Journal of General Virology (2014), 95, 1094–1103

DOI 10.1099/vir.0.061085-0

Identification and genetic characterization of a novel picornavirus from chickens Susan Bullman,1 Karen Kearney,2 Michael O’Mahony,3 Lorraine Kelly,3 Paul Whyte,3 Seamus Fanning3 and John G. Morgan2 Correspondence

1

John G. Morgan

2

[email protected]

Department of Biological Sciences, Cork Institute of Technology, Cork, Ireland School of Microbiology, University College Cork, Cork, Ireland

3

Department of Veterinary Medicine, University College Dublin, Belfield, Dublin 4, Ireland

Received 25 October 2013 Accepted 1 February 2014

A novel picornavirus from commercial broiler chickens (Gallus gallus domesticus) has been identified and genetically characterized. The viral genome consists of a single-stranded, positivesense RNA genome of .9243 nt excluding the poly(A) tail and as such represents one of the largest picornavirus genomes reported to date. The virus genome is GC-rich with a G+C content of 54.5 %. The genomic organization is similar to other picornaviruses: 59 UTR–L–VP0–VP3– VP1–2A–2B–2C–3A–3B–3C–3D–39 UTR. The partially characterized 59 UTR of .373 nt appears to possess a type II internal ribosomal entry site (IRES), which is also found in members of the genera Aphthovirus and Cardiovirus. This IRES exhibits significant sequence similarity to turkey ‘gallivirus A’. The 39 UTR of 278 nt contains the conserved 48 nt ‘barbell-like’ structure identified in ‘passerivirus’, ‘gallivirus’, Avihepatovirus and some Kobuvirus genus members. A predicted large open reading frame (ORF) of 8592 nt encodes a potential polyprotein precursor of 2864 amino acids. In addition, the virus contains a predicted large L protein of 462 amino acids. Pairwise sequence comparisons, along with phylogenetic analysis revealed the highest percentage identity to ‘Passerivirus A’ (formerly called turdivirus 1), forming a monophyletic group across the P1, P2 and P3 regions, with ,40, ,40 and ,50 % amino acid identity respectively. Reduced identity was observed against ‘gallivirus A’ and members of the Kobuvirus genus. Quantitative PCR analysis estimated a range of 4¾105 to 5¾108 viral genome copies g-1 in 22 (73 %) of 30 PCR-positive faeces. Based on sequence and phylogenetic analysis, we propose that this virus is the first member of a potential novel genus within the family Picornaviridae. Further studies are required to investigate the pathogenic potential of this virus within the avian host.

INTRODUCTION Members of the family Picornaviridae are small, nonenveloped, icosahedral viruses with a positive-sense RNA genome. They comprise a large group of human and animal pathogens, including human poliovirus (family prototypic virus), hepatitis A virus and foot-and-mouth disease virus. At present, the family is composed of 17 genera and a number of proposed genera (http://www.picornaviridae.com). Generally, the genomic organization of picornaviruses is conserved. For example, the genes encoded by kobuviruses are as follows: L, VP0, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C and 3D. The size of the RNA genome of picornaviruses ranges from 7.2 to 9.1 kb and although some Picornaviridae The GenBank /EMBL/DDBJ accession number for the ‘sicinivirus 1’ genomic sequence determined in this study is KF741227. Five supplementary tables are available with the online version of this paper.

1094

members, including the genus Dicipivirus, encode more than one polyprotein (Woo et al., 2012), picornaviruses typically encode a single ORF flanked by a 59 and 39 untranslated region (UTR). Translation produces a single polyprotein that can be functionally divided into three regions: P1, P2 and P3. The P1 region encodes the capsid proteins and the P2 and P3 regions encode proteins involved in proteolytic processing and virus replication (Giachetti et al., 1992). A number of picornaviruses such as ‘Passerivirus A’ and kobuviruses encode a leader protein (L), flanking the P1 region (Lau et al., 2011; Reuter et al., 2010; Woo et al., 2010). Additionally, the VP0 protein of some picornaviruses is proteolytically cleaved to produce individual VP4 and VP2 proteins. In general, the L protein along with the 2A viral protease, show the greatest variation among picornavirus proteins (Lau et al., 2011). To date, only a small number of picornaviruses have been reported in bird species. Known avian picornaviruses 061085 G 2014 The Authors

Printed in Great Britain

Novel chicken picornavirus

include duck hepatitis A virus (DHAV-1, genus Avihepatovirus) (Kim et al., 2006), avian sapelovirus (Duck picornavirus TW90A, genus Sapelovirus) (Tseng & Tsai, 2007) and turkey hepatitis virus (Melegrivirus A, genus Megrivirus) (Honkavuori et al., 2011). Three viruses recently identified in tracheal and cloacal swabs of dead thrushes form two proposed new picornavirus genera, ‘Passerivirus’ containing ‘Passerivirus A’ and ‘Oscivirus’ containing ‘oscivirus A1’ and ‘oscivirus A2’ (formerly known as turdivirus 2 and 3) (Woo et al., 2010). Additionally, two pigeon picornaviruses, pigeon picornavirus A and B (Kofstad & Jonassen, 2011) and a quail picornavirus (Pankovics et al., 2012) have recently been identified. Furthermore, two candidate novel genera of picornaviruses, ‘gallivirus A’ and Turkey avisivirus (TuASV), were recently detected in healthy turkeys and commercial turkeys with enteric and/or stunting syndrome: strains turkey/M176/ 2011/HUN, and turkey/M176-TuASV/2011/HUN, respectively (Boros et al., 2012, 2013; Farkas et al., 2012). Viruses known to infect chickens include avian influenza and avian encephalomyelitis virus (AEV, genus Tremovirus; Marvil et al., 1999). Chicken anaemia virus (CAV, genus Gyrovirus of the Circoviridae) has been reported to promote immune suppression (Schat, 2009), as has infectious bursal disease virus (IBDV, genus Avibirnavirus, family Birnaviridae; Mahgoub et al., 2012). Furthermore, infectious bronchitis virus (IBV) is a coronavirus that causes a highly contagious respiratory and reproductive tract disease in chickens (Jackwood, 2012). Additionally, avian hepatitis E virus (genus Hepevirus) causes hepatitis by the faecal–oral route of transmission (Huang et al., 2004). Recently, the partial nucleotide sequences of chicken ‘galliviruses’ detected in the faeces of chickens have been reported (Farkas et al., 2012). This study reports the molecular identification and characterization of the genome of a novel chicken picornavirus. Initial screening studies of chicken faecal samples, using human norovirus RNA polymerase consensus primers, identified a PCR product with homology to members of the genus Kobuvirus. The genome of this picornavirus has subsequently been sequenced. Based on sequence and phylogenetic analysis we propose that this virus, termed ‘sicinivirus 1’ (sicini is the Gaelic word for chickens), is the first member of a potentially novel genus within the family Picornaviridae.

