Plant Physiology and Biochemistry 80 (2014) 121e127
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Identification and characterization of the 14-3-3 gene family in Hevea brasiliensis Zi-Ping Yang a, b, Hui-Liang Li a, Dong Guo a, Xiao Tang a, b, Shi-Qing Peng a, b, * a
College of Agriculture, Hainan University, Haikou 570228, China Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, 4# Xueyuan Rd., Haikou 571101, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 February 2014 Accepted 29 March 2014 Available online 5 April 2014
The 14-3-3 proteins are a family of conserved phospho-specific binding proteins involved in diverse physiological processes. Although the genome-wide analysis of this family has been carried out in certain plant species, little is known about 14-3-3 protein genes in rubber tree (Hevea brasiliensis). In this study, we identified 10 14-3-3 protein genes (designated as HbGF14a to HbGF14j) in the latest rubber tree genome. A phylogenetic tree was constructed and found to demonstrate that HbGF14s can be divided into two major groups. Tissue-specific expression profiles showed that 10 HbGF14 were expressed in at least one of the tissues, which suggested that HbGF14s participated in numerous cellular processes. The 10 HbGF14s responded to jasmonic acid (JA) and ethylene (ET) treatment, which suggested that these HbGF14s were involved in response to JA and ET signaling. The target of HbGF14c protein was related to small rubber particle protein, a major rubber particle protein that is involved in rubber biosynthesis. These findings suggested that 14-3-3 proteins may be involved in the regulation of natural rubber biosynthesis. Ó 2014 Published by Elsevier Masson SAS.
Keywords: 14-3-3 protein Genome-wide analysis Hevea brasiliensis Small rubber particle protein
1. Introduction The 14-3-3 proteins form a family of highly conserved, acidic, dimeric proteins with a subunit mass of approximately 30 kDa and are involved in protein interactions mediating signal transduction pathways (Oecking and Jaspert, 2009). These 14-3-3 proteins have been identified in all investigated eukaryotic species, often in multiple isoforms. Plant 14-3-3 isoforms function by binding to phosphorylated client proteins to modulate their function (de Boer et al., 2013). Members of plant 14-3-3 proteins are widely implicated in various physiological processes (DeLille et al., 2001a; Denisona et al., 2011), such as stress responses, metabolism, signal transduction, the cell cycle, as well as in various aspects of plant growth and development (Ho et al., 2013; Szopa et al., 2003; Yang et al., 2013; Korthout and De Boer, 1998; Yoon and Kieber, 2013; Chen et al., 2013). In plants, identified putative 14-3-3
Abbreviations: BiFC, bimolecular fluorescence complementation; ET, ethylene; JA, jasmonate; SRPP, small rubber particle protein; Y2H, yeast two-hybrid. * Corresponding author. Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, 4# Xueyuan Rd., Haikou 571101, China. Tel.: þ86 898 66890670; fax: þ86 898 66890978. E-mail address: [email protected] (S.-Q. Peng). http://dx.doi.org/10.1016/j.plaphy.2014.03.034 0981-9428/Ó 2014 Published by Elsevier Masson SAS.
client proteins has exceeded 300 (Oecking and Jaspert, 2009; Chang et al., 2009; Paul et al., 2009; Schoonheim et al., 2007a; Alexander and Morris, 2006), which suggests that 14-3-3s could potentially be involved in numerous signaling pathways and physiological processes in plants. Most plants have about a dozen 14-3-3 genes that provide sequence and functional diversity, which potentially lead to specialized structures and functions within the various members of the 14-3-3 family of proteins (Paul et al., 2012). That diversity can be enlarged by selective phosphorylation of 14-3-3s at several known sites, which are variously retained among the isoforms, across the protein sites (Rosenquist et al., 2000). For example, 13 143-3 protein genes are found in Arabidopsis (DeLille et al., 2001b), 6 in cotton (Zhang et al., 2010), 8 in rice (Yao et al., 2007), 5 in barley (Schoonheim et al., 2007b), and 17 in tobacco (Konagaya et al., 2004). However, no systematic investigations of 14-3-3 families have been reported in rubber tree (Hevea brasiliensis). Rubber trees are important perennial crops that produce natural rubber, a cis 1,4-polyisoprene. Natural rubber is obtained commercially from the latex of rubber tree (Kush, 1994). Laticifers in rubber tree are the sole site for natural rubber biosynthesis and storage. Rubber biosynthesis occurs on the surface of a special type of organelle (rubber particle) in the cytoplasm (latex) of the laticifer cells (Archer and Audley, 1987). The general rubber biosynthesis
122
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
metabolic pathway has been revealed in rubber trees (Chow et al., 2007), but the molecular regulation of their natural rubber is not well-known (Wang et al., 2013; Tang et al., 2013). Therefore, the identification and functional study of regulation of natural rubber biosynthesis-related gene may elucidate the molecular mechanisms of natural rubber biosynthesis in rubber tree. In this study, data mining of rubber tree genome was performed, from which 10 14-3-3 genes were systematically identified from the genome data. To further investigate their evolutionary relationships and functions, we carried out structural and phylogenetic analyses, as well as observed the subcellular locations of these proteins. The expression profiles in various organs and response to different hormones of HbGF14s were extensively investigated, and HbGF14c interaction with small rubber particle protein (SRPP) was proven by yeast two-hybrid (Y2H) and bimolecular fluorescence complementation (BiFC) assay. The results from this work may provide a foundation for further evolutionary and functional characterization of 14-3-3 gene family in rubber trees. 2. Materials and methods 2.1. Plant materials H. brasiliensis clones RY7-33-97 were grown in the experimental farm of the Chinese Academy of Tropical Agriculture Sciences, Hainan, China. The shoots were treated by 0.5% ethrel or 0.1% methyl jasmonate, respectively, based on Hao’s method (Hao and Wu, 2000). Latex samples were collected at 1, 3, 6, 9, 24, and 48 h after treatments from 12 shoots for each interval and were immediately stored at 80 C for RNA extraction. In the latex RNA extraction, the latex was dropped directly into liquid nitrogen contained in an ice kettle. Rubber tree flowers, leaves, and barks were washed with double-distilled H2O to remove latex and then immediately frozen in liquid nitrogen.
modifications described here. Full-length HbGF14 cDNAs were inserted into the vector pCAMBIAC1302 driven by the 35S promoter and were transformed into the GV3101 strain (Agrobacterium tumefaciens) by using an electroporation system (Gene Pulser Xcell, Bio-Rad, USA). Detached onion epidermal cells were submerged in 25 mL of the bacterial suspension. The containers were covered with 0.22 mm of microfilter and transferred to a water circulating vacuum pump SHZ-III B (Shanghai, China). Infiltration vacuum pressure at 0.085 MPa was applied for 10 min and released gradually. The redundant bacterial liquid on the surface of the leaves were removed by sterile filter paper, then onion epidermal cells were placed between 2-layer sterile filter paper with MS Solid medium in dark condition at 28 C. Transient expression of GF14GFP fusions in onion epidermal cells were observed with a confocal laser scanning microscope (Zeiss LSM510, Germany). 2.5. Expression analysis Total RNA was extracted according to Tang’s method (Tang et al., 2007). First-strand cDNA was synthesized using the RevertAidÔ First-Strand cDNA Synthesis Kit (Fermentas, Lithuania). qRT-PCR was conducted with the primers (Table 2), and the rubber tree actin gene (GenBank HQ260674.1) was used as an internal control. qRT-PCR was performed using the fluorescent dye SYBR-Green (Takara, China), and the melt curve analysis of amplification products was conducted using the Stratagene Mx3005P Real-Time Thermal Cycler (Agilent, America). qRT-PCR conditions were as follows: 30 s at 95 C for denaturation, 40 cycles for 5 s at 94 C, 20 s at 56 C, and 20 s at 72 C for amplification. An average of three independent biological replicates was performed for each time. Analysis of variance (ANOVA) was used to compare the statistical difference based on Fisher’s LSD test, at a significance level of P < 0.05, P < 0.01. 2.6. Yeast two-hybrid assays
2.2. Database search and sequence conservation analysis of rubber tree 14-3-3 genes The whole genome shotgun database of rubber tree (GenBank: AJJZ01000000) (Rahman et al., 2013) and ncbi-blast-2.2.28þ-win32 software were downloaded from the National Center for Biotechnology (NCBI) (http://www.ncbi.nlm.nih.gov/). Afterwards, a local whole genome shotgun database of rubber tree was established using above software. A BLASTp search on the whole genome shotgun database was performed to detect 14-3-3 proteins in rubber tree. 2.3. Phylogenetic analysis and genomic structure Comparison and analysis of HbGF14 sequences were performed using BLAST at the NCBI. ClustalX2 (http://www.clustal.org/) was used to multi-align nucleotide acid and amino acid sequences of the 14-3-3s. A phylogenetic tree was constructed using MEGA5.2 (http://www.megasoftware.net/) from ClustalX2 alignments by neighbor-joining method. Bootstrap values were calculated from 1000 trials. The sequence information for AtGF14s and OsGF14s was retrieved from the NCBI. Genomic structures of the HbGF14 genes were analyzed by comparing the cDNA sequences using GSDS software (http://gsds.cbi.pku.edu.cn/) and the corresponding genomic DNA sequences which were extracted from the local whole genome shotgun database. 2.4. Subcellular localization of HbGF14 genes Agrobacterium-mediated transient assays were performed as described by Wang’s method (Wang et al., 2013), with a few
