAT, pX58pRCAT, pXMbNcCAT, and pXStMbCAT. CAM indicates chloramphenicol, and ~-AC and ~-AC. acetylated forms of chloramphenicol. (B) CAT activity assay of pX58pCAT. pX58pMlCAT, pX58pM2CAT, and pX58pM3CAT. (C) CAT activity assay of pXStMbCAT and pXStMbM2CAT.
amined with pXBaMbCAT and pXStBaCAT, respectively (data not shown). Three different plasmids were controlled by the 58bp fragment with a 5- or 6-bp change (pX58pMl CAT, pX58pM2CAT, and pX58pM3CAT). pX58pM 1CAT and pX58pM3CAT had promoter activity as did also pX58pCAT, while pX58pM2CAT had almost no promoter activity (Figs. 4 and 58). To show that the marked reduction in binding and promoter activity was not due to unique structure lllllT, different mutation ATCGAT instead of lllllT was introduced and the same experiment was carried out. The ATCGAT mutation again greatly reduced the binding and promoter activity of the 58-bp DNA fragment (data not shown). A plasmid pXStMbM2CAT was subsequently constructed by introducing the mutant 58-bp fragment (M2) into pXStMbCAT. This plasmid (pXStMbM2CAT) showed below one-fifth the promoter activity of pXStMbCAT (Figs. 4 and 5C), indicating that most, if not all, of this activity to be due to the 16-bp sequence from nt 1 102 to nt 1 1 17 in the binding site of the cellular factor. Transcription
of pXStMbCAT
and pXStMbM2CAT
As shown in Fig. 6A, Northern blotting of transcripts from pXStMbCAT and pXStMbM2CAT showed two
NAKAMURA
538
A
and nt 1100 + 2) (Fig. 6B). Interaction between the cellular factor and palindrome structure (nt 1 105 to nt 1 1 12) would thus appear essential to the regulation of the X gene transcription. On the other hand, the transcription start site of pX58pCAT could hardly be determined because of the signal being about one-fortieth that of pXStMbCAT. Homology
7.5kb-
1.4kb-
AND KOIKE
=
FIG. 6. Transcription of pXStMbCAT and pXStMbM2CAT. (A) Northern blotting. RNA was prepared from HUH-~ cells transfected with pXStMbCAT DNA or pXStMbM2CAT DNA by the guanidiumcesium chloride method. The RNA samples were electrophoresed on an agarose gel containing 2.2 M formaldehyde and transferred to nitrocellulose filter. The 32P-labeled 570-bp Ball/Ball DNA fragment taken from pXStMbCAT by nick translation was used as a probe. The arrows indicate the signals of interest. Ori indicates the position of the well and positions of size marker are shown on the left of the autoradiographed picture. (El) Nuclease Sl mapping. pXStMbCAT and pXStMbM2CAT were digested with h/ull and their Y-ends were labeled by T4 polynucleotide kinase. The 32P-labeled PvulllBgllI 0.3. kb fragment was then prepared and used as the probe. The protected products were subjected to 7 M urea-contained polyacrylamide gel electrophoresis and size was estimated and compared with those of the markers of 32P-labeled Hinfl-digested fragments of pSR322 DNA. The symbol (+) or (-) indicates the presence or absence of RNA samples in the mixture. The right two lanes are the longer exposed picture of the middle two lanes (pXStMbM2CAT). Arrows indicate major signals.
