Biotechnol Lett DOI 10.1007/s10529-014-1749-1
ORIGINAL RESEARCH PAPER
Identification and functional characterization of Siberian wild rye (Elymus sibiricus L.) small heat shock protein 16.9 gene (EsHsp16.9) conferring diverse stress tolerance in prokaryotic cells Sang-Hoon Lee • Ki-Won Lee • Dong-Gi Lee • Daeyoung Son • Su Jung Park • Ki-Yong Kim Hyung Soo Park • Joon-Yung Cha
•
Received: 5 October 2014 / Accepted: 10 December 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Small heat shock proteins (Hsps) protect against stress-inducible denaturation of substrates. Our objectives were to clone and examine the mRNA expression of the Hsp16.9 gene from Siberian wild rye grown under diverse stress treatments. We characterized EsHsp16.9 from Elymus sibiricus L. EsHsp16.9 has a 456-bp open reading frame that encodes a 151-amino acid protein with a conserved a-crystallin domain. Northern blot analysis showed that
Sang-Hoon Lee and Ki-Won Lee have contributed equally to the work.
Electronic supplementary material The online version of this article (doi:10.1007/s10529-014-1749-1) contains supplementary material, which is available to authorized users. S.-H. Lee K.-W. Lee K.-Y. Kim H. S. Park Grassland & Forages Division, National Institute of Animal Science, Rural Development Administration, Cheonan 330-801, Republic of Korea e-mail: [email protected] K.-W. Lee e-mail: [email protected] K.-Y. Kim e-mail: [email protected] H. S. Park e-mail: [email protected] D.-G. Lee Division of Life Science, Korea Basic Science Institute, Daejeon 305-333, Republic of Korea e-mail: [email protected]
EsHsp16.9 transcripts were enhanced by heat, drought, arsenate, methyl viologen, and H2O2 treatment. In addition, recombinant EsHsp16.9 protein acts as a molecular chaperone to prevent the denaturation of malate dehydrogenase. Growth of cells overexpressing EsHsp16.9 was up to 200 % more rapid in the presence of NaCl, arsenate, and polyethylene glycol than that of cells harboring an empty vector. These data suggest that EsHsp16.9 acts as a molecular chaperone that enhances stress tolerance in living organisms. Keywords Abiotic stress Cytosolic small heat shock protein class I Molecular chaperone Tolerance
D. Son Department of Applied Biology, Gyeongsang National University, Jinju 660-701, Republic of Korea e-mail: [email protected] S. J. Park Department of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea e-mail: [email protected] J.-Y. Cha (&) Division of Applied Life Science (BK21Plus), Plant Molecular Biology and Biotechnology Research Center (PMBBRC), Gyeongsang National University, Jinju 660-701, Republic of Korea e-mail: [email protected]
123
Biotechnol Lett
Introduction Siberian wild rye (Elymus sibiricus L.) is a perennial, cespitose, self-pollinating grass indigenous to Northern Asia and widely distributed from Northern Europe to Japan. The plant shows strong environmental adaptability with tolerance to drought and cold; thus, it is often used as a forage resource (Yan et al. 2007). Environmental stress caused by global warming leads to decreased crop productivity and is a serious issue in agriculture (Ahuja et al. 2010). Breeding of E. sibiricus could increase the productivity of forage crops; however, genetic studies on this grass have not been conducted. Heat shock proteins (Hsps) are well-characterized stress-inducible proteins that act as molecular chaperones in prokaryotes and eukaryotes (Vierling 1991). Chaperones bind to unfolded proteins, prevent aggregation, induce correct refolding, and facilitate correct cell function under stressful conditions. Among several families of Hsps classified by molecular mass, small Hsps are 12–43 kDa and include a conserved acrystallin domain with different subcellular localizations (Vierling 1991; Wang et al. 2004). Environmental stressors can lead to diverse expression of small Hsp in plants (Hamilton and Heckathorn 2001; Malik et al. 1999; Sato and Yokoya 2008). Overexpression of small Hsps confers tolerance to various stressors (Mu et al. 2013; Sato and Yokoya 2008). We identified two differentially localized small Hsps: rice chloroplast Hsp that confers tolerance to oxidative and heat stress in tall fescue, and alfalfa mitochondrial Hsp that confers tolerance to salinity and arsenic stress in Escherichia coli, tobacco, and tall fescue (Lee et al. 2012a, b). Here, we cloned the small Hsp16.9 gene from heatstress-induced fragments in Siberian wild rye using differentially expressed gene (DEG) analysis. We examined the mRNA expression of EsHsp16.9, in vitro molecular chaperone activity and in vivo stress tolerance in a prokaryotic system against diverse environmental stressors.
Materials and methods Plant materials and growth conditions Seeds of Elymus sibiricus were collected from Ulaanbaatar, Mongolia and were planted in pots
123
containing Horticulture Nursery medium (Biomedia, Gyeongju, Korea). Plants were grown at the Grassland and Forages Division, National Institute of Animal Science, Cheonan, Korea, in a growth chamber maintained at 25 °C with light intensity of 400 lmol m-2 s-1 and a 14-h photoperiod. Isolation of EsHsp16.9 Four-week-old seedlings were subjected to a 42 °C heat treatment or a 25 °C non-treatment (control) for 6 h. After treatment, leaves were harvested and frozen with liquid nitrogen. Total RNA was isolated from leaf tissues of treated and control plants using TRIzol reagent (Qiagen, CA, USA). EsHsp16.9 was isolated using the GeneFishing DEG kit (Seegene, South Korea), with an annealing control priming-based PCR method, as described by Lee et al. (2012c). Sequence analyses The nucleotide and deduced amino acid sequences and the conserved domain were analyzed using NCBIBLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and Bioedit (version 7.2.3; http://www.mbio.ncsu.edu/ bioedit/bioedit.html). The isoelectric point (pI) and molecular weight (Mw) of EsHsp16.9 were calculated using the Compute pI/Mw tool in ExPASy (http://web. expasy.org/compute_pi/). Amino acid sequences of small Hsps in Arabidopsis and homologs of EsHsp16.9 from different plant species were retrieved from the GenBank database after a homology search using BLASTP in NCBI-BLAST. Multiple sequence alignment was performed using ClustalX2 and GeneDoc (version 2.7). A phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstrap replicates in MEGA6.0 (http://www. megasoftware.net). Abiotic stress treatments to Siberian wild rye plants Four-week-old Siberian wild rye seedlings were exposed to drought (withdrawal of irrigation), heat (42 °C), cold (4 °C), salt (NaCl, 300 mM), copper (CuSO4, 500 lM), cadmium (CdCl2, 500 lM), arsenate (Na2HAsO47H2O, 500 lM), methyl viologen (MV, 1 mM), and hydrogen peroxide (H2O2, 10 mM). For heat and cold treatments, seedlings were
Biotechnol Lett
transferred to a temperature-controlled growth chamber (42 or 4 °C). For salt and heavy metal treatments, seedlings were irrigated with water containing the indicated concentrations of the compounds. For MV and H2O2 treatments, leaf segments were floated on water containing the indicated compounds. Plants were harvested after exposure of stresses for 0, 1, 6, 12, 24 and 36 h, frozen in liquid nitrogen, and maintained at -80 °C until use. Northern blot analysis To investigate transcriptional expression of the EsHsp16.9 gene in response to various abiotic stressors, total RNA was isolated from stress-treated leaves using TRIzol (Qiagen). The extracted RNA (10 lg) was fractionated by electrophoresis on a 1.2 % agarose gel containing formaldehyde and was then blotted onto a Hybond-N? nylon membrane (Amersham, Little Chalfont, UK). The blots were hybridized overnight at 65 °C with a 32P-labeled probe, which is PCR-amplified EsHsp16.9 gene using forward primer ATGTCGATCGTGCGGCGG and reverse primer TCAGCCGGAGATCTCGATG. Three independent northern blot analyses were performed and the bands were analyzed using Image J (v.1.48) for quantification. Construction of the expression plasmid, and expression and purification of the recombinant EsHsp16.9 protein To express the recombinant EsHsp16.9 protein with a glutathione S-transferase (GST) and 6 9 His tag, the open reading frame (ORF) of EsHsp16.9 was amplified by PCR using two primers (forward primer TCGGGGATCCGAATTCATGTCGATCGTGCGG CGG and reverse primer GTGCGGCCGC AAGCTTGCCGGAGATCTCGATGGC) and was ligated into the pET-41a plasmid. The plasmid was transformed into E. coli BL21 (DE3) cells, and a single colony harboring the plasmid was grown at 37 °C overnight. The culture was inoculated into fresh Luria–Bertani (LB) liquid media (tryptone and NaCl, each 10 g l-1; yeast extract, 5 g l-1) and cultured until the OD600 reached 0.6–0.8. Recombinant protein was induced by adding 0.2 mM isopropyl-1-thio-b-Dgalactopyranoside (IPTG), and cells were cultured for a further 4 h at 30 °C. After harvesting by centrifugation (3989g for 10 min at 4 °C), the cells were re-