Yeast two-hybrid (Y2H) assays were performed using the MatchmakerÔ Gold Yeast Two-Hybrid Systems (Clontech). The open reading frame of HbGF14c and SRPP were inserted into pGBKT7 and pGADT7 vectors to create bait and prey. Then, pairs of bait and prey were co-transformed into the yeast strain AH109 by the lithium acetate method, and yeast cells were grown on DDO medium (double dropout medium, SD medium with -Trp/-Leu) according to the YeastmakerÔ Yeast Transformation System 2 User Manual (Clontech) for 3d. Transformed colonies were plated onto QDO/X/A medium (quadruple dropout medium, SD medium with -Trp/-Leu/-Ade/-His) were used to test for possible interactions between HbGF14c and SRPP according to their growth status, as well as b-galactosidase activity. For b-galactosidase assay, the co-
Table 1 Characterization of identified HbGF14 proteins. Name
HbGF14a HbGF14b HbGF14c HbGF14d HbGF14e HbGF14f HbGF14g HbGF14h HbGF14i HbGF14j
GeneBank accession (AJJZ01000000)
ORF
Protein
(bp)
aa
MW
PI
AJJZ010241816.1 AJJZ010942720.1 AJJZ010084451.1 AJJZ010277997.1 AJJZ010472055.1 AJJZ010282520.1 AJJZ010250886.1 AJJZ010581124.1 AJJZ010257177.1 AJJZ010638152.1
762 795 795 780 786 777 777 783 786 759
253 264 264 259 261 258 258 260 261 253
28,928 29,784 29,642 29,160 29,380 29,154 29,201 29,322 29,466 28,522
4.48 4.46 4.52 4.71 4.83 4.51 4.6 4.48 4.84 4.6
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
123
Table 2 The primers for qPCR analysis. Gene
Forward primer (50 e30 )
Reverse primer (50 e30 )
Hb14-3-3a Hb14-3-3b Hb14-3-3c Hb14-3-3d Hb14-3-3e Hb14-3-3f Hb14-3-3g Hb14-3-3h Hb14-3-3i Hb14-3-3j HbActin
CTTTCAGACTGGGTTCGTTGGAGA GGAGGCTTCCTGTTCTGTTCTTCTG CGCTTTGGGCTGAAGCCCTCAC ATGTGTGGAAGTGAGAAGGATGA CCAACAATGGCGCGGTAATTGT TGGTTGGTCTGACTTCCAATACCC GCATTTCTATTCCCCAAGTGCCAT AGAAGTAGCTTGGGCCACTACTCC GCTGATAAGCACCTGGAATTG TGGATGGGATTGTTTTGGCTCTTC CACCACCAGAGAGAAAGTACAG
GTCTGGAAGCATCTGCTCTGAGC TCCTCAACATCCACGGTCTTTGCA CAAGGCAAGTCCCACATCGGCA CACCTCTATGATAACCCAAATCTTCC AAAGCTGGCTATCCAAACATCAAAC TAATTCCTCAACCATGACTCTGGGA ACCAGACATAATTCTTGCTCTCCA GCTCTCTGCCACCACAACATCTTC ATCACATGGTAAAGCGATAGGA GGAGCACTGATCAATCACTCAACT GATGGACCAGACTCATCGTATTC
transformed yeast colony was grown in liquid culture, and assay was obtained according to the Yeast Protocols Handbook (protocol no. PT3024-1, Clontech Laboratories, Inc., http://www.clontech. com/) using o-nitrophenyl-b-D-galactopyranoside (ONPG) as the substrate. 2.7. Bimolecular fluorescence complementation assays To generate the constructs for BiFC assays, the open reading frames of HbGF14c and SRPP (without their stop codons) were subcloned into pSPYNE-35S (split YFP N-terminal fragment expression) and pSPYCE-35S (split YFP C-terminal fragment expression) vectors driven by the 35S promoter and were transiently co-expressed into onion epidermal cells by the GV3101 strain (Agrobacterium tumefaciens) transfection. Transformation and pre-culture was performed as previously described. Mix GV3101 strain, which transformed pSPYNE-35S-HbGF14c or pSPYCE-35S-SRPP, and the OD600, were adjusted to 0.6 with dilution buffer resuspended in infiltration buffer. The interaction of HbGF14a-YNE and SRPP-YCE in onion epidermal cells were observed with a confocal laser scanning microscope (Zeiss LSM510, Germany). Co-expressions of target genes and YFPN or YFPC were used as negative controls.
3. Results 3.1. Identification and sequence conservation of rubber tree 14-3-3 genes A total of 10 14-3-3 protein genes (named HbGFa to HbGFj) were identified from the local whole genome shotgun database of rubber tree (Rahman et al., 2013) as possible members of the HbGF14s family. The amino acid sequences of all 10 proteins were searched and blast at the NCBI to confirm putative HbGF14s from the rubber tree genome. The amino acid sequences of all 10 proteins are highly conserved, except at the N-terminal and C-terminal regions (Fig. 1). The HbGF14 proteins had calculated molecular masses ranging from 28.522 to 29.784 kD and estimated pI ranging from 4.60 to 4.84 (Table 1). 3.2. Phylogenetic analysis of the rubber tree 14-3-3s family To obtain information about the evolutionary relationship of the HbGF14s, a phylogenetic analysis was conducted on all transcribed 14-3-3s from H. brasiliensis, Arabidopsis thaliana, and Oryza sativa using protein matrices. As shown in Fig. 2, the 10 members of the HbGF14 family were subdivided into two subgroups: HbGF14a,
Fig. 1. Sequence alignment of the deduced HbGF14s. Amino acid residues that are identical in all 10 sequences are darkly shaded, while well-conserved residues are shaded in red. The a-helix (1e9) of the 14-3-3 protein is shown as a line. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
124
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
HbGF genes forming a discrete clade in the phylogenetic tree (such as HbGF14d and HbGF14e) consisted of mostly similarly sized exons with differently sized introns, or had the same size of exons but consisted of different deoxyribonucleotides of the two genes (such as HbGF14b and HbGF14c). 3.3. Subcellular localization of HbGF14s To confirm the subcellular location of HbGF14s, the HbGF14s::GFP fusion and the GFP control constructs were introduced into onion epidermal cells by particle bombardment and observed under a fluorescence microscope. HbGF14s::GFP fusion was targeted exclusively to the nucleus and cytoplasm of the onion epidermal cells, but the GFP control protein showed GFP signal throughout the cell (Fig. 4). 3.4. Expression profiles for HbGF14s in different tissues
Fig. 2. Phylogenetic tree of HbGF14 proteins. The tree was calculated based on HbGF14 protein sequences of HbGF14s; AtGF14s and OsGFs. GenBank accession numbers of selected AtWRKY proteins used for drawing phylogenetic tree: AtGF14k (AAD51783.1); AtGF14l (AAD51781.1); AtGF14c (AAA96254.1); AtGF144 (AAB62224.1); AtGF14u (AAA96253.1); AtGF14n (AAD51782.1); AtGF14y (AAB62225.1); AtGF14j (AAA96252.1); AtGF14m (AAD51784.1; AtGF14i (AAK11271.1); AtGF14o (AAG47840.1); AtGF14x (AAD51785.1); AtGF14p (NP565174.1); OsGF14a (AAO72553.1); OsGF14b (AAB07456.1); OsGF14c (AAB07457.1); OsGF14d (AAB07458.1); OsGF14e (CAB77673.1); OsGF14f (AAX95656.1); OsGF14g (BAD73105.1); OsGF14h (ABA94733).
HbGF14d, HbGF14e, HbGF14f, and HbGF14g are grouped together with the A. thaliana and O. sativa isoforms; and HbGF14b, HbbGF14c, HbGF14h, HbGF14i, and HbGF14j formed a branch together with the A. thaliana and O. sativa isoforms. We subsequently performed an exon-intron structure analysis to support the phylogeny reconstruction (Fig. 3). HbGF structure comprised 4 and 7 exons in non-epsilon and in epsilon-like group, respectively. The gene structure analysis revealed that the two
Real-time quantitative PCR was used to detect the expression patterns for all HbGF14s in the roots, barks, leaves, flowers, and the latex. Tissue-specific expression profiles showed that 10 HbGF14s were expressed in at least one of the tissues (Fig. 5). Eight genes (HbGF14a, -b, -c, -d, -f, -g, -I, and -j) were expressed in all tested tissues, although the transcript abundance of certain genes in spatial tissues was very low. HbGF14e and HbGF14h were expressed in barks, flowers, and the latex, but not in the roots and the leaves. HbGF14a, b, c, e, f, and h showed high levels of transcript abundance in latex but low levels in any other tissues, the transcript abundances of HbGF14d and -i were higher in the roots than any other tissues. By contrast, genes as HbGF14a,- b, -d,- f, and -i revealed more than 3- to 10-fold difference in expression levels of different organs, whereas HbGF14c, -e, -h and -j revealed more than 10-fold difference in expression levels. These results indicate that the HbGF14s are involved in various aspects of physiological and developmental processes. 3.5. Expression patterns of HbGF14s in the latex respond to JA and ET treatment In rubber trees, ethylene (ET) and jasmonate (JA) are the two hormones that function prominently in latex regeneration between consecutive latex exploitation (tapping) (Wu et al., 2002; Yu et al., 2007; Zhu and Zhang, 2009). Therefore, we tested whether ET and JA application had any effects on HbGF14s expression in the latex (Fig. 6). The results indicated that 10 genes responded to ET and JA
Fig. 3. Neighbor-joining phylogenetic tree, intron-exon structures, and exon length. The unrooted phylogenetic tree (the part of left side) from the HbGF14s was depicted by the MEGA 4.0 program with the NJ method. All of 10 gene’s intron-exon structures are described in the middle part. The exons are shown as boxes (open reading frame in black, untranslated region (UTR) in white), while the introns are represented by lines. The exon length of HbGF14s is indicated at a section in the right side.
