115
v&s Researcfi, 19 (1991) 115-126 0 1991 Elsevier Science Publishers B.V. 016%1702/91/$03.50 ADONIS 016817029100076H VIRUS 00651
Identification and mapping of the UL56 gene transcript of herpes simplex virus type 1 Angela R&en-Wolff and Gholamreza Darai Imtitut ftir Medizinische
Virologie der Universitiit Heidelberg, Heidelberg, F. R.G.
(Accepted 17 December 1990)
Summary The herpes simplex virus type 1 (HSV-1) strain HFEM is apathogenic for tree shrews and mice by the intrape~tone~l application route. This is due to a 4.1 kbp deletion IO.762 to 0.789 map units (mu)] within the BarnHI DNA fragment B of the viral genome. With exception of 71 bp the DNA sequences of the deleted region are located within the repetitive DNA sequences of the inverted repeat of the L segment of the HSV-1 genome (IRL). A 1.5 kb RNA hybridizing to the DNA sequences of the HSV-1 genome at map position 0.760-0.762 (&sHII DNA fragment F, part of the BumHI DNA fragment B) was found to be missing in cells infected with HSV-1 HFEM and other apathogenic HSV-1 strains. A detailed analysis of the transcriptional profile of this region of the pathogenic prototype strain HSV-1 F and strand-specific hybridizations revealed that this 1.5 kb RNA species is transcribed at 2 to 4 h p.i. in leftward orientation. The corresponding open reading frame in the HSV-1 genome had been predicted as the UL56 gene. The absence of this 1.5 kb RNA in HSV-1 HFEM-infected cells is due to the fact that the promoter region of the UL56 gene is located within those DNA sequences which are deleted in the HSV-1 HFEM genome. A specific DNA fragment (650 bp) was amplified by reverse polymerase chain reaction using oIigonucleotide primers corresponding to the predicted translational start and te~nation region of the UL56 gene. The corresponding cDNA had been derived from cellular RNA from HSV-1 F-infected cells using oligo(dT) priming, This indicates that the 1.5 kb RNA is the real transcript of the UL56 gene of HSV-1.
CorresFond~ce to: C. Dar&, Institut fiir M~i~nische heimer Feld 324, 6900 Heidelberg, F.R.G.
Virologie der Universitlt
Heidelberg, Im Neuen-
116
Pathogenicity;
Latency;
RNA transcripts;
Northern
blot analysis
Herpes simplex virus type 1 (HSV-1) strain HFEM, whose genome harbours a deletion of 4.1 kbp [0.762-0.789 map units (mu)] (Rosen and Darai, 1985; Koch et al., 1987) has been shown to be apathogenic for tree shrews (Darai and Rosen, 1985; Rosen et al., 1985, 1986) and mice (Becker et al., 1986; Ben-Hur et al., 1988) by the intraperitoneal application route. The deleted region mapped within the DNA sequences of the BamHI DNA fragment B of the HSV-1 genome (0.738-0.809 mu; nucleotide positions (np) 1133222123464 of the HSV-1 genome [according to McGeoch et al., 1988)]. Furthermore, HSV-1 HFEM lost the ability to colonize the nervous system and to persist as latent virus in the ganglia of latently infected animals. However, it acquired a new phenotype which is reflected in the ability to persist as latent virus in the spleen cells of the infected animals. HSV-1 HFEM can be recovered from this tissue by the cocultivation technique (Rosen et al., 1985). The replacement of the deletion in the genome of HSV-1 HFEM with the corresponding DNA sequences of the pathogenic HSV-1 strain F by marker rescue experiments restored the virulent phenotype and the ability to colonize ganglia (Rosen and Darai, 1985; Rosen et al., 1985, 1986; Darai and Rosen, 1985). The analysis of the viral RNAs mapped within the DNA sequences of the BamHI DNA fragment B of the apathogenic HSV-1 strain HFEM and pathogenic HSV-1 strains revealed the presence of a 1.5 kb transcript in all pathogenic strains tested (Rosen-Wolff et al., 1988, 1989). This RNA species hybridizes to the DNA sequences at 0.760-0.762 mu of the HSV-1 genome (corresponding to np 116659116951 of the viral genome). As far as apathogenic HSV-1 strains are concerned it was found that the 1.5 kb RNA was either completely missing or significantly altered in size (Rosen-Wolff et al., 1988, 1989). The start and termination of the deletion in the genome of HSV-1 HFEM (Koch et al., 1987) correspond to the nucleotide positions 117088-120641 of the HSV-1 genome. It was shown that the main part of the deletion was localized within the DNA sequences of the inverted repeat of the L segment of the HSV-1 genome (IRL) sequences which start at the np 117158. An alteration at the 5’ end of the deletion and the neighbouring unique DNA sequences of the BamHI DNA fragment B can be considered as the reason for the apathogenicity of HSV-1 HFEM, since the genetic information located within the inverted repeat region should also be present in the TRL sequences located within the BamHI DNA fragment E. The identification and characterization of the transcripts originating from this genomic region is the subject of this report. This investigation is of particular importance since it focusses attention on the understanding of those molecular mechanisms which seem to be involved in the processes of the viral pathogenicity and latency.
117
Materials and Methods Viruses and cells HSV-1 F (Ejercito et al., 1968) and HSV-1 HFEM (Halliburton et al., 1980) which were used in this study were grown on monkey kidney cells (RC-37), mouse embryonic fibroblasts (MEF), tree shrew baby fibroblasts (TBF), and human embryonic lung cells (HEL) as described previously (Rosen et al., 1985). Preparation
of viral RNA
Total cellular RNA was isolated at different times after infection using the guanidinium/cesium chloride method (Glisin et al., 1974; Ullrich et al., 1977) as described by Maniatis et al. (1989). Northern
blot analyses
The Northern blot analyses of these RNAs were carried out using formaldehyde agarose gel (1%) electrophoresis (Lehrach et al., 1977) as described by Maniatis et al. (1989). The hybridization was carried out according to Southern (1975). The dsDNA probes for the hybridization were nick translated with ar3*P-dCTP and a32P-dATP (specific activity 6000 Ci/mmol; purchased by New England Nuclear) according to Rigby et al. (1977) as described previously (Rosen et al., 1986). For strand specific hybridizations a two step protocol was followed. In the first step the ssDNA of recombinant Ml3 phages were hybridized to the viral RNA and in the second step 32P-labeled ssDNA of Ml3 was hybridized to the RNA/DNA hybrids. Synthesis
of cDNA
Five pg of total cellular RNA from infected cells was incubated at 60 o C for 15 min and cDNA was synthesized by oligo(dT) priming in a buffer containing 50 pmol of oligo(dT),, primer, 1.25 mM of each dNTP, 0.3 mM spermidine, 2 mM NaPPi, 50 mM Tris-HCl, pH 8.3, 50 mM KCl, 10 mM MgCl,, 1 mM DTT, 1 mM EDTA, 10 pg/ml BSA, 20 units of RNasin (Promega, Madison, U.S.A.), and of 20 units of AMV reverse transcriptase (Promega, Madison, U.S.A.) for 30 min at 42” C. Polymerase
chain reaction (PCR)
The following synthetic oligonucleotide primers were used to amplify the HSV-1 F cDNA: primer 1 containing an EcoRI site (5’-GCGAATTCGTCGTGGCTTTGGGGCGCATCCATG-3’) corresponds to the translational start region of the UL56 gene and primer 2 containing a BamHI site (5’-CGGGATCCCTGTCGCCGGTATGGGGCATGATCA-3’) corresponds to the translational termination region of the UL56 gene. The exact position of the primers within the HSV-1 DNA
118
sequences is indicated in Fig. 3. First-strand cDNA/RNA hybrids were denatured at 96’C for 5 min and PCR was performed in 100 ~1 volumes of 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl,, 0.01% (w/v) gelatin, 200 PM of each dNTP, 1 PM of each primer, and 2.5 units of Taq DNA polymerase (Perkin-Elmer). Thirty cycles took place in an automated temperature cycling reactor (ERICOMP Inc., U.S.A.) which provided per cycle 20 s of each incubation at 95, 55, and 72°C.