suspended in one-tenth (10 %) volume phosphatebuffered saline (PBS; 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.3) of culture volume and frozen at –80 °C until use. After thawing, resuspended cells were incubated on ice for 20 min in the presence of 1 % Triton X-100 and disrupted by sonication (20 % amplitude with 2 s on/ off for 10 min at 4 °C). After centrifugation (1,5939g for 15 min at 4 °C), the supernatant was applied to a glutathione Sepharose 4B affinity column and incubated for 16 h at 4 °C. GST-fused EsHsp16.9 recombinant protein was washed with a 20-column volume of cold 1 9 PBS, eluted with 10 mM reduced glutathione, and dialyzed against 40 mM HEPES (pH 7.5) buffer using a 5,000-Da cutoff dialysis tube for 16 h at 4 °C. Recombinant proteins were confirmed by separation on a 10 % SDS–polyacrylamide gel. Chaperone assay Recombinant GST-fused EsHsp16.9 protein was examined for chaperone activity by measuring its ability to reduce thermal aggregation of Arabidopsis malate dehydrogenase (MDH, EC 1.1.1.37) expressed recombinantly. Recombinant GST-MDH was expressed in E. coli (BL21 DE3) and induced by 1 mM IPTG. Extraction and affinity purification of GST-MDH protein were carried out as described above. Before elution, MDH was cleaved using thrombin for 16 h at 4 °C and was further dialyzed as mentioned previously. MDH aggregation was monitored for 15 min in the absence or presence of various concentrations of GST-fused EsHsp16.9 with 40 mM HEPES (pH 7.5) by measuring absorbance at 340 nm using a Beckman DU-800 spectrophotometer fitted with a thermostatic cell holder assembly at 45 °C. The increasing absorbance values represent aggregation of MDH under thermal conditions. Three independent experiments were performed; the data are presented in one representative figure. Growth inhibition assay against abiotic stressors in E. coli E. coli cells harboring empty vector (pET-41a) and EsHsp16.9 (pET-41a:EsHsp16.9) plasmids were cultured overnight at 37 °C and inoculated into fresh LB liquid media in 1:100 cell-to-media volume ratios. Cells were subsequently cultured at 37 °C until the
123
Biotechnol Lett
Isolation of full-length EsHsp16.9
Fig. 2 Amino acid sequence comparison and phylogenetic c analysis of EsHsp16.9 with small Hsps from different plant species. a Alignment of Elymus sibiricus Hsp16.9 (EsHsp16.9) protein with homologs from Hordeum vulgare (Hsp17; ADW78607), Zea mays (Hsp16.9 class I; NP_001150783), Triticum monococcum (Hsp17; CAM96547), Aegilops longissima (Hsp16.9; CAM96537), Setaria italica (Hsp16.9 class I; XP_004968026), Oryza sativa (Hsp; AAB39856), Medicago truncatula (Hsp18.2 class I; XP_003619703), Nicotiana tabacum (Hsp 3B class I; ADK36668), and Cicer arietinum (Hsp8.5 class I; XP_004505085). Multiple sequence alignment was performed using ClustalX2 and GeneDoc (ver. 2.7). b Phylogenetic analysis of EsHsp16.9 with homologs from different plants. The phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstrap replicates in MEGA6.0. Numbers indicate the percentage of confidence
Using DEG analysis for the gene-fishing technique, several partial cDNA fragments were obtained from heat stress-exposed Siberian wild rye mRNA. The
amplified fragments were eluted, cloned into a pTOPO vector, and sequenced. A BLAST search showed one fragment with high sequence similarity to Hordeum
Fig. 1 Phylogenetic analysis of EsHsp16.9 with Arabidopsis genes encoding small Hsps. Amino acid sequences of EsHsp16.9 were compared with Arabidopsis small heat shock protein (Hsp) genes by phylogenetic analysis. Arabidopsis small Hsp genes include AT1G53540 (NCBI accession number ABD57522; Protein name, At17.6C class I), AT3G46230 (AEE78138; At17.4 class I), AT5G59720 (AED97223; At18.1 class I), AT1G07400 (AEE28120; At17.8 class I), AT1G59860 (ABD57519; At17.6A class I), AT2G29500 (ABD57517; At17.6B class I), AT4G10250 (AAO44068; At22), AT5G37670 (AED94218; At17.5), AT4G25200 (BAH19967;
At23.6), AT5G51440 (AED96081), AT4G27670 (AEE85379; At21), AT1G52560 (AAR92344; At26.5), AT5G54660 (ABL66753; At21.7 class V), AT5G12030 (AED91752; At17.7 class II), AT5G12020 (AED91751; At17.6 class II), AT1G54050 (AEE33041; At17.3 class III), AT4G21870 (ABF59020; At15.4 class IV), AT3G22530 (AEE76650), AT1G06460 (ABF74713), AT5G04890 (AED90800), and AT3G10680 (AEE74942). The phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstrap replicates in MEGA6.0. Numbers indicate the percentage of confidence
OD600 reached 0.6. After IPTG (0.2 mM) induction, cells were immediately treated with NaCl (400 mM), arsenate (As, 0.1 mM), or polyethylene glycol (3 %) and incubated at 30 °C. For heat stress, cells were transferred to 48 °C after IPTG induction. Cell growth was monitored via a spectrophotometer (OD600) hourly for 4 h. Results were averaged from six independent experiments.
Results and discussion
123
Biotechnol Lett
vulgare mRNA for a 17-kDa class-I small Hsp and a full-length open reading frame (ORF) sequence revealed by sequence alignment with other small
Hsp genes. Full-length ORF resulted in 456-bp encoding 151 amino acids, which exhibited a conserved a-crystallin domain between amino acids 45
123
Biotechnol Lett
and 136 (Supplementary Fig. S1). The small Hsps are characterized by a conserved a-crystallin domain composed of approximately 100 amino acids, and have structurally disordered N-terminal arms and a short flexible C-terminal extension (Vierling 1991; Wang et al. 2004). By using the compute pI/Mw tool, the calculated isoelectric point (pI) and molecular weight of the deduced DEG66 were 5.53 and 16,923 Da, respectively. The full-length ORF sequence was deposited in GenBank (accession number KM025035). Hsps act mainly to suppress protein aggregation and to help refolding of stress-damaged proteins; these chaperone processes are classified as ATP-independent and -dependent, respectively. ATPdependent refolding of damaged substrates is facilitated by the Hsp100, Hsp90, and Hsp70 subfamilies, whereas ATP-independent protection is manipulated by small Hsps (Siddique et al. 2008). However, these apparent independent processes often cooperate in the assembly of hetero-multimeric chaperone machinery (Mogk et al. 2003).
to [1 % of total leaf proteins in soybean seedlings (Vierling 1991). However, the expression patterns of genes encoding small Hsps under other environmental stressors have not been extensively studied. Crops and model plants such as Arabidopsis are sensitive to abiotic stress, and biotechnological approaches have been widely adopted to improve their stress tolerance (Varshney et al. 2011). To add to this growing body of research, we examined the expression of EsHsp16.9 under various stress conditions by northern blot analysis (Supplementary Fig. S2 and Fig. 3). The amount of EsHsp16.9 mRNA increased rapidly and markedly under heat stress conditions (Fig. 3a). Drought stress also triggered expression of EsHsp16.9 (Fig. 3d). Expression patterns of EsHsp16.9 differed under the other stress treatments (Fig. 3b, c, e–g). The oxidative stress agents MV and H2O2 strongly induced EsHsp16.9 mRNA expression (Fig. 3h and 3i). These findings suggest that the diverse small Hsps are differentially involved in each stress condition, with EsHsp16.9 mainly playing a role in responses to heat, drought, and oxidative stress.