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
125
identified in yeast (Fig. 7A). To further determine if HbGF14c interacted with SRPP, we examined the interaction between SRPP and HbGF14c using a bimolecular fluorescence complementation (BiFC) assay (Fig. 7B). A strong fluorescence signal was observed in the cytoplasm of onion epidermal cells expressing both pSPYNE35S-HbGF14c þ pSPYCE-35S-SRPP and pSPYNE-35S-SRPP þ pSPYCE-35S-HbGF14c fusion proteins, but not with the pSPYNE35S-HbGF14c þ pSPYCE, pSPYNE-35S-SRPP þ pSPYCE, pSPYCE-35SHbGF14c þ pSPYNE, and pSPYCE-35S-SRPP þ pSPYNE, which served as negative controls. These data confirmed the interaction of HbGF14c with SRPP. 4. Discussion
Fig. 4. Subcellular localization analysis of HbGF14s. The lower panel: corresponding bright field, fluorescence, merged fluorescence image of GFP control; the other panels: the corresponding bright field, fluorescence, merged fluorescence image of HbGF14a to HbGF14j.
treatment. HbGF14b was repressed by JA and ET, whereas the other nine HbGF14s were induced by JA and ET. 3.6. Interaction of HbGF14c with SRPP To identify interaction partners of HbGF14s in the latex, yeast two-hybrid analysis was performed using HbGF14s as bait to screen the two-hybrid library of latex cDNAs constructed on the prey vector. The interaction of SRPP, a major rubber particles protein involved in rubber biosynthesis (Oh et al., 1999), with HbGF14c was
The 14-3-3s proteins are encoded by a large multi-gene family in plants. Numerous 14-3-3s have also been identified in plants (Rosenquist et al., 2000; DeLille et al., 2001b; Zhang et al., 2010; Yao et al., 2007; Schoonheim et al., 2007b; Konagaya et al., 2004), with high sequence conservation both within and among species. Whereas a high degree of overlap is likely between the functions of the different isoforms in plants, an increasing evidence for variation exists in their affinity for certain clients, which suggests the possibility of different isoforms performing specific functions in defined processes (Paul et al., 2012; Rosenquist et al., 2000). One gene encoding 14-3-3 protein in rubber trees was the first characterized by Yang et al. (Yang et al., 2011). In this study, we identified ten 14-3-3 protein genes in the most current rubber tree genome. These HbGF14s isoforms exhibit a high cell and tissuetype specificity. The expression specificity and subcellular compartment of isoforms contribute to their diverse interactions with partners, as well as differential functions in cellular activities (Rosenquist et al., 2000). Laticifers in rubber tree are the tissues which are specific for the biosynthesis and storage of natural rubber, as well as defense against pathogens. In this study, we found that HbGF14a, b, c, e, f, and h showed high levels of transcript abundance in latex, suggesting their possible, vital role in laticifer cells. A number of 14-3-3 roles in physiological processes may be at least partly due to their effects on the regulation of hormone signaling pathways. Recent studies in Arabidopsis and rice have shown that 14-3-3s are involved in negative regulation of brassinosteroid signaling by anchoring the BRZ1 and BRZ2/BES1 transcription factors in the cytoplasm (Gampala et al., 2007; Bai et al.,
Fig. 5. Expression patterns of HbGF14s in different tissues. Relative transcript abundances of HbGF14s were examined by qRT-PCR. The Y-axis is the scale of the relative transcript abundance level, while the X-axis denotes the tissues of rubber tree. Total RNA was isolated from roots, barks, leaves, flowers, and latex, respectively. The rubber tree actin gene (GenBank HQ260674.1) was used as an internal control. The PCR primers were designed to avoid the conserved region and to amplify100 bp to 300 bp products. Primer sequences are shown in detail in Table 2.
126
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
Fig. 6. Expression patterns of HbGF14s respond to JA and ET treatment. Relative transcript abundances of HbGF14s were examined by qRT-PCR. The Y-axis is the scale of the relative transcript abundance level, while the X-axis is the time course of JA and ET treatment. The rubber tree actin gene (GenBank HQ260674.1) was used as an internal control. The significant difference was assessed by AOVA (one or two stars corresponding to P < 0.05 and P < 0.01). The PCR primers were designed to avoid the conserved region and to amplify 150 bp to 300 bp products. Primer sequences are shown in detail in Table 2.
2007). A number of recent studies have linked 14-3-3s to ABA and GA signaling (Schoonheim et al., 2007b; Ishida et al., 2004). It has been suggested that 14-3-3s are involved in cross-talk between ABA and GA pathways (Schoonheim et al., 2009). In Arabidopsis, 143-3 proteins act through a direct interaction and stabilization of 1aminocyclopropane-1-carboxylate synthase (ACS) and through decreasing the abundance of the ubiquitin ligases that target a subset of ACS proteins for degradation (Yoon and Kieber, 2013). The transcription of OsGF14b and OsGF14g were up-regulated by ET (Yao et al., 2007). These studies demonstrate that 14-3-3s are involved in ET pathways. JA treatment widely up-regulated the transcription of the rice 14-3-3 gene family in rice seedlings (Yao et al., 2007), indicating 14-3-3s are involved in JA pathways. In this work, we found that 10 HbGF14 were regulated by the ethylene and jasmonate in latex. Biosynthesis of natural rubber is enhanced in rubber trees by endogenous accumulation and exogenous application of JA (Wu et al., 2002; Yu et al., 2007). The expressions of HbGF14a, b, c, e,
f, and h were regulated by the ethylene and jasmonate, suggesting that 14-3-3 proteins may be involved in the regulation of natural rubber biosynthesis in rubber tree laticifer cells through jasmonate and ethylene signal transduction pathways. Elucidating the mechanism of rubber biosynthesis regulation by 14-3-3s may be of great interest in the future. Plant 14-3-3 isoforms function by binding to phosphorylated client proteins to modulate their function. In plants, 14-3-3 proteins have been found to regulate a variety of biological processes, such as metabolic, growth and developmental or signaling pathways, via interactions with their target proteins (DeLille et al., 2001a, 2001b; Zhang et al., 2010). Whereas numerous 14-3-3 proteineprotein interactions were identified at present (Paul et al., 2009), little is known about how the rubber tree 14-3-3 proteins regulate natural rubber biosynthesis through interacting with target proteins. Y2H and BiFC assay indicated that HbGF14c interacted with SRPP. SRPP is a major rubber particle protein involved in rubber biosynthesis
Fig. 7. Interaction between SRPP and HbGF14c in yeast and plant cells. (A) Yeast two-hybrid analysis. SRPP construct fused with a DNA binding domain (BD) and full-length HbGF14c fused with a transactivation domain (AD) were co-transformed into AH109 yeast cells. The interaction of SRPP and HbGF14c was detected using a b-galactosidase assay. (B) BiFC of SRPP and HbGF14c in transiently transformed onion epidermal cells. YC-SRPP and YN-HbGF14c or YC-HbGF14c and YN-SRPP were used as negative control. The YFP signal was observed using confocal microscopy.