Results Identification
and characterization
of the 1.5 kb RNA
In order to identify those HSV-1 genes which are involved in the molecular mechanisms of the viral pathogenicity a detailed transcriptional profile analysis of this part of the unique region of the genome of the pathogenic prototype strain HSV-1 F was carried out. The results of hybridization experiments in which 32P-labeled BssHII subfragments of the BamHI DNA fragment B were hybridized to the RNA of RC-37 cells
2
IE63 %tL .
1.5kbw
L
Fig. 1. Autoradiographic profile of Northern blot hybridization experiments for the analysis of the RNAs isolated from RC-37 cells infected with HSV-1 F. The RNA was separated electrophoretically at constant voltage 80 V for 16 h. The separated and purified DNA insert of recombinant plasmids which contain HSV-1 DNA sequences of the genome coordinates 0.738 to 0.771 were labeled with 32P in vitro and used as hybridization probe: lane 1, BamHI/BssHII DNA fragment F12, nucleotide position (np) 113322114508; lane 2, BssHII C/HpaI DNA fragment, np 114508-115764; lane 3, BssHII DNA fragment C, np 114508-116659; lane 4, BssHII DNA fragment F, np 1166599116951; lane 5, BssHII DNA fragment D, np 116951-118483). The position of the IE 63 mRNA (1.8 kb) is shown in lane 1 and the position of the 1.5 kb RNA transcript (UL56) is indicated with arrow heads in lanes 3, 4 and 5.
115272
1154%
116056 116329
116923
117088 @
BssHII C
I @+
BssHII F
&==Fig. 2. (A) schematic diagram of the HSV-1 genome. (B) physical map of the BnmHI DNA fragment B of HSV-1 (0.738-0.809 mu; np 113322-123464). Th e map presents the arrangement of the BssHfI and HpaI DNA fragments within the &u&II DNA fragment B of HSV-1 F (Koch et al., 1987). The abbreviations Fll and F12 indicate both BssHII terminal fragments of the BumHI DNA fragment B. The position of the deletion in the genome of HSV-1 HFEM is indicated with a box at the bottom of the map (R&en et al., 1985; Koch et al., 1987). The position of the beginning of IRL (according to McGeoch et al., 1988) is indicated by an arrow. (C) magnification of the unique region of the BumHI DNA fragment B. The positions of the predicted genes locahied within this region are indicated as boxes with different shapes together with the translational start and stop codons and their nucleotide positions witbin the HSV-1 genome (according to McGeoch et al., 1988). The orientations of these genes are indicated by fat arrows. Below the boxes the positions of the BssHII and HpaI recognition sites are indicated together with their nucleotide positions. The begitming of the deletion in the HSV-1 HFEM genome at np 117088 is indicated by an open box. At the bottom of this panel the DNA fragments which were used as hybridization probes are indicated as solid lines with the numbers that correspond to the lanes in Fig. 1.
infected with
HSV-1 F are shown in Fig. 1. The properties of the DNA fragments used as hybridization probes to identify those transcripts mapped within this genomic region are summarized in Fig. 2. The hybridization with the left terminus of the BarnHI DNA fragment B (~u~HI/~~~HII Fl2; 0.738-0.746 mu; HSV-1 np 113322-114508; Fig. 1, lane 1) shows a strong hybridization signal with a 1.8 kb RNA which corresponds to the IE
120
63 mRNA (UL54) (Clements et al., 1979; Watson et al., 1979; Mackem and Roizman, 1980). A weaker signal was detected at the position of 3.5 and 1.5 kb when the same hybridization probe was used. The transcripts hybridizing to the F12 DNA fragment (0.738-0.746 mu) are transcribed in rightward orientation from the upper DNA strand (data not shown). Therefore the 1.5 kb transcript could be identified as the RNA originating from the UL53 gene which overlaps the first 120 bp of the BumHI DNA fragment B up to the polyadenylation signal located at the nucleotide position 113442-113448 (AATAAA). The hybridization with the BssHII C/HpaI subfragment (0.746-0.755 mu; HSV-1 np 114508115764; Fig. 1, lane 2) led to the detection of a 1.8 kb RNA (IE 63 mRNA) which is transcribed in rightward orientation from the upper strand. These results are in agreement with the predictions based on the DNA sequence analysis (McGeoch et al., 1988) of the HSV-1 genome. However, an additional RNA of 1.5 kb can be detected when the whole &HI1 DNA fragment C (0.746-0.760 mu; HSV-1 np 114508-116659; Fig. l., lane 3) is used as hybridization probe. This RNA is transcribed in leftward orientation from the lower strand. This is in agreement with the identification of an open reading frame (ORF) UL56 at the position 116923-116329 which should be transcribed in leftward orientation. Using this probe another RNA of 1.8 kb (IE 63 mRNA, UL54) was detected, which has already been demonstrated by the BssHII C/H@1 subfragment (Fig. 1, lane 2). The neighbouring DNA sequences of the B.ssHII DNA fragment F located at the genome coordinates 0.760-0.762 (corresponding to the np 116659-116951; Fig. 2B), which had been used to identify the 1.5 kb transcript, hybridized only to an RNA of a size of 1.5 kb (transcribed in leftward o~~tation). The predicted UL56 gene (np 116923-116329) overlaps the Bs.sHII DNA fragment F (np 116659-116951) in full length. All these data taken together allow to identify the 1.5 kb RNA as the transcriptional activity corresponding to the UL56 gene of HSV-1. The hybridization experiment using the BssHLI DNA fragment D (0.762-0.771 mu; HSV-1 np 116951-118483) resulted in the observation of a weak hybridization signal at the position of 1.5 kb as expected from the DNA sequence data since the promoter region of the UL56 gene (np 117157-116923) is located within the DNA sequences of the &HI1 DNA fragment D. The two other RNA transcripts of 2.0 and 2.5 kb detected by this probe must be located within the IRL sequences since they can also be detected by the corresponding DNA sequences of the BamHI DNA fragment E (np 2907-11825). The transcription profile analyses described here revealed the presence of at least three different RNAs originating from the unique DNA sequences of the BumHI DNA fragment B. Two of these RNA species UL53 (1.5 kb) and UL54 (IE 63 mRNA, 1.8 kb) are transcribed in rightward orientation. The third RNA is transcribed in leftward orientation and can be considered as the transcript of the viral UL56 gene. The results presented here are in agreement with our previous data (Ben-Hur et al., 1989) regarding the mapping of at least 8 RNAs within the DNA sequences of the whole BumHI DNA fragment B. The analysis of the DNA sequences of HSV-1 HFEM revealed that the deletion starts at np 117088 and is terminated at np 120641 (Koch et al., 1987). The ORF of
121
AGTCCCATTCCCGAAGGCGTAGCCCGTTAACTTGGCTGGCTTGGATGGGGAGTAGGGGCC