Characterization of EsHsp16.9 Small Hsps make up a multigene family, are classified according to their subcellular localization, and commonly act as molecular chaperones. In the completed genome of Arabidopsis, 34 small Hsps were identified and classified into five subclasses (Siddique et al. 2008). To reveal the class to which EsHsp16.9 belonged, we performed a phylogenetic analysis with Arabidopsis small Hsps (Fig. 1). As determined previously, cytosolic small Hsps are divided two classes. EsHsp16.9 showed high sequence similarity (70.9 %) with AtHsp18.1 of cytosolic class I and shared 60–70 % sequence similarity with other cytosolic class I small Hsps in Arabidopsis. We further compared EsHsp16.9 to cytosolic class I small Hsps of other plants (Fig. 2); EsHsp16.9 had the highest sequence similarity to wheat (96 %) and barley (94.7 %) and was more similar to monocots ([80 %) than to dicots (approximately 70 %). These findings are not surprising since Siberian wild rye belongs to the tribe Triticeae, which is similar to wheat (Yan et al. 2007). Expression of EsHsp16.9 in response to stress Small Hsps are dramatically induced when plants are exposed to heat stress, and these proteins accumulate
123
Expression, purification, and molecular chaperone activity of recombinant EsHsp16.9 protein The EsHsp16.9 gene was expressed in E. coli BL21 cells as GST and 6 9 His-tagged fusion proteins. To establish ideal conditions for the expression of recombinant EsHsp16.9 protein, cells harboring EsHsp16.9 were induced by different concentrations of IPTG (0, 0.2, and 1 mM) and were cultured at 18, 26, and 37 °C, after IPTG induction (data not shown). Large amounts of recombinant EsHsp16.9 protein were obtained when cells were incubated at 37 °C for 4 h after 0.2 mM IPTG induction. Recombinant EsHsp16.9 of the expected size (43.8 kDa) was highly expressed in the total fraction after IPTG induction, but it was not detected in the absence of IPTG treatment (Fig. 4). In addition, the recombinant EsHsp16.9 protein was similarly expressed in the supernatant and pellet fractions (Fig. 4a). Using the supernatant, we further purified the recombinant protein by glutathione–Sepharose 4B resin, eluted it by reduced glutathione, and separated the protein using 10 % SDS-PAGE. Large amounts of recombinant EsHsp16.9 protein (1.64 mg EsHsp16.9 protein from 250 ml liquid culture) were purified (Fig. 4b).
Biotechnol Lett
indicating that MDH was fully denatured (Fig. 5). Orchardgrass Hsp70 (DgHsp70) and bovine serum albumin (BSA) were used as a positive and negative control, respectively. DgHsp70 decreased the aggregation of MDH at a 1:0.5 molar ratio of MDH/ DgHsp70; BSA did not decrease aggregation at a 1:5 ratio of MDH/BSA. Interestingly, MDH denaturation was protected in a dose-dependent manner in the presence of EsHsp16.9. EsHsp16.9 at concentrations 5 M greater than that of MDH protected almost 90 %
Small Hsps are molecular chaperones that prevent irreversible aggregation of substrates under heat stress (Siddique et al. 2008; Vierling 1991). To characterize the functional chaperone properties of EsHsp16.9, MDH, which is one of the best-known model substrates for chaperone assays, was denatured under thermal aggregation at 45 °C and its denaturation was monitored for 15 min. In the absence of EsHsp16.9, MDH was rapidly denatured for 10 min under the heated condition, after which the curve plateaued,
20
Heat
15 10 5 0
C 3
Cold
2 1 0
0
1
6
12
24
36
0
1
Drought
9 6 3 0 0
1
6
12
24
3
1 0 12
0
8
1 0 1
6
12
24
1
24
36
9 6 3 0
Time (h) Fig. 3 Expression of EsHsp16.9 transcripts in response to abiotic stressors. Expression of EsHsp16.9 in seedlings treated with heat (a), cold (b), salt (c), drought (d), copper (e), cadmium (f), arsenate (g), methyl viologen (h) and hydrogen peroxide
6
12
Time (h)
24
36
24
36
24
36
4 2 0 1
6
12
Time (h)
MV
1
12
Cd
0
I
0
6
6
36
12
Relative Expression
2
6
1
Time (h)
As
1
2
Time (h)
Cu
0
H
0
Salt
0
36
2
36
Relative Expression
Relative Expression
3
24
F
Time (h)
G
12
Relative Expression
E Relative Expression
Relative Expression
12
6
3
Time (h)
Time (h)
D
Relative Expression
B 25
Relative Expression
Relative Expression
A
24
36
H2O2
9 6 3 0 0
1
6
12
Time (h)
(i) for 0, 1, 6, 12, 24 and 36 h. Three independent northern blot analyses were performed and the band intensity was analyzed using ImageJ. Data are mean ± SE (n = 3)
123
Biotechnol Lett
(kDa)
M T
Acquired abiotic stress tolerance by overexpression of EsHsp16.9 in E. coli
B
A
IPTG (mM)
0 S P
0.2 T
S P
70 55 40 35
Elution (kDa)
M S
1
2
3
Next, we examined abiotic stress tolerance conferred by EsHsp16.9, which showed enhanced mRNA expression under stress conditions and functional molecular chaperone activity in vitro (Figs. 3, 5). To identify stress tolerance, we used EsHsp16.9 in a prokaryotic system with the E. coli growth-inhibition assay. Cells harboring vector (pET41a, as a control) or EsHsp16.9 (pET41a:EsHsp16.9) were overexpressed by 0.2 mM IPTG (Fig. 4a) and diluted to equal cell optical density (OD) before abiotic stress treatment. Diluted cells were immediately exposed to salt, arsenate, polyethylene glycol (PEG), or heat (45 °C), and cell growth was measured hourly for 4 h. In the absence of stress, cells harboring vector or EsHsp16.9 grew similarly during the 4-h incubation (Fig. 6a). However, vector-containing cell growth was severely retarded in the presence of stressors (Fig. 6b–e). Cells harboring EsHsp16.9 grew better than those harboring vector in the presence of salt, arsenate, and PEG (Fig. 6b–d). However, under heat stress, growth of EsHsp16.9 cells was inhibited similarly to that of vector-contacting cells (Fig. 6e). Genes encoding small Hsps have been used as heat stress markers, and several small Hsps are involved in heat stress tolerance (Mu et al. 2013). Our data indicate that overexpression of EsHsp16.9 in E. coli enhanced tolerance to salt, arsenate, and PEG. We previously
70 55 40 35
Fig. 4 Expression and purification of recombinant EsHsp16.9 protein. a Expression of recombinant EsHsp16.9 protein. Cells harboring the EsHsp16.9 gene were induced by 0 or 0.2 mM isopropyl-1-thio-b-D-galactopyranoside (IPTG). Total extracts (T), supernatant (S), and pellet (P) fractions were separated in 10 % SDS-PAGE. Molecular markers (M) are represented on the left. b Purification of EsHsp16.9 protein. Supernatant fractions (S) were purified by affinity chromatography using glutathione–Sepharose 4B resin and eluted by reduced glutathione
of MDH against heat-induced denaturation. In addition, the light-scattering value of EsHsp16.9 in the absence of MDH was not increased by heat, indicating that EsHsp16.9 is a heat-stable protein. In vitro experiments have revealed that most small Hsps assemble large oligomeric states of 12–40 subunits based on dimers as building blocks. The N-terminal arm is essential for oligomerization, chaperone activity, and substrate specificity and the C-terminal extension is also involved in oligomerization (Basha et al. 2013). 0.6
Light scattering (A340)
