GENE-40167; No. of pages: 7; 4C: Gene xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xylostella: Possible involvement in resistance to beta-cypermethrin Xi'en Chen, Yalin Zhang ⁎ Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, College of Plant Protection, Northwest A&F University, Yangling, Shaanxi 712100, China
a r t i c l e
i n f o
Article history: Received 13 June 2014 Received in revised form 20 October 2014 Accepted 25 December 2014 Available online xxxx Keywords: Cytochrome P450 enzyme systems Overexpression Resistance Plutella xylostella
a b s t r a c t NADPH–cytochrome P450 reductase (CPR) and cytochrome b5 (b5) are essential for cytochrome P450 mediated biological reactions. CPR and b5 in several insects have been found to be associated with insecticide resistance. However, CPR and b5 in the diamondback moth (DBM), Plutella xylostella, are not characterized and their roles remain undefined. A full-length cDNA of CPR encoding 678 amino acids and a full-length cDNA of b5 encoding 127 amino acids were cloned from DBM. Their deduced amino acid sequences shared high identities with those of other insects and showed characteristics of classical CPRs and b5s, respectively. The mRNAs of both genes were detectable in all developmental stages with the highest expression levels occurring in the 4th instar larvae. Tissue-specific expression analysis showed that their transcripts were most abundant in gut. Transcripts of CPR and b5 in the beta-cypermethrin resistant DBM strain were 13.2- and 2.84-fold higher than those in the beta-cypermethrin susceptible strain, respectively. The expression levels of CPR and b5 were enhanced by beta-cypermethrin at the concentration of 12 mg L−1 (~LC10). The results indicate that CPR and b5 may play essential roles in the P450 mediated resistance of DBM to beta-cypermethrin or even other insecticides. © 2014 Published by Elsevier B.V.
1. Introduction The diamondback moth (DBM), Plutella xylostella, is a worldwide distribution pest damaging crucifer vegetables which causes over 1 billion USD lost annually (Furlong et al., 2013; Talekar and Shelton, 1993). To date, its control remains mainly relying on the use of chemical insecticides. However, due to the frequent and unreasonable use of insecticides, as well as its polyvoltine characteristics and wide overlap of generations, DBM has developed resistance to N90 insecticides (APRD, 2014; Furlong et al., 2013). The enzymatic detoxification is considered as the major mechanism of DBM resistance to various insecticides. Cytochrome P450 monooxygenases (P450s), a superfamily of ancient enzymes that play dominant roles in the oxidative metabolism of endogenous compounds and xenobiotics (Feyereisen, 1999), have been suggested to be involved in DBM field resistance to organophosphates, pyrethroids, indoxacarb, avermectins, and benzoylureas (Eziah et al., 2009; Iqbal and Wright, 1997).
Abbreviations: DBM, diamondback moth; CPR, NADPH–cytochrome P450 reductase; b5, cytochrome b5; P450s, cytochrome P450 monooxygenases; RT-qPCR, real-time quantitative polymerase chain reaction; RACE, rapid amplification of cDNA ends; NCBI, National Center for Biotechnology Information; ANOVA, analysis of variance. ⁎ Corresponding author. E-mail address: [email protected] (Y. Zhang).
Generally, during the P450-dependent metabolic process, two electrons are required. The first one or both are considered to be transferred from NADPH by NADPH-dependent cytochrome P450 reductase (CPR) (Gan et al., 2009). The second one is thought to be transferred by cytochrome b5 (b5) in some cases (Porter, 2002; Zhang et al., 2005). Both two enzymes, playing crucial roles in supporting the P450 metabolic system, have been identified to be associated with insecticide resistance in several insects. In Helicoverpa armigera, the induction and over-expression patterns of b5 were identical to those of CYP6B7 indicating its involvement in the CYP6B7-mediated pyrethroid resistance (Ranasinghe and Hobbs, 1999a). A recent study showed that the susceptibility of H. armigera to fenvalerate was significantly enhanced after knockdown of CYP6B7 together with CPR and b5 (Tang et al., 2012). Knockdown of CPR also resulted in the reduced deltamethrin resistance in Cimex lectularius (Zhu et al., 2012), and the increased susceptibility to imidacloprid and beta-cypermethrin in Nilaparvata lugens (Liu et al., 2014), respectively. To our knowledge, although sequences of CPR and b5 cDNAs of many insects are available on NCBI database, only a few CPRs from several species of insects, including Musca domestica (Koener et al., 1993), Drosophila melanogaster (Hovemann et al., 1997), Bombyx mori (Horike et al., 2000), Mamestra brassicae (Maibeche-Coisne et al., 2005), Anopheles gambiae (Lycett et al., 2006), Anopheles minimus (Kaewpa et al., 2007), C. lectularius (Zhu et al., 2012), Chilo suppressalis (Liu et al., 2013), H. armigera (Zhao et al., 2014), and N. lugens (Liu et al., 2014), have
http://dx.doi.org/10.1016/j.gene.2014.12.053 0378-1119/© 2014 Published by Elsevier B.V.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
2
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
been characterized. And reports about insect b5 were even fewer. There is no report concerning the sequences and functions of CPR and b5, as well as their interactions with individual P450 in DBM. In this work, the fulllength cDNAs of CPR and b5 from DBM were cloned and characterized. Their transcriptional levels at different developmental stages and in various tissues were investigated. The transcriptional responses of CPR and b5 to beta-cypermethrin, as well as their expression profiles in betacypermethrin population were examined. The present study may provide a foundation for further investigation to uncover the functions of CPR and b5 in the P450-mediated beta-cypermethrin or other insecticide resistance in DBM. 2. Materials and methods 2.1. Insects An insecticide-susceptible strain of DBM (L-SS) with an LC50 value of 48.9 mg L−1 for beta-cypermethrin was initially obtained from a culture at the Biorational Pesticides Research and Development Center, Northwest A&F University, Shaanxi, China, has been maintained in the laboratory for N5 years without exposure to insecticides. A field strain of DBM (TBRS) was originally collected from cabbage field in Tai Bai county, Shaanxi, China, in August 2013, and showed an LC50 value of 7.92 g L−1 for betacypermethrin with the resistance ratio about 162-fold. The two strains were reared on Pak choi cabbage seedlings at 25 ± 2 °C, 50% relative humidity and with a photoperiod of 16:8 (light:dark) in the laboratory. Newly molted moths were collected and supplied with 5% honey solution as nutrients and permitted to oviposition on moist gauze sterilized with a 1% sodium hypochlorite solution. 2.2. Beta-cypermethrin treatment Beta-cypermethrin (purity ≥ 95%, Jingchun Co. Ltd., Shanghai, China) was diluted in acetone to produce a stock solution and was further diluted to 12 mg L−1 (~LC10) and 50 mg L−1 (~LC50) by 0.5‰ Triton X-100 solution, respectively. Newly molted 4th instar larvae of L-SS were selected and starved for 4 h. The leaf-dipping method was employed (Baek et al., 2010). Fresh radish leaves were dipped into the beta-cypermethrin solutions for 10–15 s and air dried at room temperature, then fed to the starved larvae. Larvae that fed with radish leaves treated with solution in the absence of beta-cypermethrin were taken as the controls. All larvae collected after 2 h, 6 h, 12 h, and 24 h posttreatment were snap frozen in liquid nitrogen and then stored at −80 °C. 2.3. Total RNA isolation and cDNA synthesis Total RNA was extracted from different developmental stages, (egg, 1st to 4th instar larvae, pupae and adult) and various tissues (head, gut, epidermis, and hemolymph) of the 4th instar larvae using RNAiso Plus (TaKaRa, Dalian, China) following the manual instructions. For real-time quantitative polymerase chain reaction (RT-qPCR) analysis, cDNAs were synthesized from 1.0 μg RNA using PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). For amplification of CPR and b5, cDNAs were synthesized from the 4th instar larvae RNA using 5′-Full RACE Kit and 3′-Full RACE Core Set (TaKaRa, Dalian, China), respectively. All cDNAs were stored at −20 °C until use. 2.4. Cloning of full-length cDNA of CPR and b5 Using the full-length cDNA of H. armigera CPR (accession: HM347785) and b5 (accession: AF061105) as probes, we blasted the genomic and transcriptomic database for DBM (KONAGAbase) (Jouraku et al., 2013). The fragments of DBM CPR and b5 were obtained. Fulllength sequences were cloned by rapid amplification of cDNA ends PCR (RACE-PCR) with universal primers supplied in the RACE kits and
specific primers listed in Table 1 according to the manual instructions. The open reading frames (ORFs) of DBM CPR and b5 were amplified and confirmed by PCR using corresponding specific primers (Table 1). All PCR products were cloned into pMD19-T vectors (TaKaRa, Dalian, China) and transformed into Escherichia coli DH5α cells and then sequenced (AuGCT, Inc., Beijing, China).