expected for norovirus-related viral species (predicted size 113 bp). Subsequently, the PCR fragment was sequenced and a translational reading frame of 30 amino acids was identified, exhibiting 67 % identity to the RNA polymerase protein (3D protein) of aichivirus B (bovine kobuvirus). An additional RT-PCR using a sense primer to this DNA sequence, along with an oligo(dt) primer, was successfully performed to amplify the 39 region of the virus. Subsequent sequencing established that the virus has a 39 UTR of 278 bp (excluding the poly(A) tail). A new investigation was then undertaken on 30 chicken cloacal samples obtained from approximately 8-week-old chickens slaughtered at a commercial chicken processing farm in Ireland. In total, 73 % of samples were positive by PCR using primers 23F/23R (39 region of the 3D gene of ‘sicinivirus 1’). Quantitative realtime PCR identified one sample (sample 23) with relatively high viral RNA numbers and this sample was used to generate cDNA that was sequenced using an Illumina MiSeq sequencing platform. The metagenomic sequencing data returned 13 contig sequences with a total length of 30 185 bp and an average GC content of approximately 55 %. BLASTP analysis revealed that 11 of the 13 contigs encoded components of viral RNA genomes and six of these contigs encoded regions of the ‘sicinivirus 1’ genome, which were further confirmed by genomic walking PCR. Genomic organization The genome of ‘sicinivirus 1’ is .9243 nt in size, excluding the poly(A) tail (Fig. 1). The virus genome is GC-rich with a G+C content of 54.5 %. The genomic organization is similar to other picornaviruses: 59 UTR–L–VP0–VP3– VP1–2A–2B–2C–3A–3B–3C–3D–39 UTR. A large ORF of 8592 nt is predicted to encode a potential polyprotein precursor of 2864 aa. The partially characterized 59 UTR contains .373 nt while the 39 UTR is 278 nt in length. The sequenced ‘sicinivirus 1’ genome is predicted to encode a large L protein followed by P1, P2 and P3 regions potentially encoding the capsid proteins VP0, VP3 and VP1, the 2A, 2B and 2C and the 3A, 3B, 3C and 3D proteins respectively (Fig. 1). Furthermore, putative protease cleavage sites of the polyprotein were mapped using the NetPicoRNA prediction program and alignment of the ‘sicinivirus 1’ amino acid sequence to ‘Passerivirus A’. Glutamine (Q) was located at the C-terminal of all 10 protease cleavage sites. Analysis of the 5§ UTR and 3§ UTR

RESULTS The identification of this novel picornavirus has its origins in a project designed to investigate the presence of noroviruslike viruses in domesticated farm animals (cattle, pigs, sheep and chicken faecal samples). Reverse transcriptase (RT)PCR performed using the broadly reactive norovirus specific Ni/E3 primers (Green et al., 1995) identified an approximate 240 bp fragment in 30 % (124 of 773 samples) of chicken samples. This PCR fragment was larger than http://vir.sgmjournals.org

The 59 UTR of ‘sicinivirus 1’ is incomplete as the domains A–I of the potential type II internal ribosomal entry site (IRES) are missing (Fig. 2). Sequence homology and Mfold RNA secondary structure analysis of the available 59 UTR sequence indicates the virus contains domains J, K and L of a type II IRES, with strong sequence and structure homology to that of ‘gallivirus A’ (Boros et al., 2012). The J domain of ‘sicinivirus 1’ shares 67 % nucleotide sequence homology with ‘gallivirus A’ (Boros et al., 2012). The 1095

S. Bullman and others

nt 0

1000

2000

3000

4000

5000

P1 Q/T UTR >373 nt

Q/G

6000

7000

8000

P2

Q/G

Q/S

Q/A

9000

10 000

P3

Q/G

Q/G

Q/A Q/I

Q/S UTR

L 1386 462

5′

[374–1759]

VP0 1020 340

VP3 624 208

VP1 945 315

2A 483 161

2B 588 196

2C 1020 340

3A 450 150

3B 57 19

3C 525 175

3D 1416 472

278 nt A (n) 3′

[2780–3403] [4349–4831] [5420–6439] [6947–7024] [7550–8965] [1760–2779] [3404–4348] [4832–5419] [6440–6946] [7025–7549]

Fig. 1. Predicted genome organization of ‘sicinivirus 1’. The P1 region represents the structural proteins VP0, VP3 and VP1 and contains 847 aa (2541 nt). The P2 region represents the 2A, 2B and 2C proteins and contains 697 aa (2091 nt). The P3 region represents the proteins 3A, 3B, 3C and 3D and contains 842 aa (2526 nt). The protein name along with nucleotide (upper numbers) and amino acid (lower numbers) lengths are indicated within each gene box. The genomic region is indicated below each gene box within the square brackets. The predicted protein cleavage sites are indicated above each gene junction (one letter amino acid code). A partial 59 UTR region of 373 nt and a 39 UTR region of .278 nt are presented at the corresponding ends of the gene box.