Fig. 5 Molecular chaperone activity of recombinant EsHsp16.9 protein. Malate dehydrogenase (MDH, 0.3 lM) was incubated in the absence or presence of recombinant EsHsp16.9 protein. Various molar ratios of MDH to EsHsp16.9 were examined. Bovine serum albumin (BSA) and orchardgrass Hsp70 (DgHsp70) were used as a negative and positive control, respectively
0.4
MDH (0.3 μM) + EsHsp16.9 (1:0.3) + EsHsp16.9 (1:1)
0.2
+ EsHsp16.9 (1:3) + EsHsp16.9 (1:5) + BSA (1:5) + DgHsp70 (1:0.5) EsHsp16.9 (0.3 μM)
0 0
5
10
Time (min) at 45 °C
123
15
Biotechnol Lett
Vector EsHsp16.9
0.200
0.150
0.100
0.500
1
2
3
0.400 0.300 0.200
4
1
Cell O.D (600 nm)
Cell O.D (600 nm)
E
Vector EsHsp16.9
0.200
2
3
4
0.150 0.100 0.050
EsHsp16.9
0.500 0.400 0.300 0.200
0
1
2
3
4
Time (hr)
Time (hr)
PEG
Vector
0.100 0
Time (hr)
0.250
As
0.600
Vector EsHsp16.9
0.100 0
D
C
NaCl
0.600
Cell O.D (600 nm)
Cell O.D (600 nm)
B
Control
0.250
Cell O.D (600 nm)
A
Heat
0.200
Vector EsHsp16.9
0.180 0.160 0.140 0.120 0.100
0
1
2
3
4
0
Time (hr)
1
2
3
4
Time (hr)
Fig. 6 Stress tolerance assay in the E. coli system. E. coli cells harboring empty vector (pET-41a) and EsHsp16.9 (pET41a:EsHsp16.9) plasmids were treated with various stressors: NaCl (B, 400 mM), arsenate (C, 0.1 mM), polyethylene glycol
(D, 3 %), and heat (E, 48 °C). Cells were cultured without stress treatment (A, Control). Cell growth was monitored hourly by using a spectrophotometer (OD600), for 4 h. The results were averaged from six independent experiments
cloned mitochondrial small Hsp23 (MsHsp23) from alfalfa, and its transcripts were highly induced by heat, salt, and arsenate (Lee et al. 2012b). In addition, overexpression of MsHsp23 in E. coli and tobacco conferred salt and arsenate tolerance (Lee et al. 2012a). Taken together, these findings suggest that EsHsp16.9 confers enhanced stress tolerance to plants.
environmental stressors. Small Hsp genes are found in various organisms and act as molecular chaperones to protect cellular proteins against damage from diverse stressors; these genes also induce stress tolerance. Using a recombinant protein expression system in E. coli, we expressed and purified recombinant EsHsp16.9 protein; this protein showed molecular chaperone activity that protected thermal aggregation of malate dehydrogenase in vitro. In addition, E. coli cells expressing EsHsp16.9 showed better growth under salt, arsenate, PEG, and heat. Thus, genetic manipulation of the EsHsp16.9 gene has the potential to confer tolerance in living organisms to multiple environmental stressors.
Conclusions Siberian wild rye grass is an important forage crop in Northern Asia and has strong adaptability to unfavorable environments. Here, we screened for useful genetic materials from Elymus sibiricus by DEG analysis using the gene-fishing technique. We identified, isolated, and successfully cloned a small Hsp 16.9 (EsHsp16.9) which we categorized in the cytosolic class I subfamily. Enhanced expression of EsHsp16.9 transcripts was confirmed under various
Acknowledgments This study was carried out with the support of the ‘‘Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ008599042015)’’ of National Institute of Animal Science, Rural Development Administration, Republic of Korea.
123
Biotechnol Lett Supporting information Supplementary Figure 1—Nucleotide and deduced amino acid sequences of small Hsp16.9 (EsHsp16.9) from Siberian wild rye (Elymus sibiricus L). Supplementary Figure 2—Northern blot analysis of EsHsp16.9 transcripts in response to abiotic stressors.
References Ahuja I, de Vos RCH, Bones AM, Hall RD (2010) Plant molecular stress responses face climate change. Trends Plant Sci 15:664–674 Basha E, Jones C, Blackwell AE, Cheng G, Waters ER, Samsel KA, Siddique M, Pett V, Wysocki V, Vierling E (2013) An unusual dimeric small heat shock protein provides insight into the mechanism of this class of chaperones. J Mol Biol 425:1683–1696 Hamilton EW, Heckathom SA (2001) Mitochondrial adaptations to NaCl. Complex I is protected by anti-oxidants and small heat shock proteins, whereas complex II is protected by proline and betaine. Plant Physiol 26:1266–1274 Lee KW, Cha JY, Kim KH, Kim YG, Lee BH, Lee SH (2012a) Overexpression of alfalfa mitochondrial HSP23 in prokaryotic and eukaryotic model systems confers enhanced tolerance to salinity and arsenic stress. Biotechnol Lett 34:167–174 Lee KW, Choi GJ, Kim KY, Ji HJ, Park HS, Kim YG, Lee BH, Lee SH (2012b) Transgenic expression of MsHsp23 confers enhanced tolerance to abiotic stresses in tall fescue. Asian-Aust J Anim Sci 25:818–823 Lee KW, Kim KH, Kim YG, Lee BH, Lee SH (2012c) Identification of MsHsp23 gene using annealing control primer system. Acta Physiol Plant 34:807–811
123
Malik MK, Slovin JP, Hwang CH, Zimmerman JL (1999) Modified expression of a carrot small heat shock protein gene, hsp17.7, results in increased or decreased thermotolerance double danger. Plant J 20:89–99 Mogk A, Deuerling E, Vorderwulbecke S, Vierling E, Bukau B (2003) Small heat shock proteins, ClpB and the DnaK system form a functional triade in reversing protein aggregation. Mol Microbiol 50:585–595 Mu C, Zhang S, Yu G, Chen N, Li X, Liu H (2013) Overexpression of small heat shock protein LimHSP16.45 in Arabidopsis enhances tolerance to abiotic stresses. PLoS One 8:e82264 Sato Y, Yokoya S (2008) Enhanced tolerance to drought stress intransgenic rice plants overexpressing a small heat-shock protein, sHSP17.7. Plant Cell Rep 27:329–334 Siddique M, Gernhard S, von Koskull-Do¨ring P, Vierling E, Scharf KD (2008) The plant sHSP superfamily: five new members in Arabidopsis thaliana with unexpected properties. Cell Stress Chaperones 13:183–197 Varshney RK, Bansal KC, Aggarwal PK, Datta SK, Craufurd PQ (2011) Agricultural biotechnology for crop improvement in a variable climate: hope or hype? Trends Plant Sci 16:363–371 Vierling E (1991) The roles of heat shock proteins in plants. Ann Rev Plant Physiol Plant Mol Biol 42:579–620 Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci 9:244–252 Yan JJ, Bai SQ, Ma X, Gan YM, Zhang JB (2007) Genetic diversity of Elymus sibiricus and its breeding in China. Chin Bull Bot 24:226–231
ORIGINAL RESEARCH PAPER
Identification and functional characterization of Siberian wild rye (Elymus sibiricus L.) small heat shock protein 16.9 gene (EsHsp16.9) conferring diverse stress tolerance in prokaryotic cells Sang-Hoon Lee • Ki-Won Lee • Dong-Gi Lee • Daeyoung Son • Su Jung Park • Ki-Yong Kim Hyung Soo Park • Joon-Yung Cha
•
Received: 5 October 2014 / Accepted: 10 December 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Small heat shock proteins (Hsps) protect against stress-inducible denaturation of substrates. Our objectives were to clone and examine the mRNA expression of the Hsp16.9 gene from Siberian wild rye grown under diverse stress treatments. We characterized EsHsp16.9 from Elymus sibiricus L. EsHsp16.9 has a 456-bp open reading frame that encodes a 151-amino acid protein with a conserved a-crystallin domain. Northern blot analysis showed that
Sang-Hoon Lee and Ki-Won Lee have contributed equally to the work.