2.5. Sequence analysis of CPR and b5 The full-length cDNAs of DBM CPR and b5 were assembled using the Contig Express program suite Vector NTI6.0 (InforMax, Frederick, MD, USA), and the ORFs were obtained by ORF Finder (http://www.ncbi. nlm.nih.gov/gorf/gorf.html). The ExPASy Compute pI/Mw tool, (http:// web.expasy.org/compute_pi/), was used to predict the molecular weight and isoelectric point of the deduced amino acid sequence. Sequence similarities were analyzed by using BLAST programs (http:// www.ncbi.nlm.gov/blast/). The N-terminal signal peptide and transmembrane domain were predicted by using SignalP 4.0 server (http:// www.cbs.dtu.dk/services/SignalP/) and TMHMM Server 2.0 (http:// www.cbs.dtu.dk/services/TMHMM-2.0/), respectively. For the analysis of protein domains, the InterProScan 4 from EMBL-EBI (http://www. ebi.ac.uk/Tools/pfa/iprscan/) was used to search the InterPro collection of protein signature databases. The phylogenetic trees were conducted by the neighbor-joining method with bootstrap test of 1000 replicates using MEGA 5.0 software (Tamura et al., 2011).
2.6. RT-qPCR analysis All primers used in RT-qPCR reactions were designed by Primer3 (http://www.simgene.com/Primer3) and listed in Table 1. Using 100fold diluted cDNAs as templates, RT-qPCR was performed on an iCycler iQ5 real-time PCR detection system (Bio-Rad, Philadelphia, PA, USA) using the UltraSYBR mixture (CWBIO, Beijing, China) according to the manual's instructions. Thermal cycling conditions were as follows: 95 °C for 10 min, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. This was followed by a dissociation analysis to confirm the homogeneity of the PCR product. The actin gene (accession: JN410820) was used as a reference. The RT-qPCR was repeated three times for each gene. Each replicate was performed with an independent RNA sample preparation and consisted of three technical replicates. The comparative Ct method was used to assess the different expression levels of DBM CPR and b5 (Livak and Schmittgen, 2001). Table 1 Primers used in this work. Gene
Primer name
Sequence (5′–3′)
Function
CPR
CPR-5R CGGCGGGCAACATCCAGGTGAC 5′-RACE CPR-3R ACCTGCTCGGCAACCAGAACGC 3′-RACE CPR-F CATATGCACCATCACCATTCGGAGGACCTCGCGCA ORF amplification CPR-R AAGCTTCTAGCTCCACACGTCGGCGGAG – CPR-qF CTCTCGACGACGTGTTTTCA RT-qPCR analysis CPR-qR TGGTATAACGCCTTGCCTTC – b5 b5-5R GGCGTTCCTGGACGACCACCCG 5′-RACE b5-3R CCTCCGACTGCTTCCACGACAT 3′-RACE b5-F CATATGCACCATCACCATACCA ORF CGGAGTTCACGCG amplification b5-R AAGCTTTCACCCGAACAGATAGAAGTAG – b5-qF TCATCATCATCGACAACGTG RT-qPCR analysis b5-qR GAACTGCAGCATCCAGTCG – β-Actin qF GCGACTTGACCGACTACC RT-qPCR analysis qR GGAATGAGGGCTGGAACA –
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
2.7. Statistical analyses All data were presented as mean ± standard error (SE) and analyzed by one-way ANOVA with least significant difference test among multiple groups or analyzed by Student's t-test (two-tailed paired t-test) between two groups using SAS software (v9.1, SAS Institute Inc., Gary, NC). The level of significance was set at P b 0.05. 3. Results 3.1. Cloning and sequence analysis of DBM CPR and b5 Based on the cDNA fragments of DBM CPR and b5 from KONAGAbase, we carried out the RACE-PCR and obtained the fulllength cDNAs of these two genes. Nucleotide sequence analysis revealed that the complete cDNA of DBM CPR has a 5′-untranslated region (5′UTR) of 172 bp, a 3′-untranslated region (3′-UTR) of 485 bp, and an open reading frame (ORF) of 2037 bp which encodes a protein of 678 aa, with the theoretical pI of 5.59 and calculated molecular weight of 76,314.50 Da; the full-length cDNA of DBM b5 owns a 66 bp 5′-UTR, a 305 bp 3′-UTR, and an 384 bp ORF encoding a protein of 127 aa, with the theoretical pI of 4.54 and calculated molecular weight of 13,719.34 Da. The cDNA sequences of DBM CPR and b5 have been deposited in the GenBank database with the accession numbers of KJ767015 and KJ767014, respectively. The DBM CPR protein possesses the characteristic motifs of insect CPR, including the FMN, FAD, and NADPH binding domains (Fig. 1A). The 15 amino acid residues interacting with non-covalently bound heme are identical or highly conserved in insect b5 proteins (Fig. 1B). No signal peptide was found in the secondary structures of these two proteins, however, an N-terminal transmembrane region and a Cterminal transmembrane region were observed in CRP and b5, respectively (Fig. 1). The transmembrane region in these two proteins may function as an anchor involved in location on the membrane of the endoplasmic reticulum. BLAST analysis of deduced amino acid sequence of DBM CPR on NCBI revealed its high similarities with CPRs from other insect species. It shared
3
81%, 80%, 79%, 76%, 68%, and 67% to CPR of H. armigera (ADK25060), Spodoptera littoralis (AFP20584), C. suppressalis (AGM20565), B. mori (NP_001104834), D. melanogaster (NP_477158), and Tribolium castaneum (XP_971174), respectively. DBM b5 possessed 52%, 47%, 44%, 42%, and 39% to b5 of B. mori (NP_001106739), H. armigera (ADU02195), D. melanogaster (NP_610294), Culex quinquefasciatus (XP_001867082) and T. castaneum (XP_974294), respectively. Both DBM CPR and b5 showed higher identities to those of Lepidoptera insects than to those of other insects, and the phylogenetic trees revealed that CPR from Lepidoptera insects formed a cluster (Fig. 2A), however, Danaus plexippus and Papilio polytes b5s formed a cluster and other Lepidoptera insects b5s fell into another cluster (Fig. 2B). 3.2. Developmental- and tissue-specific expression profiles of DBM CPR and b5 To determine the developmental variation and tissue distribution of DBM CPR and b5, their relative transcriptional levels among various tissues and life stages were investigated by qPCR. The results showed that the expression levels of CPR were varied through the whole life stages, with the highest level occurring in the 4th instar larvae and the lowest level founded in eggs. The transcripts of b5 were low in eggs, but gradually increased from eggs to the 4th instar larvae, and then decreased in pupae and adults (Fig. 3A). The tissue-dependent expression patterns of CPR and b5 were determined in four tissues, including head, hemolymph, gut, and cuticle. The results clearly revealed that transcripts of both genes were most abundant in gut. CPR mRNA was not detected, and b5 mRNA was nearly undetectable in cuticle, respectively. In hemolymph, their expression levels were all lower than those in gut, but were all higher than those in head (Fig. 3B). Our results indicated that CPR and b5 may have similar transcriptional profiles in various tissues. 3.3. Transcripts of DBM CPR and b5 in L-SS and TB-RS In order to uncover whether the CPR and b5 are associated with betacypermethrin resistance, their expression levels in the 4th instar larvae
Fig. 1. Alignment of the deduced amino acid sequences of CPR (A) and b5 (B). Pxyl: Plutella xylostella; Harm: Helicoverpa armigera; Bmor: Bombyx mori; Mdom: Musca domestica; Agam: Anopheles gambiae.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
4
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
Fig. 2. The polygenetic tree of DBM CPR (A) and b5 (B) with those of other insects. Bootstrap values are shown on each node. DBM CPR and b5 are marked by solid circles.