216

L

1

41

153

268 374

Pyrimidine-rich region

K

85

J

Fig. 2. Predicted RNA secondary structure of the ‘sicinivirus 1’ IRES. The partial structure of the 59 UTR is missing regions A–I but includes domains J, K and L (labelled), in addition to a pyrimidine-rich region located between domains K and L. These domains correspond to a type II IRES structure and share conserved nucleotide sequences to other picornaviruses such as the turkey ‘gallivirus A’ (NC_018400) and turkey TuASV (KC465954) (Boros et al., 2012, 2013). Labels indicate specific nucleotides. 1096

Journal of General Virology 95

Novel chicken picornavirus

structure of the stem–loop is almost identical to that of ‘gallivirus A’ with the K domain protruding at a 90 uC angle from the right side of the J domain stem. In addition, two tetraloop GNRA motifs are present in ‘sicinivirus 1’ domains J–L. A 19 nt (position 153–171) pyrimidine-rich tract p(Y) is present between domains J/K and L. This p(Y) tract is very similar in structural location to that of ‘gallivirus A’ (Boros et al., 2012). The 59 UTR of type I and type II IRESs usually contain a conserved 39 terminal sequence Yn– Xm–ATG motif, where the Yn defines the size of a pyrimidine tract (n; 8 to 10 nt) and Xm is the distance it is spaced from the AUG; ‘sicinivirus 1’ has a potential Yn–Xm–ATG motif of Y7–X45–ATG.

The 39 UTR of ‘sicinivirus 1’ exhibits homology to kobuviruses and other chicken and turkey picornaviruses (Fig. 3). This region has a number of secondary RNA stem– loop structures including a 48 nt ‘barbell-like’ structure identified in ‘Passerivirus A’, ‘gallivirus’, avihepatovirus and some Kobuvirus genus members (Boros et al., 2012). The strongest sequence homology between these viruses is observed in the lower loop of the barbell, two regions of 15 nt and 10 nt identity respectively (Fig. 3). The upper loop of the barbell contains a shorter p(Y) region to that found in kobuviruses and ‘gallivirus A’ (Boros et al., 2012). The location of this barbell structure in ‘sicinivirus 1’ is towards the 39 end of the 39 UTR in contrast to

Poly(Y) tract 204

225

185

‘Sicinivirus’ SCV-1 ‘Passerivirus’ TV-1 Kobuvirus AICHI Kobuvirus CaKV ‘Gallivirus’ M176 ‘Gallivirus’ TRK91 ‘Gallivirus’ CHK175

*

********* **

233

*

*

*

****** *

Fig. 3. Conserved motif analysis of the 39 UTR of ‘sicinivirus 1’. Nucleotide alignment of the 39 UTR of several picornaviruses (CLUSTAL W). The grey boxes identify the regions which are conserved; an asterisk is located below sequences that are completely conserved across the seven virus strains analysed. The arrows demonstrate that the nucleotides which form this ‘barbell-like’ structure in ‘sicinivirus 1’ are highly conserved across picornaviruses (Boros et al., 2012). The presence of a poly(Y) tract, which is characteristic of this structure, is noted. The numbers correspond to the nucleotides within the 39 UTR of the following viruses; SCN-1 (‘sicinivirus 1’), TV-1 (‘Passerivirus A’; NC_014411), AICHI (aichivirus A, aichi virus 1; GQ927711), CaKV (canine kobuvirus 1; JN088541), MI76 (‘gallivirus A’; JQ691613), TRK91 (turkey/TRK91/USA/2010; JF424830) and CHK175 (CHK175/USA/2010; JF424827). http://vir.sgmjournals.org

1097

S. Bullman and others

‘Passerivirus A’ and aichivirus A where it is located at the 59 end of the 39 UTR. Analysis of coding regions The first in-frame AUG codon is located at nucleotide 374 and it contains the optimal Kozak consensus sequence (AxxA374UGG). Translation from the first in-frame AUG predicts a 462 amino acid L protein in ‘sicinivirus 1’. This predicted L protein does not show homology to any other picornavirus L protein and it does not appear to possess protease activity (Gorbalenya et al., 1991). The predicted capsid proteins are in the following order as predicted by NetPicoRNA and alignment with members of the genera Kobuvirus and ‘Passerivirus’: VP0, VP3, VP1. There is no evidence of proteolytic cleavage of the putative VP0 to VP4 and VP2 proteins. A number of conserved picornavirus motifs are present in the predicted proteins of ‘sicinivirus 1’. The myristylation site GSISST is present in the VP0 protein. The predicted 2A protein contains a motif TWAL and NT analogous to the observed HWAL and NC motifs in ‘Passerivirus A’. Furthermore, the potential 2C protein contains two conserved motifs, the NTPase motif (GXXGXGKS) as GPPGCGKS and the helicase motif (DDLXQ) as DDVGQ. The catalytic triad (H-D/E-C) is present in the putative 3C protein as H-D-C, the RNA binding domain (KFRDI) as QFKDL and the GXCG motif as GLCG. The predicted 3D protein contains the conserved motifs KDE[LI]R as KDELR, GG[LMN]PSG as GGNPSG, YGDD as YGDD and FLKR as FLKR.