bands, one major (2.9 kb) and the other minor (2.2 kb). The transcription was demonstrated to be much less efficient in the case of pXStMbM2CAT than that of pXStMbCAT. The reduction of CAT activity in pXStMbM2CAT in Figs. 4 and 5C would be due to decrease in transcription from pXStMbM2CAT. Sl nuclease analysis of the 5’ ends of the pXStMbCAT transcript showed the presence of two start sites (nt 1090 + 2 and nt 1100 4 2) upstream the palindrome structure (Fig. 6B). Similar start sites of X gene transcript were also previously mapped upstream the X promoter region (Ben-Levy et a/., 1989). To examine whether reduction in mRNA in the case of pXStMbM2CAT was the result of changing the start site of pXStMbM2CAT, Sl nuclease analysis was carried out. Although the start site of pXStMbM2CAT was not clearly demonstrated because of the signal being below one-fifth that of pXStMbCAT (Fig. 6A), the start sites of pXStMbCAT and pXStMbM2CAT did not differ much (nt 1090 + 2
search for the binding sequence
of X-PBP
As the 16-bp sequence (CGGCGCATGCGTGGAA) in the 58-bp region of X gene was shown to be an essential region for the protein binding, a search was made for homology using the DNA database. This sequence in the 58-bp region was found to be highly homologous to the promoter elements of human laminin receptor (2H5 epitope) gene (TCTGCGCGCATGCGTGGCA) (Wewer et a/., 1986) and of human lipoprotein receptor-related protein (LRP) gene (ATCGGCGCATGCG) (Kuett et a/., 1989). Perfect homology was observed in the 8-bp sequence (CGCATGCG) which forms the palindrome structure. The exact role of the 8-bp sequence has not been known in two cases, but the sequence may interact with same cellular protein which was designated as the X-PBP. DISCUSSION Examination was made of the characteristics of the binding of a novel cellular factor to the promoter region of HBV X gene, X-promoter binding protein (X-PBP). The binding site of this factor was found to be located in the 16-bp sequence from nt 1 102 to nt 1117. Previous studies indicated sequence motifs with homology to the binding sites of transcriptional factors such as C/EBP, AP-1, CREB/ATF, NF-1, HBLF, eH-TF, and EF-C to be located in the HBV enhancer/X-promoter region (Ben-Levy et al., 1989; Pate1 et a/., 1989; Faktor et a/., 1990; Dikstein et al., 1990a,b; Trujillo et a/., 1991). However, the binding site of X-PBP in this study differed from and was located downstream of any binding motifs of the above transcription factors. This is a novel factor capable of binding to the X-promoter region and is essential for initiation of X mRNA synthesis near the binding site. Mobility shift assay using the StullBamHI DNA probe (Fig. 1 B), containing the entire upstream region from the major start site previously reported (Siddiqui et al., 1987; Treinin and Laub, 1987; Trujillo et al., 1991; Saito et a/., 1986) (Fig. 2A), clearly demonstrated the existence of a binding factor. This shift assay using two shorter (123 and 164 bp) probes (Fig. 2A) and DNasel foot-printing (Fig. 2B) indicated the target sequence of this factor to possibly be from nt 1096 to nt 1 1 17. Mobility shift assay using three mutant probes (Fig. ZC), in
X PROMOTER
BINDING
which the 6-bp mutation had been introduced into the 58-bp DNA fragment (nt 1085 to nt 1142), showed the M2 mutant to lose the binding activity owing to elimination of the palindrome sequence from nt 1106 to nt 1111. The results of the CAT assay (Figs. 4, 5) indicated the 58-bp fragment to express promoter activity, but DNA sequences immediately downstream the palindrome sequence to have none. Data from this assay using pXStMbCAT and pXStMbM2CAT showed the promoter activity of the 58-bp fragment to be increased by the HBV enhancer. The mutation in the palindrome sequence reduced not only binding of the cellular factor but also promoter activity, thus showing the factor to likely be the promoter binding protein, X-PBP. Sequences associated with basal promoter activity of the X gene have been shown to locate in rather wide region between nt 1032 to nt 1 187, containing the binding motifs of NF-1, UEBP, CREB/ATF, AP-1, and eHTF (Trujillo et a/., 1991), but the present findings on the X gene transcription clearly restricted the promoter region within 58-bp DNA (nt 1085 to nt 1 142). To confirm that marked reduction