of L-SS and TB-RS were monitored. Our result showed that the transcripts of CPR and b5 were both significantly more abundant in TB-RS than those in L-SS, with the increases of 13.2- and 2.84-fold, respectively, indicating their potential involvement in beta-cypermethrin resistance (Fig. 4). 3.4. Effect of beta-cypermethrin on DBM CPR and b5 expression LC10 and LC50 amounts of beta-cypermethrin were used to challenge the expression of DBM CPR and b5, respectively. The mRNA levels of CPR were induced by 1.8- to 3.01-fold at different intervals exposed to LC10 concentration of beta-cypermethrin. LC50 amount of betacypermethrin only enhanced CPR expression by 1.5-fold at 6 h of treatment. Transcriptions of b5 were increased by 1.77- to 1.92-fold after 6–24 h of 12 mg L−1 beta-cypermethrin treatment. Its expression was significantly augmented by 1.78-fold at 2 h, and then recovered to normal levels at 6–24 h after treated with 50 mg L−1 beta-cypermethrin (Fig. 5). 4. Discussion The P450-mediated metabolism is a common mechanism by which insects become resistant to insecticides as evidenced by the numerous insect species and insecticides affected (Li et al., 2007; Scott, 1999). The classic catalytic reaction of P450s is based on heterolytic cleavage of dioxygen resulting in hydroxylation of the substrate and simulation formation of water. In this process, CPR is indispensable in transferring the electron(s) from NADPH to P450s (Hannemann et al., 2007; Laursen et al., 2011; Porter, 2002), and b5 may stimulate, inhibit or have no effects on the P450-catalyzed reactions depending on the individual P450s, type of substrate, and reaction conditions (Porter, 2002; Schenkman and Jansson, 1999, 2003). Understanding the functions of insect CPR and b5 in the detoxification of insecticides and other xenobiotics metabolized by P450 systems would be helpful to further reveal the mechanism of insecticide resistance, as well as may facilitate the identification of new targets for insecticides. In this study, a CPR cDNA and a b5 cDNA were isolated from DBM. Multiple alignment analysis showed high identities of their deduced amino acid sequences with other insect CPRs and b5s, respectively. Structure analysis revealed that the DBM CPR contained a hydrophobic N-terminal transmembrane domain which functions as membrane
anchor (Lamb et al., 2006; Wang et al., 1997), and a hydrophilic Cterminal catalytic domain comprising three distinct binding domains for FMN, FAD, and NADPH (Fig. 1A). The FMN binding domain in DBM CRP, with two binding sites interacting with the redox-partner binding site of the P450s (Lamb et al., 2006), is conserved among those in CPRs of other organisms (Horike et al., 2000; Liu et al., 2013; Mizutani and Ohta, 1998; Zhao et al., 2014). The complete function loss of yeast (Saccharomyces cerevisiae) CPR toward CYP51 was observed when the residues Thr 71 and Asp 187 in FMN binding sites were mutated to Ala (Lamb et al., 2006). It was suggested that a hydride ion derived from NADPH was transferred to FAD, and then FAD passed electrons to FMN, from where they were delivered to P450s or other acceptor proteins (Oprian and Coon, 1982; Vermilion et al., 1981). The CPR anchored on the membrane of the endoplasmic reticulum by its N-terminal hydrophobic segment which makes its remainder facing the cytoplasmic side of the membrane is important to allow electron transfer between the CPR and P450s (Pandey et al., 2007; Tang et al., 2001; Wang et al., 1997). The DBM b5 consisted of a conserved N-terminal heme binding site that was crucial for its function, and a hydrophobic C-terminal transmembrane domain anchoring it to the membrane of the endoplasmic reticulum. Fifteen residues that are involved in the heme binding (Lee et al., 1990), as well as thirteen residues constituted the “b5 fold” (Mathews, 1985), were highly conserved among b5s of divergent insect species. An identical residue proline in the transmembrane domains of various b5s was thought to be involved in the cis/trans conformation of the membrane anchor (Fig. 1B) (Vergeres and Waskell, 1995). Our results showed that both DBM CPR and b5 were structurally related to those of other species indicating that they possess similar functions with the known CPRs and b5s. And the small cluster formed by CPRs from Lepidoptera insects in the polygenetic trees indicated their close evolutionary relationship (Fig. 2A). The relative low identities in the amino acid sequences of b5s from Lepidoptera insects might explain why they could not be included in a single cluster (Fig. 2B). Some known insect CPR and b5 displayed variable expression profiles across developmental stages. The mRNA of H. armigera CPR was detected in all life stages (egg stage excluded), with the highest level occurring in the 5th instar larvae and the lowest level presenting in pupae (Zhao et al., 2014). In C. suppressalis, the CPR mRNA transcription was most abundantly expressed in adults, and the lowest expressed in the 3rd instar larvae (Liu et al., 2013). The N. lugens CPR showed fluctuated expression levels through different developmental stages. The
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
5
Fig. 3. Relative expression levels of DBM CPR and b5 at different developmental stages (A) and in various tissues (B). The relative levels of DBM CPR and b5 expression at different developmental stages and in various tissues were normalized to the level in the egg and head, respectively. Data are presented as mean ± SE; different letters denote a significant difference among different samples (P b 0.05, one-way ANOVA).