regions reveals that ‘sicinivirus 1’ and ‘Passerivirus A’ consistently form monophyletic groups. Although phylogenetic analysis reveals that ‘gallivirus A’ forms a sister clade with this group, in terms of amino acid identity shared with ‘sicinvirus 1’, it is surpassed by aichivirus C. Additionally, in relation to ‘sicinivirus 1’, ‘Passerivirus A’ has the least number of amino acid substitutions per site across the P1, 2C and 3CD regions (Tables S2, S3 and S4, available in the online Supplementary Material). The maximum amino acid identity of the ‘sicinivirus 1’ 2A and 2B proteins against other picornavirus members is 30 %, in both cases with ‘Passerivirus A’, while the predicted L protein shows no significant homology to any other L protein. Analyses of codon usage for amino acids that use either NNC or NNT indicate a slight preference for the codon NNC (0.54) in the genome of ‘sicinivirus 1’ (Table S5). ‘Passerivirus A’ and ‘oscivirus A1’ are 0.71 and 0.33 respectively. This tends to be reflected in their GC content with ‘sicinivirus 1’ at 54.5 % and ‘Passerivirus A’ at 58 %. ‘Oscivirus A1’ has a lower GC content of 47 %, possibly reflecting cytosine deamination. Viral load Quantitative PCR analysis was applied to quantify the levels of ‘sicinivirus 1’ genome in chicken faecal samples. In the 73 % (22 out of 30) positive samples, viral genome copies ranged from 3.96105 to 5.26108 per gram of cloacal content.

Comparative genomic and phylogenetic analysis and phylogenetic analysis of the predicted polyprotein of ‘sicinivirus 1’ establishes that it exhibits the greatest identity to ‘Passerivirus A’ (Table 1 and Fig. 4a, b, c). ‘sicinivirus 1’ shares an overall amino acid identity of 40.9 % (P1, P2 and P3 regions) to ‘Passerivirus A’. Furthermore, phylogenetic analysis of the P1, 2C and 3CD

BLAST

DISCUSSION In this study we report the identification of a novel picornavirus from chicken faeces. The use of norovirus consensus primers in an attempt to identify norovirus-like viruses in farm animals lead to the serendipitous detection

Table 1. Comparison of genomic features of ‘sicinivirus 1’ and nine species of picornaviruses Picornavirus

Genome features

Genus

Species

GenBank accession no

‘Passerivirus’ Kobuvirus ‘Gallivirus’ Kobuvirus Kobuvirus Salivirus ‘Oscivirus’ ‘Oscivirus’ Aphthovirus

‘Passerivirus A’ (turdivirus 1) Aichivirus C (porcine kobuvirus) Turkey ‘gallivirus A’ Canine kobuvirus 1 Aichivirus B (bovine kobuvirus) Salivirus A ‘Oscivirus A1’ (turdivirus 2) ‘Oscivirus A2’ (turdivirus 3) Foot-and-mouth disease virus O

NC_014411 NC_011829 NC_018400 JN088541 NC_004421 GQ179640 NC_014412 NC_014413 NC_004004

Size (nt) G+C (%) 8025 8210 8496 8289 8374 7982 7641 7678 8134

58.00 52.40 48.30 58.20 54.60 56.70 46.92 46.60 55.30

Pairwise amino acid identity (%) P1

P2

P3

Whole genome (P1, P2, P3)*

30.5 24.9 17.7 26.5 24.9 22.9 21.9 20.3 11.8

38.1 33.1 31.6 34.5 32.1 31.6 23.2 23.9 18.3

46.8 39.9 45.6 41.4 40.6 38.1 35.7 35.2 21.4

40.9 35.7 35.5 35.3 33.9 31.7 28.7 27 20.4

*Percentages are reflective of the amino acid identity against the entire corresponding sequence of ‘sicinivirus 1’. 1098

Journal of General Virology 95

Novel chicken picornavirus

of a PCR fragment which when sequenced demonstrated homology to aichivirus B. Others have employed consensus primers as an initial screening tool to identify novel viruses. For example, conserved primers to the 3Dpol gene of picornaviruses identified three new picornaviruses: ‘Passerivirus A’, ‘oscivirus A1’ and ‘oscivirus A2’ (Woo et al., 2010), and novel ‘galliviruses’ in chicken and turkey faecal swabs (Farkas et al., 2012). A virus enrichment and metagenomic approach was applied to identify the genome of ‘sicinivirus 1’. A number of sample preparation steps greatly enhanced the enrichment of virus-specific RNA. The treatment of the faecal extract with nucleases, while the virus RNA remained protected within viral particles, greatly decreased subsequent contamination of the RNA preparation with enteric bacterial and chicken nucleic acid. The subsequent enrichment of polyadenylated RNA by oligo(dT) capture along with the use of sequence-independent priming and specific reverse priming from the 3D region of ‘sicinivirus 1’, resulted in a very significant enrichment of RNA virus genomes. This enrichment is reflected in the metagenomic sequencing data which returned 13 contig sequences, 11 of which were from viruses with polyadenylated RNA genomes and six of these contigs encoded regions of the ‘sicinivirus 1’ genome. Phylogenetic analysis across the P1, 2C and 3CD regions of ‘sicinivirus 1’ indicates that it forms a monophyletic group with the recently identified ‘Passerivirus A’. However, the amino acid identities of the P1, P2 and P3 regions of these two viruses are below the 40 %, 40 % and 50 % thresholds respectively, which is required for members of the same genus. Furthermore, the L, 2A, 2B and 3A proteins of ‘sicinivirus 1’ share low percentage identity with other picornaviruses. Given that the closest picornavirus currently within the NCBI database, ‘Passerivirus A’, is below the amino acid threshold for genus continuation, we propose that ‘sicinivirus 1’ is the first member of a potentially novel picornavirus genus, suggestively ‘Sicinivirus’. According to the ICTV’s (International Committee of Taxonomy of Viruses) definition of a picornavirus genus (http://www. picornastudygroup.com/definitions/genus_definition.htm), members of a genus should normally share phylogenetically related P1, P2 and P3 genomic regions, with .40 %, .40 % and .50 % amino acid identity, respectively. The predicted P1, P2 and P3 genomic regions of ‘sicinivirus 1’ share, 30.5 %, 38.1 % and 46.8 % amino acid identity, respectively, to its closest relative ‘Passerivirus A’, with an overall identity of 40.9 % (Table 1). Interestingly, ‘gallivirus A’ forms a sister clade with both ‘sicinivirus 1’ and ‘Passerivirus A’. It is likely that these viruses may have shared a common ancestor. The partial 59 UTR of ‘sicinivirus 1’ is missing regions A–I but contains domains J, K and L of a type II IRES; regions H–L constitute a complete type II IRES. Five structurally distinct classes of IRES have been reported in picornaviruses. Type II IRESs contain five main domains (H, I, J, http://vir.sgmjournals.org