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
(Oh et al., 1999). HbGF14c is proposed to participate in the regulation of natural rubber biosynthesis. This study has produced a comprehensive genomics analysis of the rubber tree 14-3-3 gene family and has provided the first steps towards the selection of Hb14GFs for cloning and functional dissection, which can be used in further studies to uncover their roles in the regulation of natural rubber biosynthesis in rubber trees. Identifying the mechanism of rubber biosynthesis regulation by Hb14GFs will be of great future interest. Author contributions Conceived and designed the experiments: Shi-Qing Peng; performed the experiments: Zi-Ping Yang, Hui-liang Li, Dong Guo; analyzed the data: Zi-Ping Yang, Shi-Qing Peng; contributed reagents/materials/analysis tools: Xiao Tang; wrote the manuscript: Zi-Ping Yang, Shi-Qing Peng. Acknowledgments This research was supported by National Natural Science Foundation of China (No. 31170634), the National Nonprofit Institute Research Grant of ITBB (110205) and Major Technology Project of Hainan (ZDZX2013023-1). References Alexander, R.D., Morris, P.C., 2006. A proteomic analysis of 14-3-3 binding proteins from developing barley grains. Proteomics 6, 1886e1896. Archer, B.L., Audley, B.G., 1987. New aspects of rubber biosynthesis. Bot. J. Linn. Soc. 94, 181e196. Bai, M.Y., Zhang, L.Y., Gampala, S.S., Zhu, S.W., Song, W.Y., Chong, K., Wang, Z.Y., 2007. Functions of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. Proc. Natl. Acad. Sci. U S A 104, 13839e13844. Chang, I.F., Curran, A., Woolsey, R., Quilici, D., Cushman, J.C., Mittler, R., Harmon, A., Harper, J.F., 2009. Proteomic profiling of tandem affinity purified 14-3-3 protein complexes in Arabidopsis thaliana. Proteomics 9, 2967e2985. Chen, Q., Guo, C.L., Wang, P., Chen, X.Q., Wu, K.H., Li, K.Z., Yu, Y.X., Chen, L.M., 2013. Up-regulation and interaction of the plasma membrane Hþ-ATPase and the 143-3 protein are involved in the regulation of citrate exudation from the broad bean (Vicia faba L.) under Al stress. Plant Physiol. Biochem. 70, 504e511. Chow, K.S., Wan, K.L., Mat, I.M.N., Bahari, A., Tan, S.H., Harikrishna, K., Yeang, H.Y., 2007. Insights into rubber biosynthesis from transcriptome analysis of Hevea brasiliensis latex. J. Exp. Bot. 58, 2429e2440. de Boer, A.H., van Kleeff, P.J., Gao, J., 2013. Plant 14-3-3 proteins as spiders in a web of phosphorylation. Protoplasma 250, 425e440. DeLille, J.M., Sehnke, P.C., Ferl, R.J., 2001. The Arabidopsis 14-3-3 family of signaling regulators. Plant Physiol. 126, 35e38. DeLille, J.M., Sehnke, P.C., Ferl, R.J., 2001. The arabidopsis 14-3-3 family of signaling regulators. Plant Physiol. 126, 35e38. Denisona, F.C., Paula, A., Zupanskaa, A.K., Fer, R.J., 2011. 14-3-3 proteins in plant physiology. Semiin Cell. Dev. Biol. 22, 720e727. Gampala, S.S., Kim, T.W., He, J.X., Tang, W., Deng, Z., Bai, M.Y., Guan, S., Lalonde, S., Sun, Y., Shibagaki, N., Ferl, R.J., Ehrhardt, D., Chong, K., Burlingame, A.L., Wang, Z.Y., 2007. An essential role for 14-3-3 proteins in brassinosteroid signal transduction in Arabidopsis. Dev. Cell. 13, 177e189. Hao, B.Z., Wu, J.L., 2000. Laticifer differentiation in Hevea brasiliensis: induction by exogenous jasmonic acid and linolenic acid. Ann. Bot. 85, 37e43. Ho, S.L., Huang, L.F., Lu, C.A., He, S.L., Wang, C.C., Yu, S.P., Chen, J., Yu, S.M., 2013. Sugar starvation- and GA-inducible calcium-dependent protein kinase 1 feedback regulates GA biosynthesis and activates a 14-3-3 protein to confer drought tolerance in rice seedlings. Plant Mol. Biol. 81, 347e361. Ishida, S., Fukazawa, J., Yuasa, T., Takahashi, Y., 2004. Involvement of 14-3-3 signaling protein binding in the functional regulation of the transcriptional activator repression of shoot growth by gibberellins. Plant Cell. 16, 2641e2651.
127
Konagaya, K., Matsushita, Y., Kasahara, M., Nyunoya, H., 2004. Members of 14-3-3 protein isoforms interacting with the resistance gene product N and the elicitor of tobacco mosaic virus. J. Gen. Plant. Pathol. 70, 221e231. Korthout, H.A.A.J., De Boer, A.H., 1998. Plant plasma membrane 14-3-3 proteins differ in solubility and form fusicoccin-dependent complexes. Plant Physiol. Biochem. 36, 357e365. Kush, A., 1994. Isoprenoid biosynthesis: the Hevea factory. Plant Physiol. Biochem. 32, 761e767. Oecking, C., Jaspert, N., 2009. Plant 14-3-3 proteins catch up with their mammalian orthologs. Curr. Opin. Plant Biol. 12, 760e765. Oh, S.K., Kang, H., Shin, D.H., Yang, J., Chow, K.S., Yeang, H.Y., Wagner, B., Breiteneder, H., Han, K.H., 1999. Isolation, characterization, and functional analysis of a novel cDNA clone encoding a small rubber particle protein from Hevea brasiliensis. J. Biol. Chem. 274, 17132e17138. Paul, A.L., Liu, L., Laughner, B., McClung, S., Chen, S., Ferl, R., 2009. Comparative interactomics: analysis of Arabidopsis 14-3-3 complexes reveals highly conserved 14-3-3 interactions between humans and plants. J. Proteome Res. 8, 1913e1924. Paul, A.L., Denison, F.C., Schultz, E.R., Zupanska, A.K., Ferl, R.J., 2012. 14-3-3 Phosphoprotein interaction networksedoes isoform diversity present functional interaction specification? Front. Plant Sci. 3, 190. Rahman, A.Y.A., Usharraj, A.O., Misra, B.B., Thottathil, G.P., Jayasekaran, K., Feng, Y., Hou, S., Ong, S.Y., Ng, F.L., Lee, L.S., Tan, H.S., Sakaff, M.K.L.M., Teh, B.S., Khoo, B.F., Badai, S.S., Aziz, N.A., Yuryev, A., Knudsen, B., Dionne-Laporte, A., Mchunu, N.P., Yu, Q., Langston, B.J., Freitas, T.A.K., Young, A.G., Chen, R., Wang, L., Najimudin, N., Saito, J.A., Alam, M., 2013. Draft genome sequence of the rubber tree (Hevea brasiliensis). BMC Genomics 14, 75. Rosenquist, M., Sehnke, P., Ferl, R.J., Sommarin, M., Larsson, C., 2000. Evolution of the 14-3-3 protein family: does the large number of isoforms in multicellular organisms reflect functional specificity? J. Mol. Evol. 51, 446e458. Schoonheim, P.J., Veiga, H., Pereira Dda, C., Friso, G., van Wijk, K.J., de Boer, A.H., 2007. A comprehensive analysis of the 14-3-3 interactome in barley leaves using a complementary proteomics and two-hybrid approach. Plant Physiol. 143, 670e683. Schoonheim, P.J., Sinnige, M.P., Casaretto, J.A., Veiga, H., Bunney, T.D., Quatrano, R.S., de Boer, A.H., 2007. 14-3-3 adaptor proteins are intermediates in ABA signal transduction during barley seed germination. Plant J. 49, 289e301. Schoonheim, P.J., Costa Pereira, D.D., de Boer, A.H., 2009. Dual role for 14-3-3 proteins and ABF transcription factors in gibberellic acid and abscisic acid signalling in barley (Hordeum vulgare) aleurone cells. Plant Cell. Environ. 32, 439e447. Szopa, J., qukaszewicz, M., Aksamit, A., Korobczak, A., Kwiatkowska, D., 2003. Structural organisation, expression, and promoter analysis of a 16R isoform of 14-3-3 protein gene from potato. Plant Physiol. Biochem. 41, 417e423. Tang, C., Qi, J., Li, H., Zhang, C., Wang, Y., 2007. A convenient and efficient protocol for isolating high-quality RNA from latex of Hevea brasiliensis (para rubber tree). J. Biochem. Biophys. Methods 70, 749e754. Tang, C., Xiao, X., Li, H., Fan, Y., Yang, J., Qi, J., Li, H., 2013. Comparative analysis of latex transcriptome reveals putative molecular mechanisms underlying super productivity of Hevea brasiliensis. PLoS ONE 8, e75307. Wang, Y., Guo, D., Li, H.L., Peng, S.Q., 2013. Characterization of HbWRKY1, a WRKY transcription factor from Hevea brasiliensis that negatively regulates HbSRPP. Plant Physiol. Biochem. 71, 283e289. Wu, J.L., Hao, B.Z., Tan, H.Y., 2002. Wound-induced differentiation in Hevea brasiliensis shoots mediated by jasmonic acid. J. Rubber Res. 5, 53e63. Yang, Z.P., Li, H.L., Guo, D., Tian, W.M., Peng, S.Q., 2011. Molecular characterization of a novel 14-3-3 protein gene (Hb14-3-3c) from Hevea brasiliensis. Mol. Biol. Rep. 39, 4491e4497. Yang, J.L., Chen, W.W., Chen, L.Q., Qin, C., Jin, C.W., Shi, Y.Z., Zheng, S.J., 2013. The 143-3 protein GENERAL REGULATORY FACTOR11 (GRF11) acts downstream of nitric oxide to regulate iron acquisition in Arabidopsis thaliana. New. Phytol. 197, 815e824. Yao, Y., Du, Y., Jiang, L., Liu, J.Y., 2007. Molecular analysis and expression patterns of the 14-3-3 gene family from Oryza sativa. J. Biochem. Mol. Biol. 40, 349e357. Yoon, G.M., Kieber, J.J., 2013. 14-3-3 regulates 1-aminocyclopropane-1-carboxylate synthase protein turnover in Arabidopsis. Plant Cell. 25, 1016e1028. Yu, J.H., Yang, S.G., Huang, M.J., Tian, W.M., 2007. Effects of season, exploitation and exogenous jasmonic acid on the laticifer differentiation in mature rubber tree. Chin. J. Trop. Crops 28, 1e5. Zhang, Z.T., Zhou, Y., Li, Y., Shao, S.Q., Li, B.Y., Shi, H.Y., Li, X.B., 2010. Interactome analysis of the six cotton 14-3-3s that are preferentially expressed in fibres and involved in cell elongation. J. Exp. Bot. 61, 3331e3344. Zhu, J., Zhang, Z., 2009. Ethylene stimulation of latex production in Hevea brasiliensis. Plant Signal Behav. 4, 1e3.