highest transcription was found in the 1st instar larvae and the lowest transcription was observed in adults (Liu et al., 2014). We found that DBM CPR was expressed at various degrees from eggs to adults. It seems that CPRs form different insect species have diverse expression profiles in the entire life stages. Compared to insect CPRs, knowledge about insect b5s expressions in different stages is less. The transcription of H. armigera b5 was undetectable in eggs but was expressed at similar levels in all six larvae stages, and decreased to very low levels in pupae and adult moths (Ranasinghe and Hobbs, 1999b). A gradually increasing trend of DBM b5 mRNA levels from eggs to the 4th instar larvae was observed, then its transcription significantly down-regulated in pupae and adults. Both DBM CPR and b5 were minimum expressed in eggs and maximum expressed in the 4th instar larvae indicating their involvement in the same physiological processes. In addition, CPR and b5 that were expressed in all developmental stages suggested that they may also play important roles in the development of DBM. Generally, the distribution of certain protein in tissues is usually related to its function. The mRNA levels of CPR in C. lectularius tissues were associated with the potential localization of P450 activities indicating its involvement in the function of P450s (Zhu et al., 2012). The high abundance of CPR mRNA in antennae and embryos of D. melanogaster demonstrated the roles it played in embryonic development and odorant clearance (Hovemann et al., 1997). As showed in our results, the mRNA levels of both DBM CPR and b5 were most abundant in gut which is similar to those of in other insects, such as H. armigera
Fig. 4. Relative expression levels of DBM CPR and b5 in the beta-cypermethrin susceptible strain (L-SS) and in the beta-cypermethrin resistant strain (TB-RS). The expression levels of DBM CPR and b5 in L-SS were set to 1. Data were presented as mean ± SE; * denotes a significant difference in expression levels between L-SS and TB-RS (***P b 0.001, Student's t-test).
(Ranasinghe and Hobbs, 1999b; Zhao et al., 2014), C. suppressalis (Liu et al., 2013), and N. lugens (Liu et al., 2014), indicating the great possibility of their involvement in the metabolism of xenobiotics in the midgut. Previous study reported that CPR was involved in the biosynthesis of cuticular hydrocarbon and was highly expressed in the cuticle of Drosophila (Qiu et al., 2012). However, we found that CPR mRNA was not detected in the DBM cuticle. This difference indicated that the function of DBM CPR might differ from Drosophila CPR. This difference might be due to the distinct function of CPR in various insects. Another reasonable explanation is that the expression profiles of DBM CPR might be varied in the cuticle of different developmental stages, and we only detected its expression in the 4th instar larvae in this work. Inducibility is considered to be a general characteristic of P450 systems (Harrison et al., 2001). Induction of P450s has been taken as an indication of their roles in the metabolism of xenobiotics (Stevens et al., 2000). Numerous studies have suggested that the inducible expression of P450s was associated with resistance to pyrethroid insecticides (Guo et al., 2012; Jiang et al., 2010; Ranasinghe et al., 1998). However, little is known about the expression profiles of CPR and b5 after exposure to these insecticides. Ranasinghe and Hobbs (1999b) found that three pyrethroid insecticides, fenvalerate, cypermethrin, and permethrin could induce the expression of b5 and a pyrethroid-resistant P450, CYP6B7. In the present work, we found that both DBM CPR and b5 could be more efficiently induced by lower dose (LC10) of beta-cypermethrin than higher dose (LC50), as well as both genes were significantly induced only in short exposure intervals by higher dose (LC50) which were consistent with previous report about DBM P450 induction (Baek et al., 2010). It is likely that higher doses of insecticides could trigger severe physiological stresses leading to the rapid response of many genes, which could overwhelm many subtle processes such as CPR and b5 induction (Baek et al., 2010). Furthermore, the overexpressions of these two genes were also observed in a field collected betacypermethrin population. And a P450 gene, CYP9G2, was also highly overexpressed in this population (data not shown). Our results indicated that DBM CPR and b5 were highly likely involved in the P450mediated metabolism of beta-cypermethrin. Further investigations, such as RNA interference of CPR and/or b5 (Liu et al., 2014; Lycett et al., 2006; Tang et al., 2012; Zhu et al., 2012), will be needed to confirm this inference. Except for their crucial roles in the P450 system in vivo, many studies have also demonstrated that the CPR or b5 is required for the activities of recombinant P450 enzyme in vitro (Andersen et al., 1994; Kaspera et al., 2011; Iwata et al., 1998; Stevenson et al., 2011). With the completion of DBM genome sequencing (You et al., 2013), we can anticipate the discovery of more P450s that is related to the insecticide resistance. It will be of interest to study the metabolic ability of individual DBM P450 against insecticides or other xenobiotics in vitro. A co-
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
6
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
Fig. 5. Relative expression levels of DBM CPR and b5 in L-SS treated by beta-cypermethrin. Data were presented as mean ± SE; * denotes a significant difference in expression levels between treatment and corresponding control (*P b 0.05, **P b 0.01, ***P b 0.001, Student's t-test).
expression system containing DBM CPR and b5 designed for recombinant DBM P450 expression in Escherichia coli is being carried out. As both CPR and b5 are indispensible for P450 functions, CPR or b5 inhibitors are promising tools to conquer the P450-meditated insecticide resistance. In conclusion, the present work provides preliminary information on the sequence, phylogenicity and expression pattern of two important components of P450 systems, CPR and b5, in the diamondback moth (DBM), Plutella xylostella. These two genes were up-regulately expressed in the beta-cypermethrin resistance DBM population, and their expression could be induced by low concentration of beta-cypermethrin. Our results indicated their roles in DBM resistance to beta-cypermethrin. Further studies are needed to investigate their functions in individual P450mediated metabolic reaction and in other physiological processes in DBM. Conflict of interest The authors declare that there is no conflict of interest in this paper. Acknowledgments We sincerely appreciate Prof. J. R. Schrock (Emporia State University, USA) for revising the manuscript. This research is supported by the Special Fund for the Public Interest (Agriculture) (200903052) of the Ministry of Agriculture of China, and the ‘13115’ Sci-Tech Innovation Project of Shaanxi Province (2007ZDKG-14). References Andersen, J.F., Utermohlen, J.G., Feyereisen, R., 1994. Expression of housefly CYP6A1 and NADPH–cytochrome P450 reductase in Escherichia coli and reconstitution of an insecticide-metabolizing P450 system. Biochemistry 33, 2171–2177. APRD, 2014. Arthropod Pesticide Resistance Database. Michigan State Univ., East Lansing (http://www.pesticidesresistance.com/index.php [Accessed 10 June 2014]). Baek, J.H., Clark, J.M., Lee, S.H., 2010. Cross-strain comparison of cypermethrin-induced cytochrome P450 transcription under different induction conditions in diamondback moth. Pestic. Biochem. Physiol. 96, 43–50. Eziah, V.Y., Rose, H.A., Wilkes, M., Clift, A.D., 2009. Biochemical mechanisms of insecticide resistance in the diamondback moth (DBM) Plutella xylostella L. (Lepidoptera: Yponomeutidae), in the Sydney region, Australia. Aust. J. Entomol. 48, 321–327. Feyereisen, R., 1999. Insect P450 enzymes. Annu. Rev. Entomol. 44, 507–533. Furlong, M.J., Wright, D.J., Dosdall, L.M., 2013. Diamondback moth ecology and management: problems, progress, and prospects. Annu. Rev. Entomol. 58, 517–541. Gan, L., von Moltke, L.L., Trepanier, L.A., Harmatz, J.S., Greenblatt, D.J., Court, M.H., 2009. Role of NADPH–cytochrome P450 reductase and cytochrome-b5/NADH-b5 reductase in variability of CYP3A activity in human liver microsomes. Drug Metab. Dispos. 37, 90–96. Guo, Y.Q., Zhang, J.Z., Yang, M.L., Yan, L.Z., Zhu, K.Y., Guo, Y.P., Ma, E.B., 2012. Comparative analysis of cytochrome P450-like genes from Locusta migratoria manilensis: expression profiling and response to insecticide exposure. Insect Sci. 19, 75–85. Hannemann, F., Bichet, A., Ewen, K.M., Bernhardt, R., 2007. Cytochrome P450 systems—biological variations of electron transport chains. Biochim. Biophys. Acta Gen. Subj. 1770, 330–344.