Electronic supplementary material The online version of this article (doi:10.1007/s10529-014-1749-1) contains supplementary material, which is available to authorized users. S.-H. Lee K.-W. Lee K.-Y. Kim H. S. Park Grassland & Forages Division, National Institute of Animal Science, Rural Development Administration, Cheonan 330-801, Republic of Korea e-mail: [email protected] K.-W. Lee e-mail: [email protected] K.-Y. Kim e-mail: [email protected] H. S. Park e-mail: [email protected] D.-G. Lee Division of Life Science, Korea Basic Science Institute, Daejeon 305-333, Republic of Korea e-mail: [email protected]
EsHsp16.9 transcripts were enhanced by heat, drought, arsenate, methyl viologen, and H2O2 treatment. In addition, recombinant EsHsp16.9 protein acts as a molecular chaperone to prevent the denaturation of malate dehydrogenase. Growth of cells overexpressing EsHsp16.9 was up to 200 % more rapid in the presence of NaCl, arsenate, and polyethylene glycol than that of cells harboring an empty vector. These data suggest that EsHsp16.9 acts as a molecular chaperone that enhances stress tolerance in living organisms. Keywords Abiotic stress Cytosolic small heat shock protein class I Molecular chaperone Tolerance
D. Son Department of Applied Biology, Gyeongsang National University, Jinju 660-701, Republic of Korea e-mail: [email protected] S. J. Park Department of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea e-mail: [email protected] J.-Y. Cha (&) Division of Applied Life Science (BK21Plus), Plant Molecular Biology and Biotechnology Research Center (PMBBRC), Gyeongsang National University, Jinju 660-701, Republic of Korea e-mail: [email protected]
123
Biotechnol Lett
Introduction Siberian wild rye (Elymus sibiricus L.) is a perennial, cespitose, self-pollinating grass indigenous to Northern Asia and widely distributed from Northern Europe to Japan. The plant shows strong environmental adaptability with tolerance to drought and cold; thus, it is often used as a forage resource (Yan et al. 2007). Environmental stress caused by global warming leads to decreased crop productivity and is a serious issue in agriculture (Ahuja et al. 2010). Breeding of E. sibiricus could increase the productivity of forage crops; however, genetic studies on this grass have not been conducted. Heat shock proteins (Hsps) are well-characterized stress-inducible proteins that act as molecular chaperones in prokaryotes and eukaryotes (Vierling 1991). Chaperones bind to unfolded proteins, prevent aggregation, induce correct refolding, and facilitate correct cell function under stressful conditions. Among several families of Hsps classified by molecular mass, small Hsps are 12–43 kDa and include a conserved acrystallin domain with different subcellular localizations (Vierling 1991; Wang et al. 2004). Environmental stressors can lead to diverse expression of small Hsp in plants (Hamilton and Heckathorn 2001; Malik et al. 1999; Sato and Yokoya 2008). Overexpression of small Hsps confers tolerance to various stressors (Mu et al. 2013; Sato and Yokoya 2008). We identified two differentially localized small Hsps: rice chloroplast Hsp that confers tolerance to oxidative and heat stress in tall fescue, and alfalfa mitochondrial Hsp that confers tolerance to salinity and arsenic stress in Escherichia coli, tobacco, and tall fescue (Lee et al. 2012a, b). Here, we cloned the small Hsp16.9 gene from heatstress-induced fragments in Siberian wild rye using differentially expressed gene (DEG) analysis. We examined the mRNA expression of EsHsp16.9, in vitro molecular chaperone activity and in vivo stress tolerance in a prokaryotic system against diverse environmental stressors.
Materials and methods Plant materials and growth conditions Seeds of Elymus sibiricus were collected from Ulaanbaatar, Mongolia and were planted in pots
123
containing Horticulture Nursery medium (Biomedia, Gyeongju, Korea). Plants were grown at the Grassland and Forages Division, National Institute of Animal Science, Cheonan, Korea, in a growth chamber maintained at 25 °C with light intensity of 400 lmol m-2 s-1 and a 14-h photoperiod. Isolation of EsHsp16.9 Four-week-old seedlings were subjected to a 42 °C heat treatment or a 25 °C non-treatment (control) for 6 h. After treatment, leaves were harvested and frozen with liquid nitrogen. Total RNA was isolated from leaf tissues of treated and control plants using TRIzol reagent (Qiagen, CA, USA). EsHsp16.9 was isolated using the GeneFishing DEG kit (Seegene, South Korea), with an annealing control priming-based PCR method, as described by Lee et al. (2012c). Sequence analyses The nucleotide and deduced amino acid sequences and the conserved domain were analyzed using NCBIBLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and Bioedit (version 7.2.3; http://www.mbio.ncsu.edu/ bioedit/bioedit.html). The isoelectric point (pI) and molecular weight (Mw) of EsHsp16.9 were calculated using the Compute pI/Mw tool in ExPASy (http://web. expasy.org/compute_pi/). Amino acid sequences of small Hsps in Arabidopsis and homologs of EsHsp16.9 from different plant species were retrieved from the GenBank database after a homology search using BLASTP in NCBI-BLAST. Multiple sequence alignment was performed using ClustalX2 and GeneDoc (version 2.7). A phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstrap replicates in MEGA6.0 (http://www. megasoftware.net). Abiotic stress treatments to Siberian wild rye plants Four-week-old Siberian wild rye seedlings were exposed to drought (withdrawal of irrigation), heat (42 °C), cold (4 °C), salt (NaCl, 300 mM), copper (CuSO4, 500 lM), cadmium (CdCl2, 500 lM), arsenate (Na2HAsO47H2O, 500 lM), methyl viologen (MV, 1 mM), and hydrogen peroxide (H2O2, 10 mM). For heat and cold treatments, seedlings were
Biotechnol Lett
transferred to a temperature-controlled growth chamber (42 or 4 °C). For salt and heavy metal treatments, seedlings were irrigated with water containing the indicated concentrations of the compounds. For MV and H2O2 treatments, leaf segments were floated on water containing the indicated compounds. Plants were harvested after exposure of stresses for 0, 1, 6, 12, 24 and 36 h, frozen in liquid nitrogen, and maintained at -80 °C until use. Northern blot analysis To investigate transcriptional expression of the EsHsp16.9 gene in response to various abiotic stressors, total RNA was isolated from stress-treated leaves using TRIzol (Qiagen). The extracted RNA (10 lg) was fractionated by electrophoresis on a 1.2 % agarose gel containing formaldehyde and was then blotted onto a Hybond-N? nylon membrane (Amersham, Little Chalfont, UK). The blots were hybridized overnight at 65 °C with a 32P-labeled probe, which is PCR-amplified EsHsp16.9 gene using forward primer ATGTCGATCGTGCGGCGG and reverse primer TCAGCCGGAGATCTCGATG. Three independent northern blot analyses were performed and the bands were analyzed using Image J (v.1.48) for quantification. Construction of the expression plasmid, and expression and purification of the recombinant EsHsp16.9 protein To express the recombinant EsHsp16.9 protein with a glutathione S-transferase (GST) and 6 9 His tag, the open reading frame (ORF) of EsHsp16.9 was amplified by PCR using two primers (forward primer TCGGGGATCCGAATTCATGTCGATCGTGCGG CGG and reverse primer GTGCGGCCGC AAGCTTGCCGGAGATCTCGATGGC) and was ligated into the pET-41a plasmid. The plasmid was transformed into E. coli BL21 (DE3) cells, and a single colony harboring the plasmid was grown at 37 °C overnight. The culture was inoculated into fresh Luria–Bertani (LB) liquid media (tryptone and NaCl, each 10 g l-1; yeast extract, 5 g l-1) and cultured until the OD600 reached 0.6–0.8. Recombinant protein was induced by adding 0.2 mM isopropyl-1-thio-b-Dgalactopyranoside (IPTG), and cells were cultured for a further 4 h at 30 °C. After harvesting by centrifugation (3989g for 10 min at 4 °C), the cells were re-