start
+l TTTTCCATTACCCCAAGGACCTAGCGCGCGGGAGTCGTGGCTTTGGGGCGCATCCATGGC
(116923)
-K-A
TTCGGAGGCGGCGCAACCCGACGCGGGTTTATGGAGCGCGGGGAACGCGTTTGCTGATCC SEAAQPOAGLWSAGNAF
A
0
P
65 22
L
125 42
CCCGCCCCCCTACGATAGCTTGTCTGGTAGGAACGAGGGGCCGTTTGTCGTTATTGATCT P P P Y 0 S L S G R N E G P F V
V
IO
GGACACCCCCACGGACCCACCTCCACCGTACTCTGCTGGGCCCCTGTTGTCCGTGCCAAT 0 T P T 0 P P P P Y S A G P L L
S
V
P
162
TCCGCCAACCTCCTCCGGAGACGGCGAGGCGTCGGAGCGGGG~CGCTCACGCCAAGCCGC P P T S S G E G E A S E R G R S R
0
A
A
CCAGCGAGCCGCTCGGCGCGCCCGGCGCCGCCGCGCCGAACGACGTGCGCAGCGCCGGAGTTT (I R A A R R A R R R A E R R A (I R R
S
305 F102
TGGCCCTGGCGGGTTATTGGCAACCCCCCTGTTTCTTCCGGAAACCAGGCTTGTGGCCCC G P G G L L A T P L F L P E T R
185 245 82
L
V
A
365 P122
ACCCGACATCACAAGGGACCTCTTGTCGGGCCTCCCGACGTACGCCGAGGCTATGTCGGA P 0 IT R 0 L L S G L P T Y A E A
M
S
425 0142
CCACCCCCCAACCTATGCCACTGTCGTGGCCGTTCGTTCGTTCGACCGAA~AGC>C~GGGGC H P P T Y A T V V A V R S T E P P
S
G
465 Al62
R
545 V162
TTTGGCGCCCGACGACCAGCGACGAACGCAAAACTCGGGCGCGTGGCGGCCTCCTAGGGT L A P 0 0 0 R R T 0 N S G A W R P P 593 (116329) CAATTCGCGCGAGCTGTACAGGGCCCAACGCGCGGCGCGGCTCGTCTGATCATGCCCCAT NSRELYRAPRAARLV ACCGGCGACAGGGCTGTTGTGGCGTGGTGTGGCGCCaTGCTGlATTTGGGGTGGTCGCGA TTGTGGTGGTCATTATTCTGGTATTCCTGTGGCGGTAAGCGCCCCTGTGAGTTAATAAAT AAAAGTATCACGGTCCATACTGGCCTGTCGCGTTGTCTCGGAGGGCTTTGGGTCCACAAA CTCACACCACGCCGTGTTTGGTTGGGTTACGGCTCTTTATTTllTTGGGGGGGGTTACAC
(116079)
Fig. 3. DNA sequence of a part of the unique DNA sequencea of the BumHI DNA fragment B harbouring the UL56 gene (adapted from McGeoch et al., 1988). Although the UL56 gene is transcribed in leftward orientation, the DNA sequence is shown in rightward orientation (inverted and complementary to the original DNA sequence) to simplify the recognition of the transcriptional and translational signals. The TATA-box, the ATG start codon of UL56, the TGA stop codon of UL56, the polyadenylation signal AATAAA, and the GT-Cluster are underlined. The deduced amino acid sequence of the UL56 ORF is indicated below the corresponding DNA sequence in one-letter-code. The 5’ terminus of the DNA sequences deleted within the genome of HSV-1 HFEM are indicated by an open box at the top. The position of this re8ion within the HSV-1 genome is indicated by the nucleotide positions giveu in brackets. The positions of the oligonucieotide primers which were used to amplify the HSV-1 F cDNA by RCR are marked by solid lines above the DNA sequence.
the UL56 gene reaches from position 116922 (ATG) to 116330 (TGA) in leftward orientation (594 bp, coding for 197 amino acids, predicted molecular mass 21 kDa) and is not affected by the deletion in the HSV-1 HFEM genome (Fig. 3). However,
122
650bp
Fig. 4. Autoradiographic profile of Northern blot hybridization experiments of RNA transcripts isolated from RC-37 cells infected with the pathogenic HSV-1 strain F (lane 1) and the apathogenic strain HSV-1 Ml3 phages HFEM (lane 2). The hybridization was carried out using 32P labeled ssDNA of recombinant harbouring the BssHII DNA fragment F (0.760-0.762 mu; np 116659-116951) as described in Materials and Methods. Fig. 5. Amplification product of PCR using cDNA of HSV-1 F infected RC-37 cells with primers (5’GCGAATTCGTCGTGGCTTTGGGGCGCATCCATG-3’; primer 1) and (5’-CGGGATCCCTGTCGCCGGTATGGGGCATGATCA-3’; primer 2). Agarose slab gel electrophoresis, 1.0% agarose, 75 V at 4°C and for 20 h. Ethidium bromide staining and photographed under UV light. Lanes: molecular weight marker phage lambda digested with MIuI (lane 1); 650 bp PCR product (lane 2). The position of the PCR product is indicated with an arrow.
the UL56 gene transcript is missing in HSV-1 HFEM infected cells (Fig. 4). As shown in Fig. 3, the promoter of the UL56 gene with the TATA-box is located within the deleted DNA sequences in the genome of the apathogenic strain HSV-1 HFEM. The absence of the promoter of the UL56 gene is an adequate explanation for the absence of the 1.5 kb RNA in HSV-1 HFEM infected cells.
123
determination of the host ~~~c~ic~~ of the 1.5 kb RNA
The host specificity of the 1.5 kb RNA was investigated in various tissues from different hosts. Mouse and tree shrew fibroblasts, monkey kidney cells, and human embryonic lung cells were infected with HSV-1 F and analyzed under the same conditions as described above. The results of these experiments indicated that this RNA species was transcribed in all cell cultures infected with the pathogenic HSV-1 F. The 1.5 kb RNA was transcribed at 2-4 h p.i. Detection of the corresponding gene of the 1.5 kb RNA In order to ascertain if the 1.5 kb RNA is the real transcript of the UL56 gene a cDNA from cellular RNA from HSV-1 F-infected cells was established by oligo(dT) priming as described in Materials and Methods. This cDNA was used for amplification of the DNA sequences of the UL56 gene using synthetic oligonucleotides corresponding to the translational start and termination region of the UL56 gene. The first primer (5’~GCGAAlTCGTCGTGGC’MTGGGGCGCATCCATG-3’; primer 1, Fig. 3) is complements to the HSV-1 sequences between the nucleotide positions 116945 and 116925. The second primer (5 ‘-CGGGATCCCTGTCGCCGGTATGGGGCATGATCA-3’; primer 2, Fig. 3) is complementary to the HSV-1 np 116329-116305. As shown in Fig. 5 this analysis revealed that indeed a 650 bp DNA fragment could be amplified by using these primers.
Discussion
The involvement of the genetic information located between the genome coordinates 0.7 and 0.8 in the mechanisms of viral pathogenicity had also been documented by ~ntifant~Fi~gerald et al. (1982), Scholz et al. (1983), and Thompson et al. (1983), respectively. However, until now it has not been possible to identify exactly which gene functions are involved in the mechanisms that determine the viral pathogenicity and organotropism of the latent virus. In earlier studies it had been shown that at least eight RNA transcripts had been mapped within the BarnHI DNA fragment B (0.738-O-809 mu; np 113322-123464) (R&en-Wolff et al., 1988; Ben-Hur et al., 1989). Comparative analyses of pathogenic and apathogenic HSV-1 strains led to the discovery of a 1.5 kb RNA in all pathogenic strains tested. In contrast it was found that this RNA species was altered or missing in all apathogenic strains (Rosen-Wolff et al., 1988, 1989). Hybridization experiments revealed that this 1.5 kb RNA hybridized to the DNA sequences of the BamHI DNA fragment B at the map coordinates 0.760-0.762 mu (np 116659116951). Finally it had been shown that the absence of a transcript of 1.5 kb in all apathogenic strains is strong evidence that the activity of this gene could be responsible for the altered virulence and latency phenotype of HSV-1 (Rosen-Wolff et al., 1989).