Harrison, T.L., Zangerl, A.R., Schuler, M.A., Berenbaum, M.R., 2001. Developmental variation in cytochrome P450 expression in Papilio polyxenes in response to xanthotoxin, a hostplant allelochemicals. Arch. Insect Biochem. Physiol. 48, 179–189. Horike, N., Takemori, H., Nonaka, Y., Sonobe, H., Okamoto, M., 2000. Molecular cloning of NADPH–cytochrome P450 oxidoreductase from silkworm eggs. Eur. J. Biochem. 267, 6914–6920. Hovemann, B.T., Sehlmeyer, F., Malz, J., 1997. Drosophila melanogaster NADPH–cytochrome P450 oxidoreductase: pronounced expression in antennae may be related to odorant clearance. Gene 189, 213–219. Iqbal, M., Wright, D.J., 1997. Evaluation of resistance, cross-resistance and synergism of abamectin and teflubenzuron in a multi-resistant field population of Plutella xylostella (Lepidoptera: Plutellidae). Bull. Entomol. Res. 87, 481–486. Iwata, H., Fujita, K.I., Kushida, H., Suzuki, A., Konno, Y., Nakamura, K., Kamataki, T., 1998. High catalytic activity of human cytochrome P450 co-expressed with human NADPH–cytochrome P450 reductase in Escherichia coli. Biochem. Pharmacol. 55, 1315–1325. Jiang, H.B., Tang, P.A., Xu, Y.Q., An, F.M., Wang, J.J., 2010. Molecular characterization of two novel deltamethrin-inducible P450 genes from Liposcelis bostrychophila Badonnel (Psocoptera: Liposcelididae). Arch. Insect Biochem. Physiol. 74, 17–37. Jouraku, A., Yamamoto, K., Kuwazaki, S., Urio, M., Suetsugu, Y., Narukawa, J., Miyamoto, K., Kurita, K., Kanamori, H., Katayose, Y., Matsumoto, T., Noda, H., 2013. KONAGAbase: a genomic and transcriptomic database for the diamondback moth, Plutella xylostella. BMC Genomics 14, 464. Kaewpa, D., Boonsuepsakul, S., Rongnoparut, P., 2007. Functional expression of mosquito NADPH–cytochrome P450 reductase in Escherichia coli. J. Econ. Entomol. 100, 946–953. Kaspera, R., Naraharisetti, S.B., Evangelista, E.A., Marciante, K.D., Psaty, B.M., Totah, R.A., 2011. Drug metabolism by CYP2C8.3 is determined by substrate dependent interactions with cytochrome P450 reductase and cytochrome b5. Biochem. Pharmacol. 82, 681–691. Koener, J.F., Carino, F.A., Feyereisen, R., 1993. The cDNA and deduced protein sequence of house fly NADPH–cytochrome P450 reductase. Insect Biochem. Mol. Biol. 23, 439–447. Lamb, D.C., Kim, Y., Yermalitskaya, L.V., Yermalitsky, V.N., Lepesheva, G.I., Kelly, S.L., Waterman, M.R., Podust, L.M., 2006. A second FMN binding site in yeast NADPH–cytochrome P450 reductase suggests a mechanism of electron transfer by diflavin reductases. Structure 14, 51–61. Laursen, T., Jensen, K., Møller, B.L., 2011. Conformational changes of the NADPH–dependent cytochrome P450 reductase in the course of electron transfer to cytochromes P450. Biochim. Biophys. Acta Protein Proteomics 1814, 132–138. Lee, K.B., La Mar, G.N., Kehres, L.A., Fujinari, E.M., Smith, K.M., Pochapsky, T.C., Sligar, S.G., 1990. Proton NMR study of the influence of hydrophobic contacts on protein prosthetic group recognition in bovine and rat ferricytochrome b5. Biochemistry 29, 9623–9631. Li, X., Schuler, M.A., Berenbaum, M.R., 2007. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 52, 231–253. Liu, S., Liang, Q.M., Huang, Y.J., Yuan, X., Zhou, W.W., Qiao, F., Cheng, J., Gurr, G.M., Zhu, Z.R., 2013. Cloning, functional characterization, and expression profiles of NADPH–cytochrome P450 reductase gene from the Asiatic rice striped stem borer, Chilo suppressalis (Lepidoptera: Pyralidae). Comp. Biochem. Physiol. B 166, 225–231. Liu, S., Liang, Q.M., Zhou, W.W., Jiang, Y.D., Zhu, Q.Z., Yu, H., Zhang, C.X., Gurr, G.M., Zhu, Z.R., 2014. RNA interference of NADPH–cytochrome P450 reductase of the rice brown planthopper, Nilaparvata lugens, increases susceptibility to insecticides. Pest Manag. Sci. http://dx.doi.org/10.1002/ps.3760. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(− Delta Delta C(T)) method. Methods 25, 402–408. Lycett, G.J., McLaughlin, L.A., Ranson, H., Hemingway, J., Kafatos, F.C., Loukeris, T.G., Paine, M.J.I., 2006. Anopheles gambiae P450 reductase is highly expressed in oenocytes and in vivo knockdown increases permethrin susceptibility. Insect Mol. Biol. 15, 321–327. Maibeche-Coisne, M., Merlin, C., Francois, M.C., Porcheron, P., Jacquin-Joly, E., 2005. P450 and P450 reductase cDNAs from the moth Mamestra brassicae: cloning and expression patterns in male antennae. Gene 346, 195–203. Mathews, F.S., 1985. The structure, function and evolution of cytochromes. Prog. Biophys. Mol. Biol. 45, 1–56.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx Mizutani, M., Ohta, D., 1998. Two isoforms of NADPH: cytochrome P450 reductase in Arabidopsis thaliana. Plant Physiol. 116, 357–367. Oprian, D.D., Coon, M.J., 1982. Oxidation-reduction states of FMN and FAD in NADPH–cytochrome P-450 reductase during reduction by NADPH. J. Biol. Chem. 257, 8935–8944. Pandey, A.V., Kempná, P., Hofer, G., Mullis, P.E., Flück, C.E., 2007. Modulation of human CYP19A1 activity by mutant NADPH P450 oxidoreductase. Mol. Endocrinol. 21, 2579–2595. Porter, T.D., 2002. The roles of cytochrome b5 in cytochrome P450 reactions. J. Biochem. Mol. Toxicol. 16, 311–316. Qiu, Y., Tittiger, C., Wicker-Thomas, C., Le Goff, G., Young, S., Wajnberg, E., Fricaux, T., Taquet, N., Blomquist, G., Feyereisen, R., 2012. An insect-specific P450 oxidative decarbonylase for cuticular hydrocarbon biosynthesis. Proc. Natl. Acad. Sci. U. S. A. 109, 14858–14863. Ranasinghe, C., Hobbs, A.A., 1999a. Induction of cytochrome P450 CYP6B7 and cytochrome b5 mRNAs from Helicoverpa armigera (Hubner) by pyrethroid insecticides in organ culture. Insect Mol. Biol. 8, 443–447. Ranasinghe, C., Hobbs, A.A., 1999b. Isolation and characterisation of a cytochrome b5 cDNA clone from Helicoverpa armigera (Hubner): possible involvement of cytochrome b5 in cytochrome P450 CYP6B7 activity towards pyrethroids. Insect Biochem. Mol. Biol. 29, 145–151. Ranasinghe, C., Campbell, B., Hobbs, A.A., 1998. Over-expression of cytochrome P450 CYP6B7 mRNA and pyrethroid resistance in Australian populations of Helicoverpa armigera (Hübner). Pestic. Sci. 54, 195–202. Schenkman, J.B., Jansson, I., 1999. Interactions between cytochrome P450 and cytochrome b5. Drug Metab. Rev. 31, 351–364. Schenkman, J.B., Jansson, I., 2003. The many roles of cytochrome b5. Pharmacol. Ther. 97, 139–152. Scott, J.G., 1999. Cytochromes P450 and insecticide resistance. Insect Biochem. Mol. Biol. 29, 757–777. Stevens, J.L., Snyder, M.J., Koener, J.F., Feyereisen, R., 2000. Inducible P450s of the CYP9 family from larval Manduca sexta midgut. Insect Biochem. Mol. Biol. 30, 559–568. Stevenson, B.J., Bibby, J., Pignatelli, P., Pignatelli, P., Muangnoicharoen, S., O'Neill, P.M., Lian, L.Y., Müller, P., Nikou, D., Steven, A., Hemingway, J., Sutcliffe, M.J., Paine, M.J., 2011. Cytochrome P450 6M2 from the malaria vector Anopheles gambiae metabolizes pyrethroids: sequential metabolism of deltamethrin revealed. Insect Biochem. Mol. Biol. 41, 492–502.