in the promoter activity is due to reduction in transcription, Northern blot analysis of transcripts from pXStMbCAT and pXStMbM2CAT was performed. As shown in Fig. 6A, two transcripts, different in size, were detected in each CAT construct and the pXStMbCAT transcript had six times the intensity of that of pXStMbM2CAT. The reason that two different-sized transcripts could be detected in this and the previous study is not known (Siddiqui et a/., 1987). Sl analysis (Fig. 6B) showed the transcription start sites of pXStMbCAT and pXStMbM2CAT to be located in the same region from nt 1090 to nt 1 100. These sites are slightly upstream from previously reported start sites localized in the region from nt 1 1 15 to nt 1220 (Treinin and Laub, 1987; Siddiqui et al., 1987; Trujillo et al., 1991). This diversity may be due to a difference in stability of the 5’end of X mRNA in a different in vivo system, in which X mRNA is expressed. The transcription start site of pX58pCAT without enhancer sequences of HBV could hardly be detected because of the signal being about one-fortieth that of pXStMbCAT with its enhancer sequences (Figs. 4 and 5A). The binding site of X-promoter binding protein identified in this study differs from the binding sites of various transcription factors previously found to bind to the enhancer/X-promoter region of HBV and is located a region further downstream compared to targets of known factors involved in the regulation of X gene transcription. The competition experiments in the mobility shift assay using binding motifs of four different transcription factors, whose target sequences had a partial
PROTEIN OF HBV
539
homology to the target sequence of X-PBP, showed X-PBP to likely be a novel factor. Two putative physiological functions of X-PBP may be expected: (1) X-PBP is a component of the initiation complex: (2) X-PBP is involved in transcription by interacting with a certain component of the transcriptional apparatus. Although no sequence homology has been found between the X-PBP binding sequence and the known initiator sequences, the sequence stretch in X-PBP binding site could be an another type of initiator sequence. The experiment to clone the cDNA of X-PBP is in progress. The homology search on the binding site (CGGCGCATGCGTGGAA) of X-PBP indicated X-PBP to possibly be involved not only in X gene transcription, but the transcription of cellular genes as well, such as human laminin receptor (2H5epitope) and lipoprotein receptor-related protein (LRP) genes. The promoter element of laminin receptor (2H5 epitope) gene (TCTGCGCGCATGCGTGGCA) and promoter element of LRP gene (ATCGGCGCATGCG) were shown to contain the element possessing high homology to the binding site of X-PBP. X-PBP may be primarily involved in the transcription of cellular genes possibly related to hepatocarcinogenesis. Thus, the function and the cDNA structure of X-PBP, which is indispensable to the X gene transcription, must be understood. ACKNOWLEDGMENTS This study was supported by a Grant-in-Aid for Cancer Research from the Ministry of Education, Science and Culture and a Grant-inAid for the Comprehensive 1O-Year Strategy for Cancer Control from the Ministry of Health and Welfare, Japan to K.K.
REFERENCES ARAKI, E., SHIMADA, F., SHICHIRI, M., MORI. M., and EEINA, Y. (1988). Low background CAT plasmid. Nucleic Acids Res. 16, 1627. AUFIERO, B., and SCHNEIDER,R. J. (1990). The hepatitis B virus X-gene product trans-activates both RNA polymerase II and III EMBO/. 9, 497404. BEN-LEW, R., FAKTOR. O., BERGER,I., and SHAUL. Y. (1989). Cellular factors that interact with the hepatitis B virus enhancer. Mol. Cell. No/. 9, 1804-l 809. CHIRGWIN.J. M., PRZYBYIA,A. E., MACDONALD, R. J., and RUITER, W. I. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294-5299. COLGROVE,R.. SINON, G., and GANEM, D. (1989). Transcriptional activation of homologous and heterologous genes by the hepatitis B virus X gene product in cells permissive for viral replication. J. Viral. 63,401 g-4026. DAVIDSON, I., XIAO, J. H., ROSALES, R.. STAUB, A., and CHAMBON, P. (1988). The HeLa cell protein TEF-1 binds specificaly and cooperatively to two SV40 enhancer motifs of unrelated sequence. Cell 54, 931-942. DIGNAM, J. D., LEBOVITZ, R. M., and REODER, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 14751489.