124
The detailed hybridization experiments presented here revealed that this 1.5 kb RNA is transcribed in leftward orientation between the np 117158 (end of IRL) and 115764 (HpaI recognition site within BssHII DNA fragment C). Within this region of the HSV-1 genome the presence of a gene (UL56) had been predicted by McGeoch et al. (1989). In order to investigate whether the 1.5 kb RNA is the real transcript of the UL56 gene, cDNA of cellular RNA of HSV-1 F infected cells was synthesized by oligo(dT) priming. This cDNA could be amplified using oligonucleotide primers corresponding to the start and termination region of the UL56 gene. These results indicate that the UL56 gene transcript exists as a polyadenylated RNA and justify to declare the 1.5 kb RNA as the transcript of the UL56 gene. It could also be shown that the UL56 gene transcript is missing in HSV-1 HFEM-infected cells although the UL56 ORF is not affected by the deletion within the genome of the apathogenic HSV-1 HFEM. The absence of the UL56 gene transcript in HSV-1 HFEM infected cells is due to the fact that the UL56 promoter region including the TATA-box is located within the deleted genome region in HSV-1 HFEM. To ascertain the correlation between the transcription of the UL56 gene and the pathogenic phenotype of HSV-1 we succeeded in replacing the UL56 gene by the E. coli LacZ cassette which immediately destroyed the pathogenic phenotype of the selected HSV-1 recombinants in comparison to the parent pathogenic HSV-1 (Rosen-Wolff et al., manuscript in preparation). The study of the genomic region harboring the UL56 gene by DNA nucleotide analysis in various apathogenic HSV-1 strains (e.g. a variety of recombinant viruses) and the comparison to pathogenic strains will give explanations why the UL56 gene transcript is missing or altered in size in apathogenic strains. This analysis is in progress now and will be the subject of another report. At the present state of the investigation the possible role of the UL56 gene in the viral infection is still unknown. Therefore the characterization of the UL56 gene and its gene product is of special importance for the understanding of those molecular mechanisms which regulate the pathogenicity of HSV-1.
Acknowledgements This study was supported by the Deutsche Forschungsgemeinschaft, Schwerpunktprogramm “Persistierende Virusinfektionen: Molekulare Mechanismen und Pathogenese” (Projekt II B6 - Da 142/l-5).
References Becker, Y., Hadar, J., Tabor, E., Ben-Hur, T., Raibstein, I., R&en, A. and Darai, G. (1986) A sequence in HpaI-P fragment of herpes simplex virus-l DNA determines intraperitoneal virulence in mice. Virology 149, 225-259.
125 Ben-Hur, T., Rosen-Wolff, A., Lamade, W., Darai, G. and Becker, Y. (1988) HSV-1 HpaI P DNA sequence dete rmining intraperitoneal pathogenicity is required for transcription of viral immediate early genes in macrophages. Virology 163, 397-404. Ben-Hur,T., Moyal, M., Rosen-Wolff, A., Darai, G. and Becker, Y. (1989) Characterization of RNA transcripts from herpes simplex virus-l DNA fragment BumHI-B. Virology 169, l-11. Centifanto-Fitzgerald, Z.M., Yamaguchi, T., Kaufman, H.E., Togon, M. and Roiunan, B. (1982) 0cula1 disease pattern induced by herpes simplex virus is genetically determined by a specific region of viral DNA. J. Exp. Med. 155,475-489. Clements, J.B., McLauchlan, J. and McGeoch, D.J. (1979) Orientation of herpes simplex virus type 1 immediate early mRNAs. Nucleic Acids Res. 7, 77-91. Darai, G. and Rosen, A. (1985) Studies of virulence genes of herpes simplex virus (HSV-1). In: P.P. Pastoret (Ed.), Proceedings of CEC Seminar, Brussels, 1984: Immunity to Herpesvirus Infection of Domestic Animals, pp. 173-197. Martinus Nijhoff, The Hague. Ejercito, P.M., Kieff, E.D. and Roizman, B. (1968) Characterization of herpes simplex virus strains differing in their effects on social behaviour of infected cells. J. Gen. Virol. 2, 357-364. Glisin, V., Crkvenjakow, R. and Buys, C. (1974) Ribonucleic acid isolated by cesium chloride centrifugation. B&hem. 106, 492. Halliburton, I.W., Morse, L.S., Roizman, B. and Quinn, K.E. (1980) Mapping of the thymidine kinase genes of type 1 and 2 herpes simplex virus using intertypic recombinants. J. Gen. Virol. 49,235-253. Koch, H.G., Rosen, A., Ernst, F., Becker, Y. and Darai, G. (1987) Determination of the nucleotide sequence flanking the deletion (0.762-0.789 map units) in the genome of an intraperitoneally avirulent HSV-1 HFEM. Virus Res. 7, 105-115. Lehrach, H.D., Diamond, D., Wozney, J.M. and Boedtker, H. (1977) RNA molecular weight determination by gel electrophoresis under denaturing conditions, a critical reexamination. B&hem. 16, 4743-4751. Mackem, S. and Roizman, B. (1980) Regulation of herpesvirus macromolecule synthesis: transcriptioninitiation sites and domains of alpha genes. Proc. Natl. Acad. Sci. U.S.A. 77, 7122-7126. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. McGeoch, D.J., Dalrymple, M.A., Davison, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L.J., Scott, J.E., Taylor, P. (1988) The Complete DNA Sequence of the Long Unique Region in the Genome of Herpes Simplex Virus Type 1. J. Gen. Virol. 69, 1531-1574. Rigby, P.W.J., Die&man, M., Rhodes, C. and Berg, P. (1977) Labelling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 114, 237-256. Rosen, A., Gelderblom, H. and Darai, G. (1985) Transduction of virulence in herpes simplex virus type 1 from a pathogenic to an apathogenic strain by a cloned viral DNA fragment. Med. Microbial. Immunol. 173, 257-278. Rosen, A. and Darai, G. (1985) Mapping of the deletion in the genome of HSV-1 HFEM responsible for its avirulent phenotype. Med. Microbial. Immunol. 173, 329-343. Rosen, A., Ernst, F., Koch, H.G., Gelderblom, H., Darai, G., Hadar, J., Tabor, E., Ben-Hur, T. and Becker, Y. (1986) Replacement of the deletion in the genome (0.762-0.789 mu) of avirulent HSV-1 HFEM leads to generation of virulent intratypic recombinants. Virus Res. 5, 157-175. Rosen-Wolff, A., Ben-Hur, T., Becker, Y. and Darai, G. (1988) Comparative analysis of the transcripts mapped in the BamHI DNA fragment B of avirulent HSV-1 HFEM, virulent HSV-1 F and their intratypic recombinant viruses. Virus Res. 10, 315-324. Rosen-Wolff, A., Scholz, J. and Darai, G. (1989) Organotropism of latent herpes simplex virus is correlated to the presence of a 1.5 kb RNA transcript mapped within the BumHI DNA fragment B (0.738-0.809 map units). Virus Res. 12, 43-52. Scholx, J., Rosen, A. and Darai, G. (1983) Characterization of the genome of herpes simplex virus reisolates; generated and isolated after intertypic superinfection of HSV-1 and HSV-2 in viva. Zentralbl. Bakteriol. Mikrobiol. Hyg. I. Abt. Orig. A 254, 183. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517.
126 Thompson, R.L., Wagner, E.K. and Stevens, J.G. (1983) Physical location of a herpes simplex virus type 1 gene function(s) specially associated with a 10 million-fold increase in HSV neurovirulence. Virology 131, 180-192. Ullrich, A., Shine, J., Chirgwin, J., Pictet, R., T&her, E., Rutter, W.J. and Goodman, H.M. (1977) Rat insulin genes: construction of plasmids containing the coding sequences. Science 196, 1313. Watson, R.J., Preston, C.M. and Clements, J.B. (1979) Separation and characterization of herpes simplex virus type 1 immediate-early mRNAs. J. Viral. 31, 42-52. (Received
16 July 1990; revision
received
29 November
1990)
v&s Researcfi, 19 (1991) 115-126 0 1991 Elsevier Science Publishers B.V. 016%1702/91/$03.50 ADONIS 016817029100076H VIRUS 00651
Identification and mapping of the UL56 gene transcript of herpes simplex virus type 1 Angela R&en-Wolff and Gholamreza Darai Imtitut ftir Medizinische
Virologie der Universitiit Heidelberg, Heidelberg, F. R.G.