7
Talekar, N.S., Shelton, A.M., 1993. Biology, ecology, and management of the diamondback moth. Annu. Rev. Entomol. 38, 275–301. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tang, J., Cao, Y., Rose, R.L., Brimfield, A.A., Dai, D., Goldstein, J.A., Hodgson, E., 2001. Metabolism of chlorpyrifos by human cytochrome P450 isoforms and human, mouse, and rat liver microsomes. Drug Metab. Dispos. 29, 1201–1204. Tang, T., Zhao, C., Feng, X., Liu, X., Qiu, L., 2012. Knockdown of several components of cytochrome P450 enzyme systems by RNA interference enhances the susceptibility of Helicoverpa armigera to fenvalerate. Pest Manag. Sci. 68, 1501–1511. Vergeres, G., Waskell, L., 1995. Cytochrome b5, its functions, structure and membrane topology. Biochimie 77, 604–620. Vermilion, J.L., Ballou, D.P., Massey, V., Coon, M.J., 1981. Separate roles for FMN and FAD in catalysis by liver microsomal NADPH–cytochrome P-450 reductase. J. Biol. Chem. 256, 266–277. Wang, M., Roberts, D.L., Paschke, R., Shea, T.M., Masters, B.S.S., Kim, J.J.P., 1997. Threedimensional structure of NADPH–cytochrome P450 reductase: prototype for FMNand FAD-containing enzymes. Proc. Natl. Acad. Sci. U. S. A. 94, 8411–8416. You, M., Yue, Z., He, W., Yang, X., Yang, G., Xie, M., Zhan, D., Baxter, S.W., Vasseur, L., Gurr, G.M., Douglas, C.J., Bai, J., Wang, P., Cui, K., Huang, S., Li, X., Zhou, Q., Wu, Z., Chen, Q., Liu, C., Wang, B., Li, X., Xu, X., Lu, C., Hu, M., Davey, J.W., Smith, S.M., Chen, M., Xia, X., Tang, W., Ke, F., Zheng, D., Hu, Y., Song, F., You, Y., Ma, X., Peng, L., Zheng, Y., Liang, Y., Chen, Y., Yu, L., Zhang, Y., Liu, Y., Li, G., Fang, L., Li, J., Zhou, X., Luo, Y., Gou, C., Wang, J., Wang, J., Yang, H., Wang, J., 2013. A heterozygous moth genome provides insights into herbivory and detoxification. Nat. Genet. 45, 220–225. Zhang, H., Myshkin, E., Waskell, L., 2005. Role of cytochrome b5 in catalysis by cytochrome P450 2B4. Biochem. Biophys. Res. Commun. 338, 499–506. Zhao, C., Tang, T., Feng, X., Qiu, L., 2014. Cloning and characterisation of NADPHdependent cytochrome P450 reductase gene in the cotton bollworm, Helicoverpa armigera. Pest Manag. Sci. 70, 130–139. Zhu, F., Sams, S., Moural, T., Haynes, K.F., Potter, M.F., Palli, S.R., 2012. RNA interference of NADPH–cytochrome P450 reductase results in reduced insecticide resistance in the bed bug, Cimex lectularius. PLoS One 7, e31037.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xylostella: Possible involvement in resistance to beta-cypermethrin Xi'en Chen, Yalin Zhang ⁎ Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, College of Plant Protection, Northwest A&F University, Yangling, Shaanxi 712100, China
a r t i c l e
i n f o
Article history: Received 13 June 2014 Received in revised form 20 October 2014 Accepted 25 December 2014 Available online xxxx Keywords: Cytochrome P450 enzyme systems Overexpression Resistance Plutella xylostella
a b s t r a c t NADPH–cytochrome P450 reductase (CPR) and cytochrome b5 (b5) are essential for cytochrome P450 mediated biological reactions. CPR and b5 in several insects have been found to be associated with insecticide resistance. However, CPR and b5 in the diamondback moth (DBM), Plutella xylostella, are not characterized and their roles remain undefined. A full-length cDNA of CPR encoding 678 amino acids and a full-length cDNA of b5 encoding 127 amino acids were cloned from DBM. Their deduced amino acid sequences shared high identities with those of other insects and showed characteristics of classical CPRs and b5s, respectively. The mRNAs of both genes were detectable in all developmental stages with the highest expression levels occurring in the 4th instar larvae. Tissue-specific expression analysis showed that their transcripts were most abundant in gut. Transcripts of CPR and b5 in the beta-cypermethrin resistant DBM strain were 13.2- and 2.84-fold higher than those in the beta-cypermethrin susceptible strain, respectively. The expression levels of CPR and b5 were enhanced by beta-cypermethrin at the concentration of 12 mg L−1 (~LC10). The results indicate that CPR and b5 may play essential roles in the P450 mediated resistance of DBM to beta-cypermethrin or even other insecticides. © 2014 Published by Elsevier B.V.
1. Introduction The diamondback moth (DBM), Plutella xylostella, is a worldwide distribution pest damaging crucifer vegetables which causes over 1 billion USD lost annually (Furlong et al., 2013; Talekar and Shelton, 1993). To date, its control remains mainly relying on the use of chemical insecticides. However, due to the frequent and unreasonable use of insecticides, as well as its polyvoltine characteristics and wide overlap of generations, DBM has developed resistance to N90 insecticides (APRD, 2014; Furlong et al., 2013). The enzymatic detoxification is considered as the major mechanism of DBM resistance to various insecticides. Cytochrome P450 monooxygenases (P450s), a superfamily of ancient enzymes that play dominant roles in the oxidative metabolism of endogenous compounds and xenobiotics (Feyereisen, 1999), have been suggested to be involved in DBM field resistance to organophosphates, pyrethroids, indoxacarb, avermectins, and benzoylureas (Eziah et al., 2009; Iqbal and Wright, 1997).