K and L) and have been reported in aphthovirus, parechovirus, cardiovirus, erbovirus, cosavirus, ‘gallivirus’ and ‘hunnivirus’ (Reuter et al., 2012; Sweeney et al., 2012). They are typically 400–500 nt in size and possess a 39 end Yn–Xm–AUG motif which can act as the initiator codon. The ‘sicinivirus 1’ IRES shares a strong structural resemblance to ‘gallivirus A’. A fifth class of picornavirus IRES, an Aichi-like IRES, is present in members of the Kobuvirus, Salivirus and ‘Oscivirus’ genera (Sweeney et al., 2012). Interestingly, the ‘Passerivirus A’ 59 UTR remains to be characterized (Sweeney et al., 2012). L proteins are the most diverse among picornavirus proteins, sharing little sequence homology, as observed with the ‘sicinivirus 1’ L protein. The size of L proteins can vary from 70 amino acids in cardiovirus, to 450 amino acids for avian sapelovirus. ‘Sicinivirus 1’ is predicted to encode a very large L protein of 462 amino acids, similar in size to the 451 amino acid L protein of avian sapelovirus (Tseng & Tsai, 2007). At the time of slaughter, no grading scheme was employed to assess the health status of the chickens that were included in this study. However, ‘sicinivirus 1’ RNA genome concentrations of 3.96105 to 5.26108 were observed per gram of cloacal faeces, indicating that significant ‘sicinivirus 1’ replication is likely to be taking place in the cloacae of these chickens by 8 weeks of age. The question as to how virus shedding may relate to disease, severity of symptoms and clinical presentation, remains to be established. Also, semiquantitative PCR indicated that 9 of 30 cloacae were jointly positive for ‘sicinivirus 1’ and chicken ‘gallivirus’ (CHK1) and 93 % (27/30) were positive for Campylobacter jejuni (data not show). The two recently identified turkey picornaviruses, ‘gallivirus A’ and TuASV, were detected in both healthy and diseased turkeys (Boros et al., 2012, 2013). ‘Gallivirus A’ was detected in 88 % of farms where flocks exhibited symptoms of enteritis and/or stunting syndrome. Interestingly, co-infection with ‘gallivirus A’ and TuASV was detected in 63 % of specimens and 75 % of farms examined (Boros et al., 2012). Other disease-associated viruses, such as turkey rotavirus and astrovirus, have been reported in both healthy and diseased poultry (PantinJackwood et al., 2007). Moreover, chickens are noted as the main reservoir for human C. jejuni infection (Rosenquist et al., 2006), one of the most common bacterial causes of gastroenteritis in the developed world (Moore et al., 2005). The possibility that multiple viruses and bacteria could in combination contribute to symptoms and disease in the animal host has been proposed (Smith et al., 2013). Such investigations would require controlled infection studies along with detailed pathological and immunological analysis. In summary, we report the molecular identification of a novel picornavirus in chickens. Further studies will establish its distribution in chicken flocks and its potential role as an avian pathogen. 1099

S. Bullman and others

(a)

Aichivirus B (NC_004421)

100

Aichivirus C (NC_011829)

100

Aichivirus A (NC_001918)

100

100

Aichivirus A (JN088541)

95

Salivirus NG-J1 (GQ179640) ‘Gallivirus A’ (NC_018400) ‘Sicinivirus 1’ (KF741227)

84

‘Passerivirus A’ (NC_014411)

87

‘Oscivirus A1’ (NC_014412) 100

‘Oscivirus A2’ (NC_014413) Hepatitis A virus (ABN59386.1) Foot-and-mouth disease virus type O (NC_004004)

93

Human rhinovirus B14 (NP_041009)

68

82

Human poliovirus 1 (AY184219) 100

Enterovirus A (NP_042242) 99

(b)

Enterovirus J (YP_003358790)

98 100

Aichivirus B (NP_859024) Aichivirus C (YP_002473943)

51

Aichivirus A (NP_740440)

52

Salivirus NG-J1 (YP_003038640) ‘Sicinivirus 1’ (KF741227)

93

‘Passerivirus A’ (YP_003853294) 50

‘Gallivirus A’ (YP_006576515) ‘Oscivirus A2’ (YP_003853316) 100

‘Oscivirus A1’ (YP_003853305) Foot-and-mouth disease virus type O (NP_740463) Human rhinovirus B4 (ABF51184.1)

98

Human poliovirus 1 (ACS88257)

100

Enterovirus A (NP_740532)