suspended in one-tenth (10 %) volume phosphatebuffered saline (PBS; 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.3) of culture volume and frozen at –80 °C until use. After thawing, resuspended cells were incubated on ice for 20 min in the presence of 1 % Triton X-100 and disrupted by sonication (20 % amplitude with 2 s on/ off for 10 min at 4 °C). After centrifugation (1,5939g for 15 min at 4 °C), the supernatant was applied to a glutathione Sepharose 4B affinity column and incubated for 16 h at 4 °C. GST-fused EsHsp16.9 recombinant protein was washed with a 20-column volume of cold 1 9 PBS, eluted with 10 mM reduced glutathione, and dialyzed against 40 mM HEPES (pH 7.5) buffer using a 5,000-Da cutoff dialysis tube for 16 h at 4 °C. Recombinant proteins were confirmed by separation on a 10 % SDS–polyacrylamide gel. Chaperone assay Recombinant GST-fused EsHsp16.9 protein was examined for chaperone activity by measuring its ability to reduce thermal aggregation of Arabidopsis malate dehydrogenase (MDH, EC 1.1.1.37) expressed recombinantly. Recombinant GST-MDH was expressed in E. coli (BL21 DE3) and induced by 1 mM IPTG. Extraction and affinity purification of GST-MDH protein were carried out as described above. Before elution, MDH was cleaved using thrombin for 16 h at 4 °C and was further dialyzed as mentioned previously. MDH aggregation was monitored for 15 min in the absence or presence of various concentrations of GST-fused EsHsp16.9 with 40 mM HEPES (pH 7.5) by measuring absorbance at 340 nm using a Beckman DU-800 spectrophotometer fitted with a thermostatic cell holder assembly at 45 °C. The increasing absorbance values represent aggregation of MDH under thermal conditions. Three independent experiments were performed; the data are presented in one representative figure. Growth inhibition assay against abiotic stressors in E. coli E. coli cells harboring empty vector (pET-41a) and EsHsp16.9 (pET-41a:EsHsp16.9) plasmids were cultured overnight at 37 °C and inoculated into fresh LB liquid media in 1:100 cell-to-media volume ratios. Cells were subsequently cultured at 37 °C until the
123
Biotechnol Lett
Isolation of full-length EsHsp16.9
Fig. 2 Amino acid sequence comparison and phylogenetic c analysis of EsHsp16.9 with small Hsps from different plant species. a Alignment of Elymus sibiricus Hsp16.9 (EsHsp16.9) protein with homologs from Hordeum vulgare (Hsp17; ADW78607), Zea mays (Hsp16.9 class I; NP_001150783), Triticum monococcum (Hsp17; CAM96547), Aegilops longissima (Hsp16.9; CAM96537), Setaria italica (Hsp16.9 class I; XP_004968026), Oryza sativa (Hsp; AAB39856), Medicago truncatula (Hsp18.2 class I; XP_003619703), Nicotiana tabacum (Hsp 3B class I; ADK36668), and Cicer arietinum (Hsp8.5 class I; XP_004505085). Multiple sequence alignment was performed using ClustalX2 and GeneDoc (ver. 2.7). b Phylogenetic analysis of EsHsp16.9 with homologs from different plants. The phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstrap replicates in MEGA6.0. Numbers indicate the percentage of confidence
Using DEG analysis for the gene-fishing technique, several partial cDNA fragments were obtained from heat stress-exposed Siberian wild rye mRNA. The
amplified fragments were eluted, cloned into a pTOPO vector, and sequenced. A BLAST search showed one fragment with high sequence similarity to Hordeum
Fig. 1 Phylogenetic analysis of EsHsp16.9 with Arabidopsis genes encoding small Hsps. Amino acid sequences of EsHsp16.9 were compared with Arabidopsis small heat shock protein (Hsp) genes by phylogenetic analysis. Arabidopsis small Hsp genes include AT1G53540 (NCBI accession number ABD57522; Protein name, At17.6C class I), AT3G46230 (AEE78138; At17.4 class I), AT5G59720 (AED97223; At18.1 class I), AT1G07400 (AEE28120; At17.8 class I), AT1G59860 (ABD57519; At17.6A class I), AT2G29500 (ABD57517; At17.6B class I), AT4G10250 (AAO44068; At22), AT5G37670 (AED94218; At17.5), AT4G25200 (BAH19967;
At23.6), AT5G51440 (AED96081), AT4G27670 (AEE85379; At21), AT1G52560 (AAR92344; At26.5), AT5G54660 (ABL66753; At21.7 class V), AT5G12030 (AED91752; At17.7 class II), AT5G12020 (AED91751; At17.6 class II), AT1G54050 (AEE33041; At17.3 class III), AT4G21870 (ABF59020; At15.4 class IV), AT3G22530 (AEE76650), AT1G06460 (ABF74713), AT5G04890 (AED90800), and AT3G10680 (AEE74942). The phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstrap replicates in MEGA6.0. Numbers indicate the percentage of confidence
OD600 reached 0.6. After IPTG (0.2 mM) induction, cells were immediately treated with NaCl (400 mM), arsenate (As, 0.1 mM), or polyethylene glycol (3 %) and incubated at 30 °C. For heat stress, cells were transferred to 48 °C after IPTG induction. Cell growth was monitored via a spectrophotometer (OD600) hourly for 4 h. Results were averaged from six independent experiments.
Results and discussion
123
Biotechnol Lett
vulgare mRNA for a 17-kDa class-I small Hsp and a full-length open reading frame (ORF) sequence revealed by sequence alignment with other small
Hsp genes. Full-length ORF resulted in 456-bp encoding 151 amino acids, which exhibited a conserved a-crystallin domain between amino acids 45
123
Biotechnol Lett
and 136 (Supplementary Fig. S1). The small Hsps are characterized by a conserved a-crystallin domain composed of approximately 100 amino acids, and have structurally disordered N-terminal arms and a short flexible C-terminal extension (Vierling 1991; Wang et al. 2004). By using the compute pI/Mw tool, the calculated isoelectric point (pI) and molecular weight of the deduced DEG66 were 5.53 and 16,923 Da, respectively. The full-length ORF sequence was deposited in GenBank (accession number KM025035). Hsps act mainly to suppress protein aggregation and to help refolding of stress-damaged proteins; these chaperone processes are classified as ATP-independent and -dependent, respectively. ATPdependent refolding of damaged substrates is facilitated by the Hsp100, Hsp90, and Hsp70 subfamilies, whereas ATP-independent protection is manipulated by small Hsps (Siddique et al. 2008). However, these apparent independent processes often cooperate in the assembly of hetero-multimeric chaperone machinery (Mogk et al. 2003).
to [1 % of total leaf proteins in soybean seedlings (Vierling 1991). However, the expression patterns of genes encoding small Hsps under other environmental stressors have not been extensively studied. Crops and model plants such as Arabidopsis are sensitive to abiotic stress, and biotechnological approaches have been widely adopted to improve their stress tolerance (Varshney et al. 2011). To add to this growing body of research, we examined the expression of EsHsp16.9 under various stress conditions by northern blot analysis (Supplementary Fig. S2 and Fig. 3). The amount of EsHsp16.9 mRNA increased rapidly and markedly under heat stress conditions (Fig. 3a). Drought stress also triggered expression of EsHsp16.9 (Fig. 3d). Expression patterns of EsHsp16.9 differed under the other stress treatments (Fig. 3b, c, e–g). The oxidative stress agents MV and H2O2 strongly induced EsHsp16.9 mRNA expression (Fig. 3h and 3i). These findings suggest that the diverse small Hsps are differentially involved in each stress condition, with EsHsp16.9 mainly playing a role in responses to heat, drought, and oxidative stress.