Abbreviations: DBM, diamondback moth; CPR, NADPH–cytochrome P450 reductase; b5, cytochrome b5; P450s, cytochrome P450 monooxygenases; RT-qPCR, real-time quantitative polymerase chain reaction; RACE, rapid amplification of cDNA ends; NCBI, National Center for Biotechnology Information; ANOVA, analysis of variance. ⁎ Corresponding author. E-mail address: [email protected] (Y. Zhang).
Generally, during the P450-dependent metabolic process, two electrons are required. The first one or both are considered to be transferred from NADPH by NADPH-dependent cytochrome P450 reductase (CPR) (Gan et al., 2009). The second one is thought to be transferred by cytochrome b5 (b5) in some cases (Porter, 2002; Zhang et al., 2005). Both two enzymes, playing crucial roles in supporting the P450 metabolic system, have been identified to be associated with insecticide resistance in several insects. In Helicoverpa armigera, the induction and over-expression patterns of b5 were identical to those of CYP6B7 indicating its involvement in the CYP6B7-mediated pyrethroid resistance (Ranasinghe and Hobbs, 1999a). A recent study showed that the susceptibility of H. armigera to fenvalerate was significantly enhanced after knockdown of CYP6B7 together with CPR and b5 (Tang et al., 2012). Knockdown of CPR also resulted in the reduced deltamethrin resistance in Cimex lectularius (Zhu et al., 2012), and the increased susceptibility to imidacloprid and beta-cypermethrin in Nilaparvata lugens (Liu et al., 2014), respectively. To our knowledge, although sequences of CPR and b5 cDNAs of many insects are available on NCBI database, only a few CPRs from several species of insects, including Musca domestica (Koener et al., 1993), Drosophila melanogaster (Hovemann et al., 1997), Bombyx mori (Horike et al., 2000), Mamestra brassicae (Maibeche-Coisne et al., 2005), Anopheles gambiae (Lycett et al., 2006), Anopheles minimus (Kaewpa et al., 2007), C. lectularius (Zhu et al., 2012), Chilo suppressalis (Liu et al., 2013), H. armigera (Zhao et al., 2014), and N. lugens (Liu et al., 2014), have
http://dx.doi.org/10.1016/j.gene.2014.12.053 0378-1119/© 2014 Published by Elsevier B.V.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
2
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
been characterized. And reports about insect b5 were even fewer. There is no report concerning the sequences and functions of CPR and b5, as well as their interactions with individual P450 in DBM. In this work, the fulllength cDNAs of CPR and b5 from DBM were cloned and characterized. Their transcriptional levels at different developmental stages and in various tissues were investigated. The transcriptional responses of CPR and b5 to beta-cypermethrin, as well as their expression profiles in betacypermethrin population were examined. The present study may provide a foundation for further investigation to uncover the functions of CPR and b5 in the P450-mediated beta-cypermethrin or other insecticide resistance in DBM. 2. Materials and methods 2.1. Insects An insecticide-susceptible strain of DBM (L-SS) with an LC50 value of 48.9 mg L−1 for beta-cypermethrin was initially obtained from a culture at the Biorational Pesticides Research and Development Center, Northwest A&F University, Shaanxi, China, has been maintained in the laboratory for N5 years without exposure to insecticides. A field strain of DBM (TBRS) was originally collected from cabbage field in Tai Bai county, Shaanxi, China, in August 2013, and showed an LC50 value of 7.92 g L−1 for betacypermethrin with the resistance ratio about 162-fold. The two strains were reared on Pak choi cabbage seedlings at 25 ± 2 °C, 50% relative humidity and with a photoperiod of 16:8 (light:dark) in the laboratory. Newly molted moths were collected and supplied with 5% honey solution as nutrients and permitted to oviposition on moist gauze sterilized with a 1% sodium hypochlorite solution. 2.2. Beta-cypermethrin treatment Beta-cypermethrin (purity ≥ 95%, Jingchun Co. Ltd., Shanghai, China) was diluted in acetone to produce a stock solution and was further diluted to 12 mg L−1 (~LC10) and 50 mg L−1 (~LC50) by 0.5‰ Triton X-100 solution, respectively. Newly molted 4th instar larvae of L-SS were selected and starved for 4 h. The leaf-dipping method was employed (Baek et al., 2010). Fresh radish leaves were dipped into the beta-cypermethrin solutions for 10–15 s and air dried at room temperature, then fed to the starved larvae. Larvae that fed with radish leaves treated with solution in the absence of beta-cypermethrin were taken as the controls. All larvae collected after 2 h, 6 h, 12 h, and 24 h posttreatment were snap frozen in liquid nitrogen and then stored at −80 °C. 2.3. Total RNA isolation and cDNA synthesis Total RNA was extracted from different developmental stages, (egg, 1st to 4th instar larvae, pupae and adult) and various tissues (head, gut, epidermis, and hemolymph) of the 4th instar larvae using RNAiso Plus (TaKaRa, Dalian, China) following the manual instructions. For real-time quantitative polymerase chain reaction (RT-qPCR) analysis, cDNAs were synthesized from 1.0 μg RNA using PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). For amplification of CPR and b5, cDNAs were synthesized from the 4th instar larvae RNA using 5′-Full RACE Kit and 3′-Full RACE Core Set (TaKaRa, Dalian, China), respectively. All cDNAs were stored at −20 °C until use. 2.4. Cloning of full-length cDNA of CPR and b5 Using the full-length cDNA of H. armigera CPR (accession: HM347785) and b5 (accession: AF061105) as probes, we blasted the genomic and transcriptomic database for DBM (KONAGAbase) (Jouraku et al., 2013). The fragments of DBM CPR and b5 were obtained. Fulllength sequences were cloned by rapid amplification of cDNA ends PCR (RACE-PCR) with universal primers supplied in the RACE kits and
specific primers listed in Table 1 according to the manual instructions. The open reading frames (ORFs) of DBM CPR and b5 were amplified and confirmed by PCR using corresponding specific primers (Table 1). All PCR products were cloned into pMD19-T vectors (TaKaRa, Dalian, China) and transformed into Escherichia coli DH5α cells and then sequenced (AuGCT, Inc., Beijing, China).
2.5. Sequence analysis of CPR and b5 The full-length cDNAs of DBM CPR and b5 were assembled using the Contig Express program suite Vector NTI6.0 (InforMax, Frederick, MD, USA), and the ORFs were obtained by ORF Finder (http://www.ncbi. nlm.nih.gov/gorf/gorf.html). The ExPASy Compute pI/Mw tool, (http:// web.expasy.org/compute_pi/), was used to predict the molecular weight and isoelectric point of the deduced amino acid sequence. Sequence similarities were analyzed by using BLAST programs (http:// www.ncbi.nlm.gov/blast/). The N-terminal signal peptide and transmembrane domain were predicted by using SignalP 4.0 server (http:// www.cbs.dtu.dk/services/SignalP/) and TMHMM Server 2.0 (http:// www.cbs.dtu.dk/services/TMHMM-2.0/), respectively. For the analysis of protein domains, the InterProScan 4 from EMBL-EBI (http://www. ebi.ac.uk/Tools/pfa/iprscan/) was used to search the InterPro collection of protein signature databases. The phylogenetic trees were conducted by the neighbor-joining method with bootstrap test of 1000 replicates using MEGA 5.0 software (Tamura et al., 2011).