83 91

Enterovirus J (YP_003359172) Hepatitis virus A (ACD74580)

(c)

95

‘Sicinivirus 1’ (KF741227) ‘Passerivirus A’ (YP_003853297)

100

‘Gallivirus A’ (YP_006576515) 64

100

Chicken ‘gallivirus’ CHK1 (AEA03667) Salivirus NG-J1 (YP_003038643)

100

Aichivirus A (NP_740443)

54

Aichivirus B (NP_859027)

100 100 53

Aichivirus C (YP_002473940) ‘Oscivirus A2’ (YP_003853316)

100

‘Oscivirus A1’ (YP_003853305) Foot-and-mouth disease virus type O (NP_740466) Human rhinovirus B14 (NP_740524) Enterovirus A (NP_740535)

100

Enterovirus J (YP_001718585)

99 99

Human poliovirus 1 (ACS88257) Hepatitis virus A (ACD74580)

1100

Journal of General Virology 95

Novel chicken picornavirus

Fig. 4. Phylogenetic analysis of the ‘sicinivirus 1’ coding regions P1, 2C and 3CD. Phylogenetic trees were reconstructed based on amino acid similarity data of P1, 2C and 3CD regions from ‘sicinivirus 1’ and various members of the family Pircornaviridae. Evolutionary history was inferred by using the maximum-likelihood method based on the JTT matrix-based model (Jones et al., 1992). The bootstrap consensus tree inferred from 1000 replicates (Felsenstein, 1985) is taken to represent the evolutionary history of the taxa analysed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50 % bootstrap replicates are collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches (Felsenstein, 1985). Initial trees for the heuristic search were obtained automatically by applying neighbour-join and BioNJ algorithms to a matrix of pairwise distances estimated using a JTT model, and then selecting the topology with superior log-likelihood value. Evolutionary analyses were conducted in MEGA5 (Tamura et al., 2011). (a) Phylogenetic analysis of the ‘sicinivirus 1’ P1 region, involving 16 amino acid sequences. There were 582 positions in the final dataset. (b) Phylogenetic analysis of the ‘sicinivirus 1’ 2C region, involving 15 amino acid sequences. There were 281 positions in the final dataset. (c) Phylogenetic analysis of the ‘sicinivirus 1’ 3CD region, involving 16 amino acid sequences. There were 592 positions in the final dataset.

METHODS Virus nucleic acid isolation and enrichment. Faeces were

recovered from the cloacal content of broiler chickens immediately after normal commercial slaughter. A faecal stool sample (20 % in PBS) was rigorously mixed and allowed to settle at room temperature for 1 h, 2 ml was removed and clarified at 5000 g for 10 min. The supernatant was removed and filtered through a 0.45 mm filter (Millipore). A total of 95 ml of this sample was added to 14 ml of 106 Turbo DNase buffer with the addition of 14 units of TURBO DNase (Ambion), 20 MBU Baseline-ZERO DNase (Epicentre), 20 units RNase A (Fermentas) and incubated at 37 uC for 90 min (final volume 140 ml). One volume of Baseline-ZERO Stop solution (EDTA) was added. Viral RNA was extracted from viral particles using a QIAamp Viral RNA Mini kit (Qiagen), and no carrier RNA was added to the viral sample. The viral RNA was eluted in 60 ml elution buffer (Qiagen) containing 40 U RiboLock RNase Inhibitor (Thermo Scientific). Polyadenylated RNA was isolated using Dynabeads Oligo (dT)25 according to the manufacturer’s instructions (Dynal). cDNA synthesis and PCR amplification. cDNA was generated

using Superscript III Reverse Transcriptase (Invitrogen) according to the manufacturer’s instructions. Polyadenylated RNA was primed using two different strategies. A sequence-independent amplification of faecal mRNA was performed as described by Victoria et al. (2009), primed with 50 pmol of primer RAN (GCCGGAGCTCTGCAGATATCNNNNNNNNNN). Another RT reaction was primed with a ‘sicinivirus 1’ specific reverse primer (23R; GTACTGCAAGACCTCATACG), located in the 39 UTR. An initial incubation for 10 min at 25 uC was followed by 50 min at 50 uC and the reaction was inactivated at 70 uC for 5 min. Second strand cDNA synthesis was performed using 5 pmol ml21 of primer RAN, 10 ml of 1st strand RT reaction mix and 4 ml of 106 NEBuffer #2. The sample was denatured at 95 uC for 2 min, cooled to 4 uC for 10 min and 2 ml of 10 U Klenow Fragment (39–59 exo-; New England Biolabs) added. The samples were incubated at 37 uC for 60 min, followed by inactivation of Klenow at 75 uC for 10 min. PCR was performed on 10 ml of double-stranded cDNA in a total volume of 50 ml using AmpliTaq Gold Polymerase (5 U ml21; Life Technologies), along with either primer RA (GCCGGAGCTCTGCAGATATC) or primer RA and ‘sicinivirus 1’ specific reverse primer 23R. The PCR products were separated by 1 % agarose gel electrophoresis and DNA fragments ranging from 500 bp to 9000 bp were gel purified using a GenElute Gel Extraction kit (Sigma-Aldrich). Metagenomic DNA sequencing. A total of 1 mg of the size-

fractionated cDNA was processed by IMGM Laboratories, Germany. The cDNA was sequenced using an Illumina MiSeq sequencing platform with 250 bp paired-end sequencing reads with an average http://vir.sgmjournals.org

coverage of 1506. The library was prepared by IMGM using Nextera XT technology optimized for small genomes. Sequence annotation and genome walking. The IMGM returned