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Identification and characterization of the 14-3-3 gene family in Hevea brasiliensis Zi-Ping Yang a, b, Hui-Liang Li a, Dong Guo a, Xiao Tang a, b, Shi-Qing Peng a, b, * a
College of Agriculture, Hainan University, Haikou 570228, China Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, 4# Xueyuan Rd., Haikou 571101, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 February 2014 Accepted 29 March 2014 Available online 5 April 2014
The 14-3-3 proteins are a family of conserved phospho-specific binding proteins involved in diverse physiological processes. Although the genome-wide analysis of this family has been carried out in certain plant species, little is known about 14-3-3 protein genes in rubber tree (Hevea brasiliensis). In this study, we identified 10 14-3-3 protein genes (designated as HbGF14a to HbGF14j) in the latest rubber tree genome. A phylogenetic tree was constructed and found to demonstrate that HbGF14s can be divided into two major groups. Tissue-specific expression profiles showed that 10 HbGF14 were expressed in at least one of the tissues, which suggested that HbGF14s participated in numerous cellular processes. The 10 HbGF14s responded to jasmonic acid (JA) and ethylene (ET) treatment, which suggested that these HbGF14s were involved in response to JA and ET signaling. The target of HbGF14c protein was related to small rubber particle protein, a major rubber particle protein that is involved in rubber biosynthesis. These findings suggested that 14-3-3 proteins may be involved in the regulation of natural rubber biosynthesis. Ó 2014 Published by Elsevier Masson SAS.
Keywords: 14-3-3 protein Genome-wide analysis Hevea brasiliensis Small rubber particle protein
1. Introduction The 14-3-3 proteins form a family of highly conserved, acidic, dimeric proteins with a subunit mass of approximately 30 kDa and are involved in protein interactions mediating signal transduction pathways (Oecking and Jaspert, 2009). These 14-3-3 proteins have been identified in all investigated eukaryotic species, often in multiple isoforms. Plant 14-3-3 isoforms function by binding to phosphorylated client proteins to modulate their function (de Boer et al., 2013). Members of plant 14-3-3 proteins are widely implicated in various physiological processes (DeLille et al., 2001a; Denisona et al., 2011), such as stress responses, metabolism, signal transduction, the cell cycle, as well as in various aspects of plant growth and development (Ho et al., 2013; Szopa et al., 2003; Yang et al., 2013; Korthout and De Boer, 1998; Yoon and Kieber, 2013; Chen et al., 2013). In plants, identified putative 14-3-3
Abbreviations: BiFC, bimolecular fluorescence complementation; ET, ethylene; JA, jasmonate; SRPP, small rubber particle protein; Y2H, yeast two-hybrid. * Corresponding author. Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, 4# Xueyuan Rd., Haikou 571101, China. Tel.: þ86 898 66890670; fax: þ86 898 66890978. E-mail address: [email protected] (S.-Q. Peng). http://dx.doi.org/10.1016/j.plaphy.2014.03.034 0981-9428/Ó 2014 Published by Elsevier Masson SAS.
client proteins has exceeded 300 (Oecking and Jaspert, 2009; Chang et al., 2009; Paul et al., 2009; Schoonheim et al., 2007a; Alexander and Morris, 2006), which suggests that 14-3-3s could potentially be involved in numerous signaling pathways and physiological processes in plants. Most plants have about a dozen 14-3-3 genes that provide sequence and functional diversity, which potentially lead to specialized structures and functions within the various members of the 14-3-3 family of proteins (Paul et al., 2012). That diversity can be enlarged by selective phosphorylation of 14-3-3s at several known sites, which are variously retained among the isoforms, across the protein sites (Rosenquist et al., 2000). For example, 13 143-3 protein genes are found in Arabidopsis (DeLille et al., 2001b), 6 in cotton (Zhang et al., 2010), 8 in rice (Yao et al., 2007), 5 in barley (Schoonheim et al., 2007b), and 17 in tobacco (Konagaya et al., 2004). However, no systematic investigations of 14-3-3 families have been reported in rubber tree (Hevea brasiliensis). Rubber trees are important perennial crops that produce natural rubber, a cis 1,4-polyisoprene. Natural rubber is obtained commercially from the latex of rubber tree (Kush, 1994). Laticifers in rubber tree are the sole site for natural rubber biosynthesis and storage. Rubber biosynthesis occurs on the surface of a special type of organelle (rubber particle) in the cytoplasm (latex) of the laticifer cells (Archer and Audley, 1987). The general rubber biosynthesis
122
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
metabolic pathway has been revealed in rubber trees (Chow et al., 2007), but the molecular regulation of their natural rubber is not well-known (Wang et al., 2013; Tang et al., 2013). Therefore, the identification and functional study of regulation of natural rubber biosynthesis-related gene may elucidate the molecular mechanisms of natural rubber biosynthesis in rubber tree. In this study, data mining of rubber tree genome was performed, from which 10 14-3-3 genes were systematically identified from the genome data. To further investigate their evolutionary relationships and functions, we carried out structural and phylogenetic analyses, as well as observed the subcellular locations of these proteins. The expression profiles in various organs and response to different hormones of HbGF14s were extensively investigated, and HbGF14c interaction with small rubber particle protein (SRPP) was proven by yeast two-hybrid (Y2H) and bimolecular fluorescence complementation (BiFC) assay. The results from this work may provide a foundation for further evolutionary and functional characterization of 14-3-3 gene family in rubber trees. 2. Materials and methods 2.1. Plant materials H. brasiliensis clones RY7-33-97 were grown in the experimental farm of the Chinese Academy of Tropical Agriculture Sciences, Hainan, China. The shoots were treated by 0.5% ethrel or 0.1% methyl jasmonate, respectively, based on Hao’s method (Hao and Wu, 2000). Latex samples were collected at 1, 3, 6, 9, 24, and 48 h after treatments from 12 shoots for each interval and were immediately stored at 80 C for RNA extraction. In the latex RNA extraction, the latex was dropped directly into liquid nitrogen contained in an ice kettle. Rubber tree flowers, leaves, and barks were washed with double-distilled H2O to remove latex and then immediately frozen in liquid nitrogen.
modifications described here. Full-length HbGF14 cDNAs were inserted into the vector pCAMBIAC1302 driven by the 35S promoter and were transformed into the GV3101 strain (Agrobacterium tumefaciens) by using an electroporation system (Gene Pulser Xcell, Bio-Rad, USA). Detached onion epidermal cells were submerged in 25 mL of the bacterial suspension. The containers were covered with 0.22 mm of microfilter and transferred to a water circulating vacuum pump SHZ-III B (Shanghai, China). Infiltration vacuum pressure at 0.085 MPa was applied for 10 min and released gradually. The redundant bacterial liquid on the surface of the leaves were removed by sterile filter paper, then onion epidermal cells were placed between 2-layer sterile filter paper with MS Solid medium in dark condition at 28 C. Transient expression of GF14GFP fusions in onion epidermal cells were observed with a confocal laser scanning microscope (Zeiss LSM510, Germany). 2.5. Expression analysis Total RNA was extracted according to Tang’s method (Tang et al., 2007). First-strand cDNA was synthesized using the RevertAidÔ First-Strand cDNA Synthesis Kit (Fermentas, Lithuania). qRT-PCR was conducted with the primers (Table 2), and the rubber tree actin gene (GenBank HQ260674.1) was used as an internal control. qRT-PCR was performed using the fluorescent dye SYBR-Green (Takara, China), and the melt curve analysis of amplification products was conducted using the Stratagene Mx3005P Real-Time Thermal Cycler (Agilent, America). qRT-PCR conditions were as follows: 30 s at 95 C for denaturation, 40 cycles for 5 s at 94 C, 20 s at 56 C, and 20 s at 72 C for amplification. An average of three independent biological replicates was performed for each time. Analysis of variance (ANOVA) was used to compare the statistical difference based on Fisher’s LSD test, at a significance level of P < 0.05, P < 0.01. 2.6. Yeast two-hybrid assays
2.2. Database search and sequence conservation analysis of rubber tree 14-3-3 genes The whole genome shotgun database of rubber tree (GenBank: AJJZ01000000) (Rahman et al., 2013) and ncbi-blast-2.2.28þ-win32 software were downloaded from the National Center for Biotechnology (NCBI) (http://www.ncbi.nlm.nih.gov/). Afterwards, a local whole genome shotgun database of rubber tree was established using above software. A BLASTp search on the whole genome shotgun database was performed to detect 14-3-3 proteins in rubber tree. 2.3. Phylogenetic analysis and genomic structure Comparison and analysis of HbGF14 sequences were performed using BLAST at the NCBI. ClustalX2 (http://www.clustal.org/) was used to multi-align nucleotide acid and amino acid sequences of the 14-3-3s. A phylogenetic tree was constructed using MEGA5.2 (http://www.megasoftware.net/) from ClustalX2 alignments by neighbor-joining method. Bootstrap values were calculated from 1000 trials. The sequence information for AtGF14s and OsGF14s was retrieved from the NCBI. Genomic structures of the HbGF14 genes were analyzed by comparing the cDNA sequences using GSDS software (http://gsds.cbi.pku.edu.cn/) and the corresponding genomic DNA sequences which were extracted from the local whole genome shotgun database. 2.4. Subcellular localization of HbGF14 genes Agrobacterium-mediated transient assays were performed as described by Wang’s method (Wang et al., 2013), with a few