Characterization of EsHsp16.9 Small Hsps make up a multigene family, are classified according to their subcellular localization, and commonly act as molecular chaperones. In the completed genome of Arabidopsis, 34 small Hsps were identified and classified into five subclasses (Siddique et al. 2008). To reveal the class to which EsHsp16.9 belonged, we performed a phylogenetic analysis with Arabidopsis small Hsps (Fig. 1). As determined previously, cytosolic small Hsps are divided two classes. EsHsp16.9 showed high sequence similarity (70.9 %) with AtHsp18.1 of cytosolic class I and shared 60–70 % sequence similarity with other cytosolic class I small Hsps in Arabidopsis. We further compared EsHsp16.9 to cytosolic class I small Hsps of other plants (Fig. 2); EsHsp16.9 had the highest sequence similarity to wheat (96 %) and barley (94.7 %) and was more similar to monocots ([80 %) than to dicots (approximately 70 %). These findings are not surprising since Siberian wild rye belongs to the tribe Triticeae, which is similar to wheat (Yan et al. 2007). Expression of EsHsp16.9 in response to stress Small Hsps are dramatically induced when plants are exposed to heat stress, and these proteins accumulate
123
Expression, purification, and molecular chaperone activity of recombinant EsHsp16.9 protein The EsHsp16.9 gene was expressed in E. coli BL21 cells as GST and 6 9 His-tagged fusion proteins. To establish ideal conditions for the expression of recombinant EsHsp16.9 protein, cells harboring EsHsp16.9 were induced by different concentrations of IPTG (0, 0.2, and 1 mM) and were cultured at 18, 26, and 37 °C, after IPTG induction (data not shown). Large amounts of recombinant EsHsp16.9 protein were obtained when cells were incubated at 37 °C for 4 h after 0.2 mM IPTG induction. Recombinant EsHsp16.9 of the expected size (43.8 kDa) was highly expressed in the total fraction after IPTG induction, but it was not detected in the absence of IPTG treatment (Fig. 4). In addition, the recombinant EsHsp16.9 protein was similarly expressed in the supernatant and pellet fractions (Fig. 4a). Using the supernatant, we further purified the recombinant protein by glutathione–Sepharose 4B resin, eluted it by reduced glutathione, and separated the protein using 10 % SDS-PAGE. Large amounts of recombinant EsHsp16.9 protein (1.64 mg EsHsp16.9 protein from 250 ml liquid culture) were purified (Fig. 4b).
Biotechnol Lett
indicating that MDH was fully denatured (Fig. 5). Orchardgrass Hsp70 (DgHsp70) and bovine serum albumin (BSA) were used as a positive and negative control, respectively. DgHsp70 decreased the aggregation of MDH at a 1:0.5 molar ratio of MDH/ DgHsp70; BSA did not decrease aggregation at a 1:5 ratio of MDH/BSA. Interestingly, MDH denaturation was protected in a dose-dependent manner in the presence of EsHsp16.9. EsHsp16.9 at concentrations 5 M greater than that of MDH protected almost 90 %
Small Hsps are molecular chaperones that prevent irreversible aggregation of substrates under heat stress (Siddique et al. 2008; Vierling 1991). To characterize the functional chaperone properties of EsHsp16.9, MDH, which is one of the best-known model substrates for chaperone assays, was denatured under thermal aggregation at 45 °C and its denaturation was monitored for 15 min. In the absence of EsHsp16.9, MDH was rapidly denatured for 10 min under the heated condition, after which the curve plateaued,
20
Heat
15 10 5 0
C 3
Cold
2 1 0
0
1
6
12
24
36
0
1
Drought
9 6 3 0 0
1
6
12
24
3
1 0 12
0
8
1 0 1
6
12
24
1
24
36
9 6 3 0
Time (h) Fig. 3 Expression of EsHsp16.9 transcripts in response to abiotic stressors. Expression of EsHsp16.9 in seedlings treated with heat (a), cold (b), salt (c), drought (d), copper (e), cadmium (f), arsenate (g), methyl viologen (h) and hydrogen peroxide
6
12
Time (h)
24
36
24
36
24
36
4 2 0 1
6
12
Time (h)
MV
1
12
Cd
0
I
0
6
6
36
12
Relative Expression
2
6
1
Time (h)
As
1
2
Time (h)
Cu
0
H
0
Salt
0
36
2
36
Relative Expression
Relative Expression
3
24
F
Time (h)
G
12
Relative Expression
E Relative Expression
Relative Expression
12
6
3
Time (h)
Time (h)
D
Relative Expression
B 25
Relative Expression
Relative Expression
A
24
36
H2O2
9 6 3 0 0
1
6
12
Time (h)
(i) for 0, 1, 6, 12, 24 and 36 h. Three independent northern blot analyses were performed and the band intensity was analyzed using ImageJ. Data are mean ± SE (n = 3)
123
Biotechnol Lett
(kDa)
M T
Acquired abiotic stress tolerance by overexpression of EsHsp16.9 in E. coli
B
A
IPTG (mM)
0 S P
0.2 T
S P
70 55 40 35
Elution (kDa)
M S
1
2
3
Next, we examined abiotic stress tolerance conferred by EsHsp16.9, which showed enhanced mRNA expression under stress conditions and functional molecular chaperone activity in vitro (Figs. 3, 5). To identify stress tolerance, we used EsHsp16.9 in a prokaryotic system with the E. coli growth-inhibition assay. Cells harboring vector (pET41a, as a control) or EsHsp16.9 (pET41a:EsHsp16.9) were overexpressed by 0.2 mM IPTG (Fig. 4a) and diluted to equal cell optical density (OD) before abiotic stress treatment. Diluted cells were immediately exposed to salt, arsenate, polyethylene glycol (PEG), or heat (45 °C), and cell growth was measured hourly for 4 h. In the absence of stress, cells harboring vector or EsHsp16.9 grew similarly during the 4-h incubation (Fig. 6a). However, vector-containing cell growth was severely retarded in the presence of stressors (Fig. 6b–e). Cells harboring EsHsp16.9 grew better than those harboring vector in the presence of salt, arsenate, and PEG (Fig. 6b–d). However, under heat stress, growth of EsHsp16.9 cells was inhibited similarly to that of vector-contacting cells (Fig. 6e). Genes encoding small Hsps have been used as heat stress markers, and several small Hsps are involved in heat stress tolerance (Mu et al. 2013). Our data indicate that overexpression of EsHsp16.9 in E. coli enhanced tolerance to salt, arsenate, and PEG. We previously
70 55 40 35
Fig. 4 Expression and purification of recombinant EsHsp16.9 protein. a Expression of recombinant EsHsp16.9 protein. Cells harboring the EsHsp16.9 gene were induced by 0 or 0.2 mM isopropyl-1-thio-b-D-galactopyranoside (IPTG). Total extracts (T), supernatant (S), and pellet (P) fractions were separated in 10 % SDS-PAGE. Molecular markers (M) are represented on the left. b Purification of EsHsp16.9 protein. Supernatant fractions (S) were purified by affinity chromatography using glutathione–Sepharose 4B resin and eluted by reduced glutathione