file contained 13 contigs after de novo assembly and the contigs which were predicted to encode ‘sicinivirus 1’ sequences were analysed using Seqbuilder Lasergene suite of programs (DNASTAR). The predicted ORFs were compared to other picornaviruses within the NCBI database using BLASTP and the contigs were orientated to provide a draft of the ‘sicinivirus 1’ genome. Primers were designed to walk the entire genome of the virus (primer sequences in Table S1, available in the online Supplementary Material). Standard PCR was performed using HotStarTaq DNA Polymerase (Qiagen), annealing temperatures as specified in Table S1. PCR products were purified using the QIAquick PCR Purification kit (Qiagen), sequenced by MWG (Eurofins) and analysed by CLUSTAL W (Larkin et al., 2007). Polyprotein cleavage sites were predicted using the NetPicoRNA 1.0 server (Blom et al., 1996). Pfam (Punta et al., 2012) and BLASTP tools were used to predict conserved protein domains/families within the ‘sicinivirus 1’ polyprotein (Blom et al., 1996). RNA secondary structures were predicted using the Mfold web server (Zuker, 2003). Phylogenetic and homology analysis. Nucleic acid and deduced amino acid sequences corresponding to the ‘sicinivirus 1’ genome (9243 nt and 2864 aa) and the individual P1, P2 and P3 regions were compared using BLASTN and BLASTP, against accessible sequence data of various picornaviruses: ‘Passerivirus A’, aichivirus A, aichivirus B, aichivirus C, salivirus A, ‘gallivirus A’, ‘oscivirus A1’, ‘oscivirus A2’, human rhinovirus B14, enterovirus A, enterovirus J, human poliovirus 1, hepatitis A virus, foot-and-mouth disease virus type O and chicken ‘gallivirus’ CHK1. For phylogenetic analysis, the amino acid sequences of the P1, 2C and 3CD regions of the picornaviruses were aligned using the Muscle algorithm in MEGA5 (Tamura et al., 2011). Following this, MEGA5 (Tamura et al., 2011) was used to reconstruct phylogenetic trees by the maximum-likelihood method using the JTT matrix-based model (Jones et al., 1992), with 1000 bootstrap replicates. Using the aligned data, MEGA5 was also employed to determine pairwise distance, the disparity index and amino acid usage for the particular regions analysed. Quantification of virus levels in chicken stool samples. SYBR

Green (Sigma-Aldrich) based quantitative PCR, was performed on cDNA generated from faecal RNA extracted samples using a Roche LightCycler 480II thermocycler. A PCR generated product of 197 bp from the 39 end of the 3D gene of ‘sicinivirus 1’ was generated using primers 23F and 23R (Table S1). Serial dilutions were performed to generate a series of standards ranging in concentration from 101 to 107 molecules. Unknown faecal samples were quantified from the standard curve generated by the second derivative maximum method. 1101

S. Bullman and others

ACKNOWLEDGEMENTS Special thanks to Brigid Lucey, Department of Biological Sciences, Cork Institute of Technology for procurement of chicken cloacal samples. The project was part funded by the Irish Government under the National Development Plan 2000–2006, Food Institutional Research Measure (FIRM).

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A. & other authors (2007). CLUSTAL W and CLUSTAL_X version 2.0. Bioinformatics

23, 2947–2948. Lau, S. K., Woo, P. C., Lai, K. K., Huang, Y., Yip, C. C., Shek, C. T., Lee, P., Lam, C. S., Chan, K. H. & Yuen, K. Y. (2011). Complete genome

analysis of three novel picornaviruses from diverse bat species. J Virol 85, 8819–8828.

REFERENCES

Mahgoub, H. A., Bailey, M. & Kaiser, P. (2012). An overview of infectious bursal disease. Arch Virol 157, 2047–2057.

Blom, N., Hansen, J., Blaas, D. & Brunak, S. (1996). Cleavage

Marvil, P., Knowles, N. J., Mockett, A. P., Britton, P., Brown, T. D. & Cavanagh, D. (1999). Avian encephalomyelitis virus is a picornavirus

site analysis in picornaviral polyproteins: discovering cellular targets by neural networks. Protein Sci 5, 2203–2216. Boros, A´., Nemes, C., Pankovics, P., Kapusinszky, B., Delwart, E. & Reuter, G. (2012). Identification and complete genome characteriza-

tion of a novel picornavirus in turkey (Meleagris gallopavo). J Gen Virol 93, 2171–2182. Boros, A., Nemes, C., Pankovics, P., Kapusinszky, B., Delwart, E. & Reuter, G. (2013). Genetic characterization of a novel picornavirus

in turkeys (Meleagris gallopavo) distinct from turkey galliviruses and megriviruses and distantly related to the members of the genus Avihepatovirus. J Gen Virol 94, 1496–1509. Farkas, T., Fey, B., Hargitt, E., III, Parcells, M., Ladman, B., Murgia, M. & Saif, Y. (2012). Molecular detection of novel picornaviruses in

chickens and turkeys. Virus Genes 44, 262–272. Felsenstein, J. (1985). Confidence limits on phylogenies: an approach

and is most closely related to hepatitis A virus. J Gen Virol 80, 653– 662. Moore, J. E., Corcoran, D., Dooley, J. S., Fanning, S., Lucey, B., Matsuda, M., McDowell, D. A., Me´graud, F., Millar, B. C. & other authors (2005). Campylobacter. Vet Res 36, 351–382. Pankovics, P., Boros, A. & Reuter, G. (2012). Novel picornavirus

in domesticated common quail (Coturnix coturnix) in Hungary. Arch Virol 157, 525–530. Pantin-Jackwood, M. J., Spackman, E. & Day, J. M. (2007). Pathology

and virus tissue distribution of Turkey origin reoviruses in experimentally infected Turkey poults. Vet Pathol 44, 185–195. Punta, M., Coggill, P. C., Eberhardt, R. Y., Mistry, J., Tate, J., Boursnell, C., Pang, N., Forslund, K., Ceric, G. & other authors (2012). The Pfam protein families database. Nucleic Acids Res 40

using the bootstrap. Evolution 39, 783–791.