Yeast two-hybrid (Y2H) assays were performed using the MatchmakerÔ Gold Yeast Two-Hybrid Systems (Clontech). The open reading frame of HbGF14c and SRPP were inserted into pGBKT7 and pGADT7 vectors to create bait and prey. Then, pairs of bait and prey were co-transformed into the yeast strain AH109 by the lithium acetate method, and yeast cells were grown on DDO medium (double dropout medium, SD medium with -Trp/-Leu) according to the YeastmakerÔ Yeast Transformation System 2 User Manual (Clontech) for 3d. Transformed colonies were plated onto QDO/X/A medium (quadruple dropout medium, SD medium with -Trp/-Leu/-Ade/-His) were used to test for possible interactions between HbGF14c and SRPP according to their growth status, as well as b-galactosidase activity. For b-galactosidase assay, the co-
Table 1 Characterization of identified HbGF14 proteins. Name
HbGF14a HbGF14b HbGF14c HbGF14d HbGF14e HbGF14f HbGF14g HbGF14h HbGF14i HbGF14j
GeneBank accession (AJJZ01000000)
ORF
Protein
(bp)
aa
MW
PI
AJJZ010241816.1 AJJZ010942720.1 AJJZ010084451.1 AJJZ010277997.1 AJJZ010472055.1 AJJZ010282520.1 AJJZ010250886.1 AJJZ010581124.1 AJJZ010257177.1 AJJZ010638152.1
762 795 795 780 786 777 777 783 786 759
253 264 264 259 261 258 258 260 261 253
28,928 29,784 29,642 29,160 29,380 29,154 29,201 29,322 29,466 28,522
4.48 4.46 4.52 4.71 4.83 4.51 4.6 4.48 4.84 4.6
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
123
Table 2 The primers for qPCR analysis. Gene
Forward primer (50 e30 )
Reverse primer (50 e30 )
Hb14-3-3a Hb14-3-3b Hb14-3-3c Hb14-3-3d Hb14-3-3e Hb14-3-3f Hb14-3-3g Hb14-3-3h Hb14-3-3i Hb14-3-3j HbActin
CTTTCAGACTGGGTTCGTTGGAGA GGAGGCTTCCTGTTCTGTTCTTCTG CGCTTTGGGCTGAAGCCCTCAC ATGTGTGGAAGTGAGAAGGATGA CCAACAATGGCGCGGTAATTGT TGGTTGGTCTGACTTCCAATACCC GCATTTCTATTCCCCAAGTGCCAT AGAAGTAGCTTGGGCCACTACTCC GCTGATAAGCACCTGGAATTG TGGATGGGATTGTTTTGGCTCTTC CACCACCAGAGAGAAAGTACAG
GTCTGGAAGCATCTGCTCTGAGC TCCTCAACATCCACGGTCTTTGCA CAAGGCAAGTCCCACATCGGCA CACCTCTATGATAACCCAAATCTTCC AAAGCTGGCTATCCAAACATCAAAC TAATTCCTCAACCATGACTCTGGGA ACCAGACATAATTCTTGCTCTCCA GCTCTCTGCCACCACAACATCTTC ATCACATGGTAAAGCGATAGGA GGAGCACTGATCAATCACTCAACT GATGGACCAGACTCATCGTATTC
transformed yeast colony was grown in liquid culture, and assay was obtained according to the Yeast Protocols Handbook (protocol no. PT3024-1, Clontech Laboratories, Inc., http://www.clontech. com/) using o-nitrophenyl-b-D-galactopyranoside (ONPG) as the substrate. 2.7. Bimolecular fluorescence complementation assays To generate the constructs for BiFC assays, the open reading frames of HbGF14c and SRPP (without their stop codons) were subcloned into pSPYNE-35S (split YFP N-terminal fragment expression) and pSPYCE-35S (split YFP C-terminal fragment expression) vectors driven by the 35S promoter and were transiently co-expressed into onion epidermal cells by the GV3101 strain (Agrobacterium tumefaciens) transfection. Transformation and pre-culture was performed as previously described. Mix GV3101 strain, which transformed pSPYNE-35S-HbGF14c or pSPYCE-35S-SRPP, and the OD600, were adjusted to 0.6 with dilution buffer resuspended in infiltration buffer. The interaction of HbGF14a-YNE and SRPP-YCE in onion epidermal cells were observed with a confocal laser scanning microscope (Zeiss LSM510, Germany). Co-expressions of target genes and YFPN or YFPC were used as negative controls.
3. Results 3.1. Identification and sequence conservation of rubber tree 14-3-3 genes A total of 10 14-3-3 protein genes (named HbGFa to HbGFj) were identified from the local whole genome shotgun database of rubber tree (Rahman et al., 2013) as possible members of the HbGF14s family. The amino acid sequences of all 10 proteins were searched and blast at the NCBI to confirm putative HbGF14s from the rubber tree genome. The amino acid sequences of all 10 proteins are highly conserved, except at the N-terminal and C-terminal regions (Fig. 1). The HbGF14 proteins had calculated molecular masses ranging from 28.522 to 29.784 kD and estimated pI ranging from 4.60 to 4.84 (Table 1). 3.2. Phylogenetic analysis of the rubber tree 14-3-3s family To obtain information about the evolutionary relationship of the HbGF14s, a phylogenetic analysis was conducted on all transcribed 14-3-3s from H. brasiliensis, Arabidopsis thaliana, and Oryza sativa using protein matrices. As shown in Fig. 2, the 10 members of the HbGF14 family were subdivided into two subgroups: HbGF14a,
Fig. 1. Sequence alignment of the deduced HbGF14s. Amino acid residues that are identical in all 10 sequences are darkly shaded, while well-conserved residues are shaded in red. The a-helix (1e9) of the 14-3-3 protein is shown as a line. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
124
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
HbGF genes forming a discrete clade in the phylogenetic tree (such as HbGF14d and HbGF14e) consisted of mostly similarly sized exons with differently sized introns, or had the same size of exons but consisted of different deoxyribonucleotides of the two genes (such as HbGF14b and HbGF14c). 3.3. Subcellular localization of HbGF14s To confirm the subcellular location of HbGF14s, the HbGF14s::GFP fusion and the GFP control constructs were introduced into onion epidermal cells by particle bombardment and observed under a fluorescence microscope. HbGF14s::GFP fusion was targeted exclusively to the nucleus and cytoplasm of the onion epidermal cells, but the GFP control protein showed GFP signal throughout the cell (Fig. 4). 3.4. Expression profiles for HbGF14s in different tissues
Fig. 2. Phylogenetic tree of HbGF14 proteins. The tree was calculated based on HbGF14 protein sequences of HbGF14s; AtGF14s and OsGFs. GenBank accession numbers of selected AtWRKY proteins used for drawing phylogenetic tree: AtGF14k (AAD51783.1); AtGF14l (AAD51781.1); AtGF14c (AAA96254.1); AtGF144 (AAB62224.1); AtGF14u (AAA96253.1); AtGF14n (AAD51782.1); AtGF14y (AAB62225.1); AtGF14j (AAA96252.1); AtGF14m (AAD51784.1; AtGF14i (AAK11271.1); AtGF14o (AAG47840.1); AtGF14x (AAD51785.1); AtGF14p (NP565174.1); OsGF14a (AAO72553.1); OsGF14b (AAB07456.1); OsGF14c (AAB07457.1); OsGF14d (AAB07458.1); OsGF14e (CAB77673.1); OsGF14f (AAX95656.1); OsGF14g (BAD73105.1); OsGF14h (ABA94733).
HbGF14d, HbGF14e, HbGF14f, and HbGF14g are grouped together with the A. thaliana and O. sativa isoforms; and HbGF14b, HbbGF14c, HbGF14h, HbGF14i, and HbGF14j formed a branch together with the A. thaliana and O. sativa isoforms. We subsequently performed an exon-intron structure analysis to support the phylogeny reconstruction (Fig. 3). HbGF structure comprised 4 and 7 exons in non-epsilon and in epsilon-like group, respectively. The gene structure analysis revealed that the two
Real-time quantitative PCR was used to detect the expression patterns for all HbGF14s in the roots, barks, leaves, flowers, and the latex. Tissue-specific expression profiles showed that 10 HbGF14s were expressed in at least one of the tissues (Fig. 5). Eight genes (HbGF14a, -b, -c, -d, -f, -g, -I, and -j) were expressed in all tested tissues, although the transcript abundance of certain genes in spatial tissues was very low. HbGF14e and HbGF14h were expressed in barks, flowers, and the latex, but not in the roots and the leaves. HbGF14a, b, c, e, f, and h showed high levels of transcript abundance in latex but low levels in any other tissues, the transcript abundances of HbGF14d and -i were higher in the roots than any other tissues. By contrast, genes as HbGF14a,- b, -d,- f, and -i revealed more than 3- to 10-fold difference in expression levels of different organs, whereas HbGF14c, -e, -h and -j revealed more than 10-fold difference in expression levels. These results indicate that the HbGF14s are involved in various aspects of physiological and developmental processes. 3.5. Expression patterns of HbGF14s in the latex respond to JA and ET treatment In rubber trees, ethylene (ET) and jasmonate (JA) are the two hormones that function prominently in latex regeneration between consecutive latex exploitation (tapping) (Wu et al., 2002; Yu et al., 2007; Zhu and Zhang, 2009). Therefore, we tested whether ET and JA application had any effects on HbGF14s expression in the latex (Fig. 6). The results indicated that 10 genes responded to ET and JA
Fig. 3. Neighbor-joining phylogenetic tree, intron-exon structures, and exon length. The unrooted phylogenetic tree (the part of left side) from the HbGF14s was depicted by the MEGA 4.0 program with the NJ method. All of 10 gene’s intron-exon structures are described in the middle part. The exons are shown as boxes (open reading frame in black, untranslated region (UTR) in white), while the introns are represented by lines. The exon length of HbGF14s is indicated at a section in the right side.