540
NAKAMURA
DIKSTEIN, R., FACTOR, O., BEN-LEVY, R., and SHAUL, Y. (1990a). Functional organization of the hepatitis B virus enhancer. iclol. Cell. Biol. 10, 3683-3689. DIKSTEIN,R., FACTOR,O., and SHAUL, Y. (1990b). Hierarchic and cooperative binding of rat liver nuclear protein C/EBP at the hepatitis B enhancer. Mol. Cell. Biol. 10, 4427-4430. DYNLACHT, B. D., HOEY, T., and TJIAN, R. (1991). Isolation of coactivators associated with the TATA-binding protein that mediates transcriptional activation. Cell 66, 563-576. FAKTOR, O., BUDLOVSKY,S., BEN-LEVY, R., and SHAUL, Y. (1990). A single element within the hepatitis B virus enhancer binds multiple proteins and responds to multiple stimuli. J. Viral. 64, 1861-l 863. FAVALORO, J., TREISMAN, R., and KAMEN, R. (1980). Transcription maps of polyoma virus-specific RNA: Analysis by two-dimensional nuclease St gel mapping. J. Viral. 65, 718-749. GALAS, D. J., and SCHMITZ, A. (1978). DNase foot-printing: A simple method for the detection of protein-DNA binding specificity. Nucleic Acids. Res. 5, 3157-3167. GERSTNER,T., and ROEDER, R. G. (1988). A herpes trans-activating protein interacts with transcription factor OTF-1 and other cellular proteins. Proc. Nat/ Acad. Sci. USA 85, 6347-635 1. GORMAN, C. M., MOFFAT, L. F., and HOWARD, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-1051. GRAHAM, F. L., and VAN DER Es, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52,456467. Hu, K.-Q., VIERLING,J. M., and SIDDIQUI. A. (1990). Trans.activation of HLA-DR gene by hepatitis B virus X gene product. Proc. Nat/. Acad. Sci. USA 87, 7 140-7 144. KATSUTA, H., and TAK~OK~, T. (1976). Improved synthetic media suitable for tissue culture of various mammalian cells. Methods Ce// Biol. 14, 145-l 58. KIM, C.-M., KOIKE, K., SAITO, I., MIYAMURA, T., and JAY, G. (1991). HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature 351, 317-320. KOBAYASHI,M., and KOIKE, K. (1984). Complete nucleotide sequence of hepatitis B virus DNA of subtype adr and its conserved gene organization. Gene 30, 227-232. KOIKE, K., KOBAYASHI, M., YAGINUMA, K., and SHIRAKATA, Y. (1987). Structure and function of integrated HBV DNA. In “Hepadna Viruses” (W. Robinson, K. Koike, and H. Will, Eds.). pp. 267-286. A. R. Liss. New York. KOIKE, K., SHIFIAKATA,Y., YAGINUMA, K., ARII, K., TAKADA, S., NAKAMURA, I., HAYASHI. Y., KAWADA, M., and KOBAYASHI,M. (1989). Oncogenic potential of hepatitis B virus. Mol. Biol. Med. 6, 151-l 60. KUET~, H. C., HERZ, J., and STANLEY, K. K. (1989). Structure of the low-density lipoprotein receptor-related protein (LRP) promoter. Biochim. Biophys. Acta 1009, 229-236. MAGUIRE, H. F., HOEFFLER,J. P.. and SIDDIQUI, A. (1991). HBV X protein alters the DNA binding specificity of CREB and ATF-2 by protein-protein interaction. Science 252, 842-844. MAHE. Y., MUKAIDA, N., KUNO, K., AKIYAMA, M., IKEDA, N., MATSUSHIMA, K., and MUFIAKAMI. S. (1991). Hepatitis B virus X protein transactivates human interleukin-8 gene through acting on nuclear factor kB and CCAAT/enhancer-binding protein-like cis-elements. 1. Biol. Chem. 266, 13759-l 3763. MITCHELL, P. J., and TJIAN, R. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245, 37 l-378. PARKER,B. A., and STARK, G. R. (1979). Regulation of similian virus 40 transcription: Sensitive analysis of the RNA species present early in infections by virus or viral RNA. J. Viral. 31, 360-365. PATEL, N. U.. JAMEEL, S., ISOM. H., and SIDDIQUI, A. (1989). Interac-