(D1), D290–D301.

Giachetti, C., Hwang, S. S. & Semler, B. L. (1992). Cis-acting lesions

Reuter, G., Kecske´meti, S. & Pankovics, P. (2010). Evolution of

targeted to the hydrophobic domain of a poliovirus membrane protein involved in RNA replication. J Virol 66, 6045–6057.

Reuter, G., Pankovics, P., Knowles, N. J. & Boros, A´. (2012). Two

Gorbalenya, A. E., Koonin, E. V. & Lai, M. M. (1991). Putative papain-

porcine kobuvirus infection, Hungary. Emerg Infect Dis 16, 696–698. closely related novel picornaviruses in cattle and sheep in Hungary from 2008 to 2009, proposed as members of a new genus in the family Picornaviridae. J Virol 86, 13295–13302.

related thiol proteases of positive-strand RNA viruses. Identification of rubi- and aphthovirus proteases and delineation of a novel conserved domain associated with proteases of rubi-, alpha- and coronaviruses. FEBS Lett 288, 201–205.

Rosenquist, H., Sommer, H. M., Nielsen, N. L. & Christensen, B. B. (2006). The effect of slaughter operations on the contamination of

Green, J., Gallimore, C. I., Norcott, J. P., Lewis, D. & Brown, D. W. (1995). Broadly reactive reverse transcriptase polymerase chain

chicken carcasses with thermotolerant Campylobacter. Int J Food Microbiol 108, 226–232.

reaction for the diagnosis of SRSV-associated gastroenteritis. J Med Virol 47, 392–398.

Schat, K. A. (2009). Chicken anemia virus. Curr Top Microbiol

Honkavuori, K. S., Shivaprasad, H. L., Briese, T., Street, C., Hirschberg, D. L., Hutchison, S. K. & Lipkin, W. I. (2011). Novel

Smith, A. M., Adler, F. R., Ribeiro, R. M., Gutenkunst, R. N., McAuley, J. L., McCullers, J. A. & Perelson, A. S. (2013). Kinetics of coinfection

picornavirus in Turkey poults with hepatitis, California, USA. Emerg Infect Dis 17, 480–487.

with influenza A virus and Streptococcus pneumoniae. PLoS Pathog 9, e1003238.

Huang, F. F., Sun, Z. F., Emerson, S. U., Purcell, R. H., Shivaprasad, H. L., Pierson, F. W., Toth, T. E. & Meng, X. J. (2004). Determination

Sweeney, T. R., Dhote, V., Yu, Y. & Hellen, C. U. (2012). A distinct

and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV. J Gen Virol 85, 1609–1618. Jackwood, M. W. (2012). Review of infectious bronchitis virus around

the world. Avian Dis 56, 634–641. Jones, D. T., Taylor, W. R. & Thornton, J. M. (1992). The rapid

generation of mutation data matrices from protein sequences. Comput Appl Biosci 8, 275–282.

Immunol 331, 151–183.

class of internal ribosomal entry site in members of the Kobuvirus and proposed Salivirus and Paraturdivirus genera of the Picornaviridae. J Virol 86, 1468–1486. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011). MEGA5: molecular evolutionary genetics analysis

using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28, 2731–2739. Tseng, C. H. & Tsai, H. J. (2007). Sequence analysis of a duck

Kim, M. C., Kwon, Y. K., Joh, S. J., Lindberg, A. M., Kwon, J. H., Kim, J. H. & Kim, S. J. (2006). Molecular analysis of duck hepatitis virus

picornavirus isolate indicates that it together with porcine enterovirus type 8 and simian picornavirus type 2 should be assigned to a new picornavirus genus. Virus Res 129, 104–114.

type 1 reveals a novel lineage close to the genus Parechovirus in the family Picornaviridae. J Gen Virol 87, 3307–3316.

Victoria, J. G., Kapoor, A., Li, L., Blinkova, O., Slikas, B., Wang, C., Naeem, A., Zaidi, S. & Delwart, E. (2009). Metagenomic analyses

Kofstad, T. & Jonassen, C. M. (2011). Screening of feral and wood

of viruses in stool samples from children with acute flaccid paralysis. J Virol 83, 4642–4651.

pigeons for viruses harbouring a conserved mobile viral element: characterization of novel Astroviruses and Picornaviruses. PLoS ONE 6, e25964. 1102

Woo, P. C., Lau, S. K., Huang, Y., Lam, C. S., Poon, R. W., Tsoi, H. W., Lee, P., Tse, H., Chan, A. S. & other authors (2010). Comparative

Journal of General Virology 95

Novel chicken picornavirus analysis of six genome sequences of three novel picornaviruses, turdiviruses 1, 2 and 3, in dead wild birds, and proposal of two novel genera, Orthoturdivirus and Paraturdivirus, in the family Picornaviridae. J Gen Virol 91, 2433–2448.

(2012). Natural occurrence and characterization of two internal ribosome entry site elements in a novel virus, canine picodicistrovirus, in the picornavirus-like superfamily. J Virol 86, 2797– 2808.

Woo, P. C., Lau, S. K., Choi, G. K., Huang, Y., Teng, J. L., Tsoi, H. W., Tse, H., Yeung, M. L., Chan, K. H. & other authors

Zuker, M. (2003). Mfold web server for nucleic acid folding and

http://vir.sgmjournals.org

hybridization prediction. Nucleic Acids Res 31, 3406–3415.

1103