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
125
identified in yeast (Fig. 7A). To further determine if HbGF14c interacted with SRPP, we examined the interaction between SRPP and HbGF14c using a bimolecular fluorescence complementation (BiFC) assay (Fig. 7B). A strong fluorescence signal was observed in the cytoplasm of onion epidermal cells expressing both pSPYNE35S-HbGF14c þ pSPYCE-35S-SRPP and pSPYNE-35S-SRPP þ pSPYCE-35S-HbGF14c fusion proteins, but not with the pSPYNE35S-HbGF14c þ pSPYCE, pSPYNE-35S-SRPP þ pSPYCE, pSPYCE-35SHbGF14c þ pSPYNE, and pSPYCE-35S-SRPP þ pSPYNE, which served as negative controls. These data confirmed the interaction of HbGF14c with SRPP. 4. Discussion
Fig. 4. Subcellular localization analysis of HbGF14s. The lower panel: corresponding bright field, fluorescence, merged fluorescence image of GFP control; the other panels: the corresponding bright field, fluorescence, merged fluorescence image of HbGF14a to HbGF14j.
treatment. HbGF14b was repressed by JA and ET, whereas the other nine HbGF14s were induced by JA and ET. 3.6. Interaction of HbGF14c with SRPP To identify interaction partners of HbGF14s in the latex, yeast two-hybrid analysis was performed using HbGF14s as bait to screen the two-hybrid library of latex cDNAs constructed on the prey vector. The interaction of SRPP, a major rubber particles protein involved in rubber biosynthesis (Oh et al., 1999), with HbGF14c was
The 14-3-3s proteins are encoded by a large multi-gene family in plants. Numerous 14-3-3s have also been identified in plants (Rosenquist et al., 2000; DeLille et al., 2001b; Zhang et al., 2010; Yao et al., 2007; Schoonheim et al., 2007b; Konagaya et al., 2004), with high sequence conservation both within and among species. Whereas a high degree of overlap is likely between the functions of the different isoforms in plants, an increasing evidence for variation exists in their affinity for certain clients, which suggests the possibility of different isoforms performing specific functions in defined processes (Paul et al., 2012; Rosenquist et al., 2000). One gene encoding 14-3-3 protein in rubber trees was the first characterized by Yang et al. (Yang et al., 2011). In this study, we identified ten 14-3-3 protein genes in the most current rubber tree genome. These HbGF14s isoforms exhibit a high cell and tissuetype specificity. The expression specificity and subcellular compartment of isoforms contribute to their diverse interactions with partners, as well as differential functions in cellular activities (Rosenquist et al., 2000). Laticifers in rubber tree are the tissues which are specific for the biosynthesis and storage of natural rubber, as well as defense against pathogens. In this study, we found that HbGF14a, b, c, e, f, and h showed high levels of transcript abundance in latex, suggesting their possible, vital role in laticifer cells. A number of 14-3-3 roles in physiological processes may be at least partly due to their effects on the regulation of hormone signaling pathways. Recent studies in Arabidopsis and rice have shown that 14-3-3s are involved in negative regulation of brassinosteroid signaling by anchoring the BRZ1 and BRZ2/BES1 transcription factors in the cytoplasm (Gampala et al., 2007; Bai et al.,
Fig. 5. Expression patterns of HbGF14s in different tissues. Relative transcript abundances of HbGF14s were examined by qRT-PCR. The Y-axis is the scale of the relative transcript abundance level, while the X-axis denotes the tissues of rubber tree. Total RNA was isolated from roots, barks, leaves, flowers, and latex, respectively. The rubber tree actin gene (GenBank HQ260674.1) was used as an internal control. The PCR primers were designed to avoid the conserved region and to amplify100 bp to 300 bp products. Primer sequences are shown in detail in Table 2.
126
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
Fig. 6. Expression patterns of HbGF14s respond to JA and ET treatment. Relative transcript abundances of HbGF14s were examined by qRT-PCR. The Y-axis is the scale of the relative transcript abundance level, while the X-axis is the time course of JA and ET treatment. The rubber tree actin gene (GenBank HQ260674.1) was used as an internal control. The significant difference was assessed by AOVA (one or two stars corresponding to P < 0.05 and P < 0.01). The PCR primers were designed to avoid the conserved region and to amplify 150 bp to 300 bp products. Primer sequences are shown in detail in Table 2.
2007). A number of recent studies have linked 14-3-3s to ABA and GA signaling (Schoonheim et al., 2007b; Ishida et al., 2004). It has been suggested that 14-3-3s are involved in cross-talk between ABA and GA pathways (Schoonheim et al., 2009). In Arabidopsis, 143-3 proteins act through a direct interaction and stabilization of 1aminocyclopropane-1-carboxylate synthase (ACS) and through decreasing the abundance of the ubiquitin ligases that target a subset of ACS proteins for degradation (Yoon and Kieber, 2013). The transcription of OsGF14b and OsGF14g were up-regulated by ET (Yao et al., 2007). These studies demonstrate that 14-3-3s are involved in ET pathways. JA treatment widely up-regulated the transcription of the rice 14-3-3 gene family in rice seedlings (Yao et al., 2007), indicating 14-3-3s are involved in JA pathways. In this work, we found that 10 HbGF14 were regulated by the ethylene and jasmonate in latex. Biosynthesis of natural rubber is enhanced in rubber trees by endogenous accumulation and exogenous application of JA (Wu et al., 2002; Yu et al., 2007). The expressions of HbGF14a, b, c, e,
f, and h were regulated by the ethylene and jasmonate, suggesting that 14-3-3 proteins may be involved in the regulation of natural rubber biosynthesis in rubber tree laticifer cells through jasmonate and ethylene signal transduction pathways. Elucidating the mechanism of rubber biosynthesis regulation by 14-3-3s may be of great interest in the future. Plant 14-3-3 isoforms function by binding to phosphorylated client proteins to modulate their function. In plants, 14-3-3 proteins have been found to regulate a variety of biological processes, such as metabolic, growth and developmental or signaling pathways, via interactions with their target proteins (DeLille et al., 2001a, 2001b; Zhang et al., 2010). Whereas numerous 14-3-3 proteineprotein interactions were identified at present (Paul et al., 2009), little is known about how the rubber tree 14-3-3 proteins regulate natural rubber biosynthesis through interacting with target proteins. Y2H and BiFC assay indicated that HbGF14c interacted with SRPP. SRPP is a major rubber particle protein involved in rubber biosynthesis
Fig. 7. Interaction between SRPP and HbGF14c in yeast and plant cells. (A) Yeast two-hybrid analysis. SRPP construct fused with a DNA binding domain (BD) and full-length HbGF14c fused with a transactivation domain (AD) were co-transformed into AH109 yeast cells. The interaction of SRPP and HbGF14c was detected using a b-galactosidase assay. (B) BiFC of SRPP and HbGF14c in transiently transformed onion epidermal cells. YC-SRPP and YN-HbGF14c or YC-HbGF14c and YN-SRPP were used as negative control. The YFP signal was observed using confocal microscopy.