2.6. RT-qPCR analysis All primers used in RT-qPCR reactions were designed by Primer3 (http://www.simgene.com/Primer3) and listed in Table 1. Using 100fold diluted cDNAs as templates, RT-qPCR was performed on an iCycler iQ5 real-time PCR detection system (Bio-Rad, Philadelphia, PA, USA) using the UltraSYBR mixture (CWBIO, Beijing, China) according to the manual's instructions. Thermal cycling conditions were as follows: 95 °C for 10 min, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. This was followed by a dissociation analysis to confirm the homogeneity of the PCR product. The actin gene (accession: JN410820) was used as a reference. The RT-qPCR was repeated three times for each gene. Each replicate was performed with an independent RNA sample preparation and consisted of three technical replicates. The comparative Ct method was used to assess the different expression levels of DBM CPR and b5 (Livak and Schmittgen, 2001). Table 1 Primers used in this work. Gene
Primer name
Sequence (5′–3′)
Function
CPR
CPR-5R CGGCGGGCAACATCCAGGTGAC 5′-RACE CPR-3R ACCTGCTCGGCAACCAGAACGC 3′-RACE CPR-F CATATGCACCATCACCATTCGGAGGACCTCGCGCA ORF amplification CPR-R AAGCTTCTAGCTCCACACGTCGGCGGAG – CPR-qF CTCTCGACGACGTGTTTTCA RT-qPCR analysis CPR-qR TGGTATAACGCCTTGCCTTC – b5 b5-5R GGCGTTCCTGGACGACCACCCG 5′-RACE b5-3R CCTCCGACTGCTTCCACGACAT 3′-RACE b5-F CATATGCACCATCACCATACCA ORF CGGAGTTCACGCG amplification b5-R AAGCTTTCACCCGAACAGATAGAAGTAG – b5-qF TCATCATCATCGACAACGTG RT-qPCR analysis b5-qR GAACTGCAGCATCCAGTCG – β-Actin qF GCGACTTGACCGACTACC RT-qPCR analysis qR GGAATGAGGGCTGGAACA –
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
2.7. Statistical analyses All data were presented as mean ± standard error (SE) and analyzed by one-way ANOVA with least significant difference test among multiple groups or analyzed by Student's t-test (two-tailed paired t-test) between two groups using SAS software (v9.1, SAS Institute Inc., Gary, NC). The level of significance was set at P b 0.05. 3. Results 3.1. Cloning and sequence analysis of DBM CPR and b5 Based on the cDNA fragments of DBM CPR and b5 from KONAGAbase, we carried out the RACE-PCR and obtained the fulllength cDNAs of these two genes. Nucleotide sequence analysis revealed that the complete cDNA of DBM CPR has a 5′-untranslated region (5′UTR) of 172 bp, a 3′-untranslated region (3′-UTR) of 485 bp, and an open reading frame (ORF) of 2037 bp which encodes a protein of 678 aa, with the theoretical pI of 5.59 and calculated molecular weight of 76,314.50 Da; the full-length cDNA of DBM b5 owns a 66 bp 5′-UTR, a 305 bp 3′-UTR, and an 384 bp ORF encoding a protein of 127 aa, with the theoretical pI of 4.54 and calculated molecular weight of 13,719.34 Da. The cDNA sequences of DBM CPR and b5 have been deposited in the GenBank database with the accession numbers of KJ767015 and KJ767014, respectively. The DBM CPR protein possesses the characteristic motifs of insect CPR, including the FMN, FAD, and NADPH binding domains (Fig. 1A). The 15 amino acid residues interacting with non-covalently bound heme are identical or highly conserved in insect b5 proteins (Fig. 1B). No signal peptide was found in the secondary structures of these two proteins, however, an N-terminal transmembrane region and a Cterminal transmembrane region were observed in CRP and b5, respectively (Fig. 1). The transmembrane region in these two proteins may function as an anchor involved in location on the membrane of the endoplasmic reticulum. BLAST analysis of deduced amino acid sequence of DBM CPR on NCBI revealed its high similarities with CPRs from other insect species. It shared
3
81%, 80%, 79%, 76%, 68%, and 67% to CPR of H. armigera (ADK25060), Spodoptera littoralis (AFP20584), C. suppressalis (AGM20565), B. mori (NP_001104834), D. melanogaster (NP_477158), and Tribolium castaneum (XP_971174), respectively. DBM b5 possessed 52%, 47%, 44%, 42%, and 39% to b5 of B. mori (NP_001106739), H. armigera (ADU02195), D. melanogaster (NP_610294), Culex quinquefasciatus (XP_001867082) and T. castaneum (XP_974294), respectively. Both DBM CPR and b5 showed higher identities to those of Lepidoptera insects than to those of other insects, and the phylogenetic trees revealed that CPR from Lepidoptera insects formed a cluster (Fig. 2A), however, Danaus plexippus and Papilio polytes b5s formed a cluster and other Lepidoptera insects b5s fell into another cluster (Fig. 2B). 3.2. Developmental- and tissue-specific expression profiles of DBM CPR and b5 To determine the developmental variation and tissue distribution of DBM CPR and b5, their relative transcriptional levels among various tissues and life stages were investigated by qPCR. The results showed that the expression levels of CPR were varied through the whole life stages, with the highest level occurring in the 4th instar larvae and the lowest level founded in eggs. The transcripts of b5 were low in eggs, but gradually increased from eggs to the 4th instar larvae, and then decreased in pupae and adults (Fig. 3A). The tissue-dependent expression patterns of CPR and b5 were determined in four tissues, including head, hemolymph, gut, and cuticle. The results clearly revealed that transcripts of both genes were most abundant in gut. CPR mRNA was not detected, and b5 mRNA was nearly undetectable in cuticle, respectively. In hemolymph, their expression levels were all lower than those in gut, but were all higher than those in head (Fig. 3B). Our results indicated that CPR and b5 may have similar transcriptional profiles in various tissues. 3.3. Transcripts of DBM CPR and b5 in L-SS and TB-RS In order to uncover whether the CPR and b5 are associated with betacypermethrin resistance, their expression levels in the 4th instar larvae
Fig. 1. Alignment of the deduced amino acid sequences of CPR (A) and b5 (B). Pxyl: Plutella xylostella; Harm: Helicoverpa armigera; Bmor: Bombyx mori; Mdom: Musca domestica; Agam: Anopheles gambiae.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
4
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
Fig. 2. The polygenetic tree of DBM CPR (A) and b5 (B) with those of other insects. Bootstrap values are shown on each node. DBM CPR and b5 are marked by solid circles.
of L-SS and TB-RS were monitored. Our result showed that the transcripts of CPR and b5 were both significantly more abundant in TB-RS than those in L-SS, with the increases of 13.2- and 2.84-fold, respectively, indicating their potential involvement in beta-cypermethrin resistance (Fig. 4). 3.4. Effect of beta-cypermethrin on DBM CPR and b5 expression LC10 and LC50 amounts of beta-cypermethrin were used to challenge the expression of DBM CPR and b5, respectively. The mRNA levels of CPR were