AND KOIKE tions between nuclear factors and hepatitis B virus enhancer. 1. Viral. 63, 5293-5301. PEI, D.. and SHIH, C. (1990). Transcriptional activation and repression by cellular DNA-binding protein C/EBP. 1. Viral. 64, 15171522. FTASHNE, M. (1988). How eukaryotic transcriptional activators work. Nature 335, 683-689. RITTER, S. E., WHITTEM, T. M., QUETS, A. T., and SCHLOEMER, R. H. (1991). An internal domain of the hepatitis B virus X antigen is necessary for transactivating activity. Virology 182, 841-845. SAITO, I., OVA, Y., and SHIMOJO, H. (1986). Novel RNAfamilystructure of hepatitis B virus expressed in human cells, using a helper-free adenovirus vector. J. Viral. 58, 554-560. SASSONE-CORSI,P., SISSON,J. C., and VERMA, I. M. (1988). Transcriptional autoregulation of the proto-oncogene fos. Nature 334, 314319. SETO. E., MITCHELL, P. J., and YEN, T. S. (1990). Transactivation by the hepatitis B virus X protein depends on AP-2 and other transcription factors. Nature 344, 72-74. SETO, E., YEN, T. S. B., PETERLIN,B. M., and Ou, J. (1988). Trans-activation of the human immunodeficiency virus long terminal repeat by the hepatitis B virus X protein. Proc. Nat/. Acad. Sci. USA 85, 8286-8290. SHIRAKATA,Y., KAWADA, M., FUJIKI,Y., SANO, H., ODA, M., YAGINUMA, K., KOBAYASHI,M., and KOIKE, K. (1989). The X gene of hepatitis B virus induced growth stimulation and tumorigenic transformation of mouse NIH3T3 cells. Jpn. J. Cancer Res. 80, 617-621. SIDDIQUI,A., GAYNOR, R., SRINIVASAN.A., MAPOLES,J., and FARR, R. W. (1989). Trans-activation of viral enhancers including long terminal repeat of the human immunodeficiency virus by the hepatitis B virus X protein. Virology 169, 479-484. SIDDIQUI, A., JAMEEL,S., and MAPOLES,J. (1987). Expression of hepatitis B virus X gene in mammalian cells. Proc. Nat/. Acad. Sci. USA 84, 2513-2517. SPANDAU, D. F., and LEE, C. (1988). Trans-activation of viral enhancers by the hepatitis B virus X protein. 1. Viral. 62, 427-434. TAKADA, S., and KOIKE, K. (1990). Trans-activation function of 3’truncated X gene-cell fusion product from integrated hepatitis B virus DNA in chronic hepatitis tissues. Proc. Nat/. Acad. Sci. USA 87, 5628-5632. TAKADA, S., and KOIKE,K. (1990). X protein of hepatitis B virus resembles a serine protease inhibitor. Jpn. J. Cancer Res. 81, 11911194. TREININ. M., and LAuB, 0. (1987). Identification of a promoterelement located upstream from the hepatitis B virus X gene. Mol. Cell. Biol. 7,545-548. TRUJILLO, M. A., LETOVSKY,J., MAGUIRE, H. F., LOPEZ-CABRERA,M., and SIDDIQUI, A. (1991). Proc. Nat/. Acad. Sci. USA 88, 37973801. Twu, J., and ROBINSON, W. S. (1989). Hepatitis B virus X gene can transactivate heterologous viral sequences. Proc. Nat/. Acad. Sci. USA 86,2046-2050. UNGAR, T., and SHAUL, Y. (1990). The X protein of the hepatitis B virus acts as a transcription factor when targeted to its responsive element. EMBO 1. 9, 1889-l 895. WEWER, U. M., LIOITA, L. A., JAYE. M., RICCA, G. A., DROHAN, W. N., CLAYSMITH, A. P., RAO, C. N., WIRTH, P., COLIGAN, 1. E.. ALBRECHTSEN. R., MUDRYL, M., and SOBEL, M. E. (1986). Altered levels of laminin receptor mRNA in various human carcinoma cells that have different abilities to bind laminin. Proc. Nat/. Acad. Sci. USA 83, 7137-7141. Wu. J. Y., ZHOU, Z.-Y., JUDD, A., CARWRIGHT, C. A., and ROBINSON, W. S. (1990). The hepatitis B virual encoded transcriptional transactivator hbx appears to be a novel protein serine threonine kinase. Cell 63, 687-695.