(Accepted 17 December 1990)
Summary The herpes simplex virus type 1 (HSV-1) strain HFEM is apathogenic for tree shrews and mice by the intrape~tone~l application route. This is due to a 4.1 kbp deletion IO.762 to 0.789 map units (mu)] within the BarnHI DNA fragment B of the viral genome. With exception of 71 bp the DNA sequences of the deleted region are located within the repetitive DNA sequences of the inverted repeat of the L segment of the HSV-1 genome (IRL). A 1.5 kb RNA hybridizing to the DNA sequences of the HSV-1 genome at map position 0.760-0.762 (&sHII DNA fragment F, part of the BumHI DNA fragment B) was found to be missing in cells infected with HSV-1 HFEM and other apathogenic HSV-1 strains. A detailed analysis of the transcriptional profile of this region of the pathogenic prototype strain HSV-1 F and strand-specific hybridizations revealed that this 1.5 kb RNA species is transcribed at 2 to 4 h p.i. in leftward orientation. The corresponding open reading frame in the HSV-1 genome had been predicted as the UL56 gene. The absence of this 1.5 kb RNA in HSV-1 HFEM-infected cells is due to the fact that the promoter region of the UL56 gene is located within those DNA sequences which are deleted in the HSV-1 HFEM genome. A specific DNA fragment (650 bp) was amplified by reverse polymerase chain reaction using oIigonucleotide primers corresponding to the predicted translational start and te~nation region of the UL56 gene. The corresponding cDNA had been derived from cellular RNA from HSV-1 F-infected cells using oligo(dT) priming, This indicates that the 1.5 kb RNA is the real transcript of the UL56 gene of HSV-1.
CorresFond~ce to: C. Dar&, Institut fiir M~i~nische heimer Feld 324, 6900 Heidelberg, F.R.G.
Virologie der Universitlt
Heidelberg, Im Neuen-
116
Pathogenicity;
Latency;
RNA transcripts;
Northern
blot analysis
Herpes simplex virus type 1 (HSV-1) strain HFEM, whose genome harbours a deletion of 4.1 kbp [0.762-0.789 map units (mu)] (Rosen and Darai, 1985; Koch et al., 1987) has been shown to be apathogenic for tree shrews (Darai and Rosen, 1985; Rosen et al., 1985, 1986) and mice (Becker et al., 1986; Ben-Hur et al., 1988) by the intraperitoneal application route. The deleted region mapped within the DNA sequences of the BamHI DNA fragment B of the HSV-1 genome (0.738-0.809 mu; nucleotide positions (np) 1133222123464 of the HSV-1 genome [according to McGeoch et al., 1988)]. Furthermore, HSV-1 HFEM lost the ability to colonize the nervous system and to persist as latent virus in the ganglia of latently infected animals. However, it acquired a new phenotype which is reflected in the ability to persist as latent virus in the spleen cells of the infected animals. HSV-1 HFEM can be recovered from this tissue by the cocultivation technique (Rosen et al., 1985). The replacement of the deletion in the genome of HSV-1 HFEM with the corresponding DNA sequences of the pathogenic HSV-1 strain F by marker rescue experiments restored the virulent phenotype and the ability to colonize ganglia (Rosen and Darai, 1985; Rosen et al., 1985, 1986; Darai and Rosen, 1985). The analysis of the viral RNAs mapped within the DNA sequences of the BamHI DNA fragment B of the apathogenic HSV-1 strain HFEM and pathogenic HSV-1 strains revealed the presence of a 1.5 kb transcript in all pathogenic strains tested (Rosen-Wolff et al., 1988, 1989). This RNA species hybridizes to the DNA sequences at 0.760-0.762 mu of the HSV-1 genome (corresponding to np 116659116951 of the viral genome). As far as apathogenic HSV-1 strains are concerned it was found that the 1.5 kb RNA was either completely missing or significantly altered in size (Rosen-Wolff et al., 1988, 1989). The start and termination of the deletion in the genome of HSV-1 HFEM (Koch et al., 1987) correspond to the nucleotide positions 117088-120641 of the HSV-1 genome. It was shown that the main part of the deletion was localized within the DNA sequences of the inverted repeat of the L segment of the HSV-1 genome (IRL) sequences which start at the np 117158. An alteration at the 5’ end of the deletion and the neighbouring unique DNA sequences of the BamHI DNA fragment B can be considered as the reason for the apathogenicity of HSV-1 HFEM, since the genetic information located within the inverted repeat region should also be present in the TRL sequences located within the BamHI DNA fragment E. The identification and characterization of the transcripts originating from this genomic region is the subject of this report. This investigation is of particular importance since it focusses attention on the understanding of those molecular mechanisms which seem to be involved in the processes of the viral pathogenicity and latency.
117
Materials and Methods Viruses and cells HSV-1 F (Ejercito et al., 1968) and HSV-1 HFEM (Halliburton et al., 1980) which were used in this study were grown on monkey kidney cells (RC-37), mouse embryonic fibroblasts (MEF), tree shrew baby fibroblasts (TBF), and human embryonic lung cells (HEL) as described previously (Rosen et al., 1985). Preparation
of viral RNA
Total cellular RNA was isolated at different times after infection using the guanidinium/cesium chloride method (Glisin et al., 1974; Ullrich et al., 1977) as described by Maniatis et al. (1989). Northern
blot analyses
The Northern blot analyses of these RNAs were carried out using formaldehyde agarose gel (1%) electrophoresis (Lehrach et al., 1977) as described by Maniatis et al. (1989). The hybridization was carried out according to Southern (1975). The dsDNA probes for the hybridization were nick translated with ar3*P-dCTP and a32P-dATP (specific activity 6000 Ci/mmol; purchased by New England Nuclear) according to Rigby et al. (1977) as described previously (Rosen et al., 1986). For strand specific hybridizations a two step protocol was followed. In the first step the ssDNA of recombinant Ml3 phages were hybridized to the viral RNA and in the second step 32P-labeled ssDNA of Ml3 was hybridized to the RNA/DNA hybrids. Synthesis
of cDNA
Five pg of total cellular RNA from infected cells was incubated at 60 o C for 15 min and cDNA was synthesized by oligo(dT) priming in a buffer containing 50 pmol of oligo(dT),, primer, 1.25 mM of each dNTP, 0.3 mM spermidine, 2 mM NaPPi, 50 mM Tris-HCl, pH 8.3, 50 mM KCl, 10 mM MgCl,, 1 mM DTT, 1 mM EDTA, 10 pg/ml BSA, 20 units of RNasin (Promega, Madison, U.S.A.), and of 20 units of AMV reverse transcriptase (Promega, Madison, U.S.A.) for 30 min at 42” C. Polymerase
chain reaction (PCR)
The following synthetic oligonucleotide primers were used to amplify the HSV-1 F cDNA: primer 1 containing an EcoRI site (5’-GCGAATTCGTCGTGGCTTTGGGGCGCATCCATG-3’) corresponds to the translational start region of the UL56 gene and primer 2 containing a BamHI site (5’-CGGGATCCCTGTCGCCGGTATGGGGCATGATCA-3’) corresponds to the translational termination region of the UL56 gene. The exact position of the primers within the HSV-1 DNA
118
sequences is indicated in Fig. 3. First-strand cDNA/RNA hybrids were denatured at 96’C for 5 min and PCR was performed in 100 ~1 volumes of 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl,, 0.01% (w/v) gelatin, 200 PM of each dNTP, 1 PM of each primer, and 2.5 units of Taq DNA polymerase (Perkin-Elmer). Thirty cycles took place in an automated temperature cycling reactor (ERICOMP Inc., U.S.A.) which provided per cycle 20 s of each incubation at 95, 55, and 72°C.