of MDH against heat-induced denaturation. In addition, the light-scattering value of EsHsp16.9 in the absence of MDH was not increased by heat, indicating that EsHsp16.9 is a heat-stable protein. In vitro experiments have revealed that most small Hsps assemble large oligomeric states of 12–40 subunits based on dimers as building blocks. The N-terminal arm is essential for oligomerization, chaperone activity, and substrate specificity and the C-terminal extension is also involved in oligomerization (Basha et al. 2013). 0.6
Light scattering (A340)
Fig. 5 Molecular chaperone activity of recombinant EsHsp16.9 protein. Malate dehydrogenase (MDH, 0.3 lM) was incubated in the absence or presence of recombinant EsHsp16.9 protein. Various molar ratios of MDH to EsHsp16.9 were examined. Bovine serum albumin (BSA) and orchardgrass Hsp70 (DgHsp70) were used as a negative and positive control, respectively
0.4
MDH (0.3 μM) + EsHsp16.9 (1:0.3) + EsHsp16.9 (1:1)
0.2
+ EsHsp16.9 (1:3) + EsHsp16.9 (1:5) + BSA (1:5) + DgHsp70 (1:0.5) EsHsp16.9 (0.3 μM)
0 0
5
10
Time (min) at 45 °C
123
15
Biotechnol Lett
Vector EsHsp16.9
0.200
0.150
0.100
0.500
1
2
3
0.400 0.300 0.200
4
1
Cell O.D (600 nm)
Cell O.D (600 nm)
E
Vector EsHsp16.9
0.200
2
3
4
0.150 0.100 0.050
EsHsp16.9
0.500 0.400 0.300 0.200
0
1
2
3
4
Time (hr)
Time (hr)
PEG
Vector
0.100 0
Time (hr)
0.250
As
0.600
Vector EsHsp16.9
0.100 0
D
C
NaCl
0.600
Cell O.D (600 nm)
Cell O.D (600 nm)
B
Control
0.250
Cell O.D (600 nm)
A
Heat
0.200
Vector EsHsp16.9
0.180 0.160 0.140 0.120 0.100
0
1
2
3
4
0
Time (hr)
1
2
3
4
Time (hr)
Fig. 6 Stress tolerance assay in the E. coli system. E. coli cells harboring empty vector (pET-41a) and EsHsp16.9 (pET41a:EsHsp16.9) plasmids were treated with various stressors: NaCl (B, 400 mM), arsenate (C, 0.1 mM), polyethylene glycol
(D, 3 %), and heat (E, 48 °C). Cells were cultured without stress treatment (A, Control). Cell growth was monitored hourly by using a spectrophotometer (OD600), for 4 h. The results were averaged from six independent experiments
cloned mitochondrial small Hsp23 (MsHsp23) from alfalfa, and its transcripts were highly induced by heat, salt, and arsenate (Lee et al. 2012b). In addition, overexpression of MsHsp23 in E. coli and tobacco conferred salt and arsenate tolerance (Lee et al. 2012a). Taken together, these findings suggest that EsHsp16.9 confers enhanced stress tolerance to plants.
environmental stressors. Small Hsp genes are found in various organisms and act as molecular chaperones to protect cellular proteins against damage from diverse stressors; these genes also induce stress tolerance. Using a recombinant protein expression system in E. coli, we expressed and purified recombinant EsHsp16.9 protein; this protein showed molecular chaperone activity that protected thermal aggregation of malate dehydrogenase in vitro. In addition, E. coli cells expressing EsHsp16.9 showed better growth under salt, arsenate, PEG, and heat. Thus, genetic manipulation of the EsHsp16.9 gene has the potential to confer tolerance in living organisms to multiple environmental stressors.
Conclusions Siberian wild rye grass is an important forage crop in Northern Asia and has strong adaptability to unfavorable environments. Here, we screened for useful genetic materials from Elymus sibiricus by DEG analysis using the gene-fishing technique. We identified, isolated, and successfully cloned a small Hsp 16.9 (EsHsp16.9) which we categorized in the cytosolic class I subfamily. Enhanced expression of EsHsp16.9 transcripts was confirmed under various
Acknowledgments This study was carried out with the support of the ‘‘Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ008599042015)’’ of National Institute of Animal Science, Rural Development Administration, Republic of Korea.
123
Biotechnol Lett Supporting information Supplementary Figure 1—Nucleotide and deduced amino acid sequences of small Hsp16.9 (EsHsp16.9) from Siberian wild rye (Elymus sibiricus L). Supplementary Figure 2—Northern blot analysis of EsHsp16.9 transcripts in response to abiotic stressors.
References Ahuja I, de Vos RCH, Bones AM, Hall RD (2010) Plant molecular stress responses face climate change. Trends Plant Sci 15:664–674 Basha E, Jones C, Blackwell AE, Cheng G, Waters ER, Samsel KA, Siddique M, Pett V, Wysocki V, Vierling E (2013) An unusual dimeric small heat shock protein provides insight into the mechanism of this class of chaperones. J Mol Biol 425:1683–1696 Hamilton EW, Heckathom SA (2001) Mitochondrial adaptations to NaCl. Complex I is protected by anti-oxidants and small heat shock proteins, whereas complex II is protected by proline and betaine. Plant Physiol 26:1266–1274 Lee KW, Cha JY, Kim KH, Kim YG, Lee BH, Lee SH (2012a) Overexpression of alfalfa mitochondrial HSP23 in prokaryotic and eukaryotic model systems confers enhanced tolerance to salinity and arsenic stress. Biotechnol Lett 34:167–174 Lee KW, Choi GJ, Kim KY, Ji HJ, Park HS, Kim YG, Lee BH, Lee SH (2012b) Transgenic expression of MsHsp23 confers enhanced tolerance to abiotic stresses in tall fescue. Asian-Aust J Anim Sci 25:818–823 Lee KW, Kim KH, Kim YG, Lee BH, Lee SH (2012c) Identification of MsHsp23 gene using annealing control primer system. Acta Physiol Plant 34:807–811
123
Malik MK, Slovin JP, Hwang CH, Zimmerman JL (1999) Modified expression of a carrot small heat shock protein gene, hsp17.7, results in increased or decreased thermotolerance double danger. Plant J 20:89–99 Mogk A, Deuerling E, Vorderwulbecke S, Vierling E, Bukau B (2003) Small heat shock proteins, ClpB and the DnaK system form a functional triade in reversing protein aggregation. Mol Microbiol 50:585–595 Mu C, Zhang S, Yu G, Chen N, Li X, Liu H (2013) Overexpression of small heat shock protein LimHSP16.45 in Arabidopsis enhances tolerance to abiotic stresses. PLoS One 8:e82264 Sato Y, Yokoya S (2008) Enhanced tolerance to drought stress intransgenic rice plants overexpressing a small heat-shock protein, sHSP17.7. Plant Cell Rep 27:329–334 Siddique M, Gernhard S, von Koskull-Do¨ring P, Vierling E, Scharf KD (2008) The plant sHSP superfamily: five new members in Arabidopsis thaliana with unexpected properties. Cell Stress Chaperones 13:183–197 Varshney RK, Bansal KC, Aggarwal PK, Datta SK, Craufurd PQ (2011) Agricultural biotechnology for crop improvement in a variable climate: hope or hype? Trends Plant Sci 16:363–371 Vierling E (1991) The roles of heat shock proteins in plants. Ann Rev Plant Physiol Plant Mol Biol 42:579–620 Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci 9:244–252 Yan JJ, Bai SQ, Ma X, Gan YM, Zhang JB (2007) Genetic diversity of Elymus sibiricus and its breeding in China. Chin Bull Bot 24:226–231