Z.-P. Yang et al. / Plant Physiology and Biochemistry 80 (2014) 121e127
(Oh et al., 1999). HbGF14c is proposed to participate in the regulation of natural rubber biosynthesis. This study has produced a comprehensive genomics analysis of the rubber tree 14-3-3 gene family and has provided the first steps towards the selection of Hb14GFs for cloning and functional dissection, which can be used in further studies to uncover their roles in the regulation of natural rubber biosynthesis in rubber trees. Identifying the mechanism of rubber biosynthesis regulation by Hb14GFs will be of great future interest. Author contributions Conceived and designed the experiments: Shi-Qing Peng; performed the experiments: Zi-Ping Yang, Hui-liang Li, Dong Guo; analyzed the data: Zi-Ping Yang, Shi-Qing Peng; contributed reagents/materials/analysis tools: Xiao Tang; wrote the manuscript: Zi-Ping Yang, Shi-Qing Peng. Acknowledgments This research was supported by National Natural Science Foundation of China (No. 31170634), the National Nonprofit Institute Research Grant of ITBB (110205) and Major Technology Project of Hainan (ZDZX2013023-1). References Alexander, R.D., Morris, P.C., 2006. A proteomic analysis of 14-3-3 binding proteins from developing barley grains. Proteomics 6, 1886e1896. Archer, B.L., Audley, B.G., 1987. New aspects of rubber biosynthesis. Bot. J. Linn. Soc. 94, 181e196. Bai, M.Y., Zhang, L.Y., Gampala, S.S., Zhu, S.W., Song, W.Y., Chong, K., Wang, Z.Y., 2007. Functions of OsBZR1 and 14-3-3 proteins in brassinosteroid signaling in rice. Proc. Natl. Acad. Sci. U S A 104, 13839e13844. Chang, I.F., Curran, A., Woolsey, R., Quilici, D., Cushman, J.C., Mittler, R., Harmon, A., Harper, J.F., 2009. Proteomic profiling of tandem affinity purified 14-3-3 protein complexes in Arabidopsis thaliana. Proteomics 9, 2967e2985. Chen, Q., Guo, C.L., Wang, P., Chen, X.Q., Wu, K.H., Li, K.Z., Yu, Y.X., Chen, L.M., 2013. Up-regulation and interaction of the plasma membrane Hþ-ATPase and the 143-3 protein are involved in the regulation of citrate exudation from the broad bean (Vicia faba L.) under Al stress. Plant Physiol. Biochem. 70, 504e511. Chow, K.S., Wan, K.L., Mat, I.M.N., Bahari, A., Tan, S.H., Harikrishna, K., Yeang, H.Y., 2007. Insights into rubber biosynthesis from transcriptome analysis of Hevea brasiliensis latex. J. Exp. Bot. 58, 2429e2440. de Boer, A.H., van Kleeff, P.J., Gao, J., 2013. Plant 14-3-3 proteins as spiders in a web of phosphorylation. Protoplasma 250, 425e440. DeLille, J.M., Sehnke, P.C., Ferl, R.J., 2001. The Arabidopsis 14-3-3 family of signaling regulators. Plant Physiol. 126, 35e38. DeLille, J.M., Sehnke, P.C., Ferl, R.J., 2001. The arabidopsis 14-3-3 family of signaling regulators. Plant Physiol. 126, 35e38. Denisona, F.C., Paula, A., Zupanskaa, A.K., Fer, R.J., 2011. 14-3-3 proteins in plant physiology. Semiin Cell. Dev. Biol. 22, 720e727. Gampala, S.S., Kim, T.W., He, J.X., Tang, W., Deng, Z., Bai, M.Y., Guan, S., Lalonde, S., Sun, Y., Shibagaki, N., Ferl, R.J., Ehrhardt, D., Chong, K., Burlingame, A.L., Wang, Z.Y., 2007. An essential role for 14-3-3 proteins in brassinosteroid signal transduction in Arabidopsis. Dev. Cell. 13, 177e189. Hao, B.Z., Wu, J.L., 2000. Laticifer differentiation in Hevea brasiliensis: induction by exogenous jasmonic acid and linolenic acid. Ann. Bot. 85, 37e43. Ho, S.L., Huang, L.F., Lu, C.A., He, S.L., Wang, C.C., Yu, S.P., Chen, J., Yu, S.M., 2013. Sugar starvation- and GA-inducible calcium-dependent protein kinase 1 feedback regulates GA biosynthesis and activates a 14-3-3 protein to confer drought tolerance in rice seedlings. Plant Mol. Biol. 81, 347e361. Ishida, S., Fukazawa, J., Yuasa, T., Takahashi, Y., 2004. Involvement of 14-3-3 signaling protein binding in the functional regulation of the transcriptional activator repression of shoot growth by gibberellins. Plant Cell. 16, 2641e2651.
127
Konagaya, K., Matsushita, Y., Kasahara, M., Nyunoya, H., 2004. Members of 14-3-3 protein isoforms interacting with the resistance gene product N and the elicitor of tobacco mosaic virus. J. Gen. Plant. Pathol. 70, 221e231. Korthout, H.A.A.J., De Boer, A.H., 1998. Plant plasma membrane 14-3-3 proteins differ in solubility and form fusicoccin-dependent complexes. Plant Physiol. Biochem. 36, 357e365. Kush, A., 1994. Isoprenoid biosynthesis: the Hevea factory. Plant Physiol. Biochem. 32, 761e767. Oecking, C., Jaspert, N., 2009. Plant 14-3-3 proteins catch up with their mammalian orthologs. Curr. Opin. Plant Biol. 12, 760e765. Oh, S.K., Kang, H., Shin, D.H., Yang, J., Chow, K.S., Yeang, H.Y., Wagner, B., Breiteneder, H., Han, K.H., 1999. Isolation, characterization, and functional analysis of a novel cDNA clone encoding a small rubber particle protein from Hevea brasiliensis. J. Biol. Chem. 274, 17132e17138. Paul, A.L., Liu, L., Laughner, B., McClung, S., Chen, S., Ferl, R., 2009. Comparative interactomics: analysis of Arabidopsis 14-3-3 complexes reveals highly conserved 14-3-3 interactions between humans and plants. J. Proteome Res. 8, 1913e1924. Paul, A.L., Denison, F.C., Schultz, E.R., Zupanska, A.K., Ferl, R.J., 2012. 14-3-3 Phosphoprotein interaction networksedoes isoform diversity present functional interaction specification? Front. Plant Sci. 3, 190. Rahman, A.Y.A., Usharraj, A.O., Misra, B.B., Thottathil, G.P., Jayasekaran, K., Feng, Y., Hou, S., Ong, S.Y., Ng, F.L., Lee, L.S., Tan, H.S., Sakaff, M.K.L.M., Teh, B.S., Khoo, B.F., Badai, S.S., Aziz, N.A., Yuryev, A., Knudsen, B., Dionne-Laporte, A., Mchunu, N.P., Yu, Q., Langston, B.J., Freitas, T.A.K., Young, A.G., Chen, R., Wang, L., Najimudin, N., Saito, J.A., Alam, M., 2013. Draft genome sequence of the rubber tree (Hevea brasiliensis). BMC Genomics 14, 75. Rosenquist, M., Sehnke, P., Ferl, R.J., Sommarin, M., Larsson, C., 2000. Evolution of the 14-3-3 protein family: does the large number of isoforms in multicellular organisms reflect functional specificity? J. Mol. Evol. 51, 446e458. Schoonheim, P.J., Veiga, H., Pereira Dda, C., Friso, G., van Wijk, K.J., de Boer, A.H., 2007. A comprehensive analysis of the 14-3-3 interactome in barley leaves using a complementary proteomics and two-hybrid approach. Plant Physiol. 143, 670e683. Schoonheim, P.J., Sinnige, M.P., Casaretto, J.A., Veiga, H., Bunney, T.D., Quatrano, R.S., de Boer, A.H., 2007. 14-3-3 adaptor proteins are intermediates in ABA signal transduction during barley seed germination. Plant J. 49, 289e301. Schoonheim, P.J., Costa Pereira, D.D., de Boer, A.H., 2009. Dual role for 14-3-3 proteins and ABF transcription factors in gibberellic acid and abscisic acid signalling in barley (Hordeum vulgare) aleurone cells. Plant Cell. Environ. 32, 439e447. Szopa, J., qukaszewicz, M., Aksamit, A., Korobczak, A., Kwiatkowska, D., 2003. Structural organisation, expression, and promoter analysis of a 16R isoform of 14-3-3 protein gene from potato. Plant Physiol. Biochem. 41, 417e423. Tang, C., Qi, J., Li, H., Zhang, C., Wang, Y., 2007. A convenient and efficient protocol for isolating high-quality RNA from latex of Hevea brasiliensis (para rubber tree). J. Biochem. Biophys. Methods 70, 749e754. Tang, C., Xiao, X., Li, H., Fan, Y., Yang, J., Qi, J., Li, H., 2013. Comparative analysis of latex transcriptome reveals putative molecular mechanisms underlying super productivity of Hevea brasiliensis. PLoS ONE 8, e75307. Wang, Y., Guo, D., Li, H.L., Peng, S.Q., 2013. Characterization of HbWRKY1, a WRKY transcription factor from Hevea brasiliensis that negatively regulates HbSRPP. Plant Physiol. Biochem. 71, 283e289. Wu, J.L., Hao, B.Z., Tan, H.Y., 2002. Wound-induced differentiation in Hevea brasiliensis shoots mediated by jasmonic acid. J. Rubber Res. 5, 53e63. Yang, Z.P., Li, H.L., Guo, D., Tian, W.M., Peng, S.Q., 2011. Molecular characterization of a novel 14-3-3 protein gene (Hb14-3-3c) from Hevea brasiliensis. Mol. Biol. Rep. 39, 4491e4497. Yang, J.L., Chen, W.W., Chen, L.Q., Qin, C., Jin, C.W., Shi, Y.Z., Zheng, S.J., 2013. The 143-3 protein GENERAL REGULATORY FACTOR11 (GRF11) acts downstream of nitric oxide to regulate iron acquisition in Arabidopsis thaliana. New. Phytol. 197, 815e824. Yao, Y., Du, Y., Jiang, L., Liu, J.Y., 2007. Molecular analysis and expression patterns of the 14-3-3 gene family from Oryza sativa. J. Biochem. Mol. Biol. 40, 349e357. Yoon, G.M., Kieber, J.J., 2013. 14-3-3 regulates 1-aminocyclopropane-1-carboxylate synthase protein turnover in Arabidopsis. Plant Cell. 25, 1016e1028. Yu, J.H., Yang, S.G., Huang, M.J., Tian, W.M., 2007. Effects of season, exploitation and exogenous jasmonic acid on the laticifer differentiation in mature rubber tree. Chin. J. Trop. Crops 28, 1e5. Zhang, Z.T., Zhou, Y., Li, Y., Shao, S.Q., Li, B.Y., Shi, H.Y., Li, X.B., 2010. Interactome analysis of the six cotton 14-3-3s that are preferentially expressed in fibres and involved in cell elongation. J. Exp. Bot. 61, 3331e3344. Zhu, J., Zhang, Z., 2009. Ethylene stimulation of latex production in Hevea brasiliensis. Plant Signal Behav. 4, 1e3.