Results Identification
and characterization
of the 1.5 kb RNA
In order to identify those HSV-1 genes which are involved in the molecular mechanisms of the viral pathogenicity a detailed transcriptional profile analysis of this part of the unique region of the genome of the pathogenic prototype strain HSV-1 F was carried out. The results of hybridization experiments in which 32P-labeled BssHII subfragments of the BamHI DNA fragment B were hybridized to the RNA of RC-37 cells
2
IE63 %tL .
1.5kbw
L
Fig. 1. Autoradiographic profile of Northern blot hybridization experiments for the analysis of the RNAs isolated from RC-37 cells infected with HSV-1 F. The RNA was separated electrophoretically at constant voltage 80 V for 16 h. The separated and purified DNA insert of recombinant plasmids which contain HSV-1 DNA sequences of the genome coordinates 0.738 to 0.771 were labeled with 32P in vitro and used as hybridization probe: lane 1, BamHI/BssHII DNA fragment F12, nucleotide position (np) 113322114508; lane 2, BssHII C/HpaI DNA fragment, np 114508-115764; lane 3, BssHII DNA fragment C, np 114508-116659; lane 4, BssHII DNA fragment F, np 1166599116951; lane 5, BssHII DNA fragment D, np 116951-118483). The position of the IE 63 mRNA (1.8 kb) is shown in lane 1 and the position of the 1.5 kb RNA transcript (UL56) is indicated with arrow heads in lanes 3, 4 and 5.
115272
1154%
116056 116329
116923
117088 @
BssHII C
I @+
BssHII F
&==Fig. 2. (A) schematic diagram of the HSV-1 genome. (B) physical map of the BnmHI DNA fragment B of HSV-1 (0.738-0.809 mu; np 113322-123464). Th e map presents the arrangement of the BssHfI and HpaI DNA fragments within the &u&II DNA fragment B of HSV-1 F (Koch et al., 1987). The abbreviations Fll and F12 indicate both BssHII terminal fragments of the BumHI DNA fragment B. The position of the deletion in the genome of HSV-1 HFEM is indicated with a box at the bottom of the map (R&en et al., 1985; Koch et al., 1987). The position of the beginning of IRL (according to McGeoch et al., 1988) is indicated by an arrow. (C) magnification of the unique region of the BumHI DNA fragment B. The positions of the predicted genes locahied within this region are indicated as boxes with different shapes together with the translational start and stop codons and their nucleotide positions witbin the HSV-1 genome (according to McGeoch et al., 1988). The orientations of these genes are indicated by fat arrows. Below the boxes the positions of the BssHII and HpaI recognition sites are indicated together with their nucleotide positions. The begitming of the deletion in the HSV-1 HFEM genome at np 117088 is indicated by an open box. At the bottom of this panel the DNA fragments which were used as hybridization probes are indicated as solid lines with the numbers that correspond to the lanes in Fig. 1.
infected with
HSV-1 F are shown in Fig. 1. The properties of the DNA fragments used as hybridization probes to identify those transcripts mapped within this genomic region are summarized in Fig. 2. The hybridization with the left terminus of the BarnHI DNA fragment B (~u~HI/~~~HII Fl2; 0.738-0.746 mu; HSV-1 np 113322-114508; Fig. 1, lane 1) shows a strong hybridization signal with a 1.8 kb RNA which corresponds to the IE
120
63 mRNA (UL54) (Clements et al., 1979; Watson et al., 1979; Mackem and Roizman, 1980). A weaker signal was detected at the position of 3.5 and 1.5 kb when the same hybridization probe was used. The transcripts hybridizing to the F12 DNA fragment (0.738-0.746 mu) are transcribed in rightward orientation from the upper DNA strand (data not shown). Therefore the 1.5 kb transcript could be identified as the RNA originating from the UL53 gene which overlaps the first 120 bp of the BumHI DNA fragment B up to the polyadenylation signal located at the nucleotide position 113442-113448 (AATAAA). The hybridization with the BssHII C/HpaI subfragment (0.746-0.755 mu; HSV-1 np 114508115764; Fig. 1, lane 2) led to the detection of a 1.8 kb RNA (IE 63 mRNA) which is transcribed in rightward orientation from the upper strand. These results are in agreement with the predictions based on the DNA sequence analysis (McGeoch et al., 1988) of the HSV-1 genome. However, an additional RNA of 1.5 kb can be detected when the whole &HI1 DNA fragment C (0.746-0.760 mu; HSV-1 np 114508-116659; Fig. l., lane 3) is used as hybridization probe. This RNA is transcribed in leftward orientation from the lower strand. This is in agreement with the identification of an open reading frame (ORF) UL56 at the position 116923-116329 which should be transcribed in leftward orientation. Using this probe another RNA of 1.8 kb (IE 63 mRNA, UL54) was detected, which has already been demonstrated by the BssHII C/H@1 subfragment (Fig. 1, lane 2). The neighbouring DNA sequences of the B.ssHII DNA fragment F located at the genome coordinates 0.760-0.762 (corresponding to the np 116659-116951; Fig. 2B), which had been used to identify the 1.5 kb transcript, hybridized only to an RNA of a size of 1.5 kb (transcribed in leftward o~~tation). The predicted UL56 gene (np 116923-116329) overlaps the Bs.sHII DNA fragment F (np 116659-116951) in full length. All these data taken together allow to identify the 1.5 kb RNA as the transcriptional activity corresponding to the UL56 gene of HSV-1. The hybridization experiment using the BssHLI DNA fragment D (0.762-0.771 mu; HSV-1 np 116951-118483) resulted in the observation of a weak hybridization signal at the position of 1.5 kb as expected from the DNA sequence data since the promoter region of the UL56 gene (np 117157-116923) is located within the DNA sequences of the &HI1 DNA fragment D. The two other RNA transcripts of 2.0 and 2.5 kb detected by this probe must be located within the IRL sequences since they can also be detected by the corresponding DNA sequences of the BamHI DNA fragment E (np 2907-11825). The transcription profile analyses described here revealed the presence of at least three different RNAs originating from the unique DNA sequences of the BumHI DNA fragment B. Two of these RNA species UL53 (1.5 kb) and UL54 (IE 63 mRNA, 1.8 kb) are transcribed in rightward orientation. The third RNA is transcribed in leftward orientation and can be considered as the transcript of the viral UL56 gene. The results presented here are in agreement with our previous data (Ben-Hur et al., 1989) regarding the mapping of at least 8 RNAs within the DNA sequences of the whole BumHI DNA fragment B. The analysis of the DNA sequences of HSV-1 HFEM revealed that the deletion starts at np 117088 and is terminated at np 120641 (Koch et al., 1987). The ORF of
121
AGTCCCATTCCCGAAGGCGTAGCCCGTTAACTTGGCTGGCTTGGATGGGGAGTAGGGGCC
start
+l TTTTCCATTACCCCAAGGACCTAGCGCGCGGGAGTCGTGGCTTTGGGGCGCATCCATGGC
(116923)
-K-A
TTCGGAGGCGGCGCAACCCGACGCGGGTTTATGGAGCGCGGGGAACGCGTTTGCTGATCC SEAAQPOAGLWSAGNAF
A
0
P
65 22
L
125 42
CCCGCCCCCCTACGATAGCTTGTCTGGTAGGAACGAGGGGCCGTTTGTCGTTATTGATCT P P P Y 0 S L S G R N E G P F V
V
IO
GGACACCCCCACGGACCCACCTCCACCGTACTCTGCTGGGCCCCTGTTGTCCGTGCCAAT 0 T P T 0 P P P P Y S A G P L L
S
V
P
162
TCCGCCAACCTCCTCCGGAGACGGCGAGGCGTCGGAGCGGGG~CGCTCACGCCAAGCCGC P P T S S G E G E A S E R G R S R
0
A
A
CCAGCGAGCCGCTCGGCGCGCCCGGCGCCGCCGCGCCGAACGACGTGCGCAGCGCCGGAGTTT (I R A A R R A R R R A E R R A (I R R
S
305 F102
TGGCCCTGGCGGGTTATTGGCAACCCCCCTGTTTCTTCCGGAAACCAGGCTTGTGGCCCC G P G G L L A T P L F L P E T R
185 245 82
L
V
A
365 P122
ACCCGACATCACAAGGGACCTCTTGTCGGGCCTCCCGACGTACGCCGAGGCTATGTCGGA P 0 IT R 0 L L S G L P T Y A E A
M
S
425 0142
CCACCCCCCAACCTATGCCACTGTCGTGGCCGTTCGTTCGTTCGACCGAA~AGC>C~GGGGC H P P T Y A T V V A V R S T E P P
S
G
465 Al62
R
545 V162
TTTGGCGCCCGACGACCAGCGACGAACGCAAAACTCGGGCGCGTGGCGGCCTCCTAGGGT L A P 0 0 0 R R T 0 N S G A W R P P 593 (116329) CAATTCGCGCGAGCTGTACAGGGCCCAACGCGCGGCGCGGCTCGTCTGATCATGCCCCAT NSRELYRAPRAARLV ACCGGCGACAGGGCTGTTGTGGCGTGGTGTGGCGCCaTGCTGlATTTGGGGTGGTCGCGA TTGTGGTGGTCATTATTCTGGTATTCCTGTGGCGGTAAGCGCCCCTGTGAGTTAATAAAT AAAAGTATCACGGTCCATACTGGCCTGTCGCGTTGTCTCGGAGGGCTTTGGGTCCACAAA CTCACACCACGCCGTGTTTGGTTGGGTTACGGCTCTTTATTTllTTGGGGGGGGTTACAC
(116079)
Fig. 3. DNA sequence of a part of the unique DNA sequencea of the BumHI DNA fragment B harbouring the UL56 gene (adapted from McGeoch et al., 1988). Although the UL56 gene is transcribed in leftward orientation, the DNA sequence is shown in rightward orientation (inverted and complementary to the original DNA sequence) to simplify the recognition of the transcriptional and translational signals. The TATA-box, the ATG start codon of UL56, the TGA stop codon of UL56, the polyadenylation signal AATAAA, and the GT-Cluster are underlined. The deduced amino acid sequence of the UL56 ORF is indicated below the corresponding DNA sequence in one-letter-code. The 5’ terminus of the DNA sequences deleted within the genome of HSV-1 HFEM are indicated by an open box at the top. The position of this re8ion within the HSV-1 genome is indicated by the nucleotide positions giveu in brackets. The positions of the oligonucieotide primers which were used to amplify the HSV-1 F cDNA by RCR are marked by solid lines above the DNA sequence.
the UL56 gene reaches from position 116922 (ATG) to 116330 (TGA) in leftward orientation (594 bp, coding for 197 amino acids, predicted molecular mass 21 kDa) and is not affected by the deletion in the HSV-1 HFEM genome (Fig. 3). However,
122
650bp
Fig. 4. Autoradiographic profile of Northern blot hybridization experiments of RNA transcripts isolated from RC-37 cells infected with the pathogenic HSV-1 strain F (lane 1) and the apathogenic strain HSV-1 Ml3 phages HFEM (lane 2). The hybridization was carried out using 32P labeled ssDNA of recombinant harbouring the BssHII DNA fragment F (0.760-0.762 mu; np 116659-116951) as described in Materials and Methods. Fig. 5. Amplification product of PCR using cDNA of HSV-1 F infected RC-37 cells with primers (5’GCGAATTCGTCGTGGCTTTGGGGCGCATCCATG-3’; primer 1) and (5’-CGGGATCCCTGTCGCCGGTATGGGGCATGATCA-3’; primer 2). Agarose slab gel electrophoresis, 1.0% agarose, 75 V at 4°C and for 20 h. Ethidium bromide staining and photographed under UV light. Lanes: molecular weight marker phage lambda digested with MIuI (lane 1); 650 bp PCR product (lane 2). The position of the PCR product is indicated with an arrow.
the UL56 gene transcript is missing in HSV-1 HFEM infected cells (Fig. 4). As shown in Fig. 3, the promoter of the UL56 gene with the TATA-box is located within the deleted DNA sequences in the genome of the apathogenic strain HSV-1 HFEM. The absence of the promoter of the UL56 gene is an adequate explanation for the absence of the 1.5 kb RNA in HSV-1 HFEM infected cells.
123
determination of the host ~~~c~ic~~ of the 1.5 kb RNA
The host specificity of the 1.5 kb RNA was investigated in various tissues from different hosts. Mouse and tree shrew fibroblasts, monkey kidney cells, and human embryonic lung cells were infected with HSV-1 F and analyzed under the same conditions as described above. The results of these experiments indicated that this RNA species was transcribed in all cell cultures infected with the pathogenic HSV-1 F. The 1.5 kb RNA was transcribed at 2-4 h p.i. Detection of the corresponding gene of the 1.5 kb RNA In order to ascertain if the 1.5 kb RNA is the real transcript of the UL56 gene a cDNA from cellular RNA from HSV-1 F-infected cells was established by oligo(dT) priming as described in Materials and Methods. This cDNA was used for amplification of the DNA sequences of the UL56 gene using synthetic oligonucleotides corresponding to the translational start and termination region of the UL56 gene. The first primer (5’~GCGAAlTCGTCGTGGC’MTGGGGCGCATCCATG-3’; primer 1, Fig. 3) is complements to the HSV-1 sequences between the nucleotide positions 116945 and 116925. The second primer (5 ‘-CGGGATCCCTGTCGCCGGTATGGGGCATGATCA-3’; primer 2, Fig. 3) is complementary to the HSV-1 np 116329-116305. As shown in Fig. 5 this analysis revealed that indeed a 650 bp DNA fragment could be amplified by using these primers.
Discussion
The involvement of the genetic information located between the genome coordinates 0.7 and 0.8 in the mechanisms of viral pathogenicity had also been documented by ~ntifant~Fi~gerald et al. (1982), Scholz et al. (1983), and Thompson et al. (1983), respectively. However, until now it has not been possible to identify exactly which gene functions are involved in the mechanisms that determine the viral pathogenicity and organotropism of the latent virus. In earlier studies it had been shown that at least eight RNA transcripts had been mapped within the BarnHI DNA fragment B (0.738-O-809 mu; np 113322-123464) (R&en-Wolff et al., 1988; Ben-Hur et al., 1989). Comparative analyses of pathogenic and apathogenic HSV-1 strains led to the discovery of a 1.5 kb RNA in all pathogenic strains tested. In contrast it was found that this RNA species was altered or missing in all apathogenic strains (Rosen-Wolff et al., 1988, 1989). Hybridization experiments revealed that this 1.5 kb RNA hybridized to the DNA sequences of the BamHI DNA fragment B at the map coordinates 0.760-0.762 mu (np 116659116951). Finally it had been shown that the absence of a transcript of 1.5 kb in all apathogenic strains is strong evidence that the activity of this gene could be responsible for the altered virulence and latency phenotype of HSV-1 (Rosen-Wolff et al., 1989).
124
The detailed hybridization experiments presented here revealed that this 1.5 kb RNA is transcribed in leftward orientation between the np 117158 (end of IRL) and 115764 (HpaI recognition site within BssHII DNA fragment C). Within this region of the HSV-1 genome the presence of a gene (UL56) had been predicted by McGeoch et al. (1989). In order to investigate whether the 1.5 kb RNA is the real transcript of the UL56 gene, cDNA of cellular RNA of HSV-1 F infected cells was synthesized by oligo(dT) priming. This cDNA could be amplified using oligonucleotide primers corresponding to the start and termination region of the UL56 gene. These results indicate that the UL56 gene transcript exists as a polyadenylated RNA and justify to declare the 1.5 kb RNA as the transcript of the UL56 gene. It could also be shown that the UL56 gene transcript is missing in HSV-1 HFEM-infected cells although the UL56 ORF is not affected by the deletion within the genome of the apathogenic HSV-1 HFEM. The absence of the UL56 gene transcript in HSV-1 HFEM infected cells is due to the fact that the UL56 promoter region including the TATA-box is located within the deleted genome region in HSV-1 HFEM. To ascertain the correlation between the transcription of the UL56 gene and the pathogenic phenotype of HSV-1 we succeeded in replacing the UL56 gene by the E. coli LacZ cassette which immediately destroyed the pathogenic phenotype of the selected HSV-1 recombinants in comparison to the parent pathogenic HSV-1 (Rosen-Wolff et al., manuscript in preparation). The study of the genomic region harboring the UL56 gene by DNA nucleotide analysis in various apathogenic HSV-1 strains (e.g. a variety of recombinant viruses) and the comparison to pathogenic strains will give explanations why the UL56 gene transcript is missing or altered in size in apathogenic strains. This analysis is in progress now and will be the subject of another report. At the present state of the investigation the possible role of the UL56 gene in the viral infection is still unknown. Therefore the characterization of the UL56 gene and its gene product is of special importance for the understanding of those molecular mechanisms which regulate the pathogenicity of HSV-1.
Acknowledgements This study was supported by the Deutsche Forschungsgemeinschaft, Schwerpunktprogramm “Persistierende Virusinfektionen: Molekulare Mechanismen und Pathogenese” (Projekt II B6 - Da 142/l-5).
References Becker, Y., Hadar, J., Tabor, E., Ben-Hur, T., Raibstein, I., R&en, A. and Darai, G. (1986) A sequence in HpaI-P fragment of herpes simplex virus-l DNA determines intraperitoneal virulence in mice. Virology 149, 225-259.
125 Ben-Hur, T., Rosen-Wolff, A., Lamade, W., Darai, G. and Becker, Y. (1988) HSV-1 HpaI P DNA sequence dete rmining intraperitoneal pathogenicity is required for transcription of viral immediate early genes in macrophages. Virology 163, 397-404. Ben-Hur,T., Moyal, M., Rosen-Wolff, A., Darai, G. and Becker, Y. (1989) Characterization of RNA transcripts from herpes simplex virus-l DNA fragment BumHI-B. Virology 169, l-11. Centifanto-Fitzgerald, Z.M., Yamaguchi, T., Kaufman, H.E., Togon, M. and Roiunan, B. (1982) 0cula1 disease pattern induced by herpes simplex virus is genetically determined by a specific region of viral DNA. J. Exp. Med. 155,475-489. Clements, J.B., McLauchlan, J. and McGeoch, D.J. (1979) Orientation of herpes simplex virus type 1 immediate early mRNAs. Nucleic Acids Res. 7, 77-91. Darai, G. and Rosen, A. (1985) Studies of virulence genes of herpes simplex virus (HSV-1). In: P.P. Pastoret (Ed.), Proceedings of CEC Seminar, Brussels, 1984: Immunity to Herpesvirus Infection of Domestic Animals, pp. 173-197. Martinus Nijhoff, The Hague. Ejercito, P.M., Kieff, E.D. and Roizman, B. (1968) Characterization of herpes simplex virus strains differing in their effects on social behaviour of infected cells. J. Gen. Virol. 2, 357-364. Glisin, V., Crkvenjakow, R. and Buys, C. (1974) Ribonucleic acid isolated by cesium chloride centrifugation. B&hem. 106, 492. Halliburton, I.W., Morse, L.S., Roizman, B. and Quinn, K.E. (1980) Mapping of the thymidine kinase genes of type 1 and 2 herpes simplex virus using intertypic recombinants. J. Gen. Virol. 49,235-253. Koch, H.G., Rosen, A., Ernst, F., Becker, Y. and Darai, G. (1987) Determination of the nucleotide sequence flanking the deletion (0.762-0.789 map units) in the genome of an intraperitoneally avirulent HSV-1 HFEM. Virus Res. 7, 105-115. Lehrach, H.D., Diamond, D., Wozney, J.M. and Boedtker, H. (1977) RNA molecular weight determination by gel electrophoresis under denaturing conditions, a critical reexamination. B&hem. 16, 4743-4751. Mackem, S. and Roizman, B. (1980) Regulation of herpesvirus macromolecule synthesis: transcriptioninitiation sites and domains of alpha genes. Proc. Natl. Acad. Sci. U.S.A. 77, 7122-7126. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. McGeoch, D.J., Dalrymple, M.A., Davison, A.J., Dolan, A., Frame, M.C., McNab, D., Perry, L.J., Scott, J.E., Taylor, P. (1988) The Complete DNA Sequence of the Long Unique Region in the Genome of Herpes Simplex Virus Type 1. J. Gen. Virol. 69, 1531-1574. Rigby, P.W.J., Die&man, M., Rhodes, C. and Berg, P. (1977) Labelling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 114, 237-256. Rosen, A., Gelderblom, H. and Darai, G. (1985) Transduction of virulence in herpes simplex virus type 1 from a pathogenic to an apathogenic strain by a cloned viral DNA fragment. Med. Microbial. Immunol. 173, 257-278. Rosen, A. and Darai, G. (1985) Mapping of the deletion in the genome of HSV-1 HFEM responsible for its avirulent phenotype. Med. Microbial. Immunol. 173, 329-343. Rosen, A., Ernst, F., Koch, H.G., Gelderblom, H., Darai, G., Hadar, J., Tabor, E., Ben-Hur, T. and Becker, Y. (1986) Replacement of the deletion in the genome (0.762-0.789 mu) of avirulent HSV-1 HFEM leads to generation of virulent intratypic recombinants. Virus Res. 5, 157-175. Rosen-Wolff, A., Ben-Hur, T., Becker, Y. and Darai, G. (1988) Comparative analysis of the transcripts mapped in the BamHI DNA fragment B of avirulent HSV-1 HFEM, virulent HSV-1 F and their intratypic recombinant viruses. Virus Res. 10, 315-324. Rosen-Wolff, A., Scholz, J. and Darai, G. (1989) Organotropism of latent herpes simplex virus is correlated to the presence of a 1.5 kb RNA transcript mapped within the BumHI DNA fragment B (0.738-0.809 map units). Virus Res. 12, 43-52. Scholx, J., Rosen, A. and Darai, G. (1983) Characterization of the genome of herpes simplex virus reisolates; generated and isolated after intertypic superinfection of HSV-1 and HSV-2 in viva. Zentralbl. Bakteriol. Mikrobiol. Hyg. I. Abt. Orig. A 254, 183. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517.
126 Thompson, R.L., Wagner, E.K. and Stevens, J.G. (1983) Physical location of a herpes simplex virus type 1 gene function(s) specially associated with a 10 million-fold increase in HSV neurovirulence. Virology 131, 180-192. Ullrich, A., Shine, J., Chirgwin, J., Pictet, R., T&her, E., Rutter, W.J. and Goodman, H.M. (1977) Rat insulin genes: construction of plasmids containing the coding sequences. Science 196, 1313. Watson, R.J., Preston, C.M. and Clements, J.B. (1979) Separation and characterization of herpes simplex virus type 1 immediate-early mRNAs. J. Viral. 31, 42-52. (Received
16 July 1990; revision
received
29 November
1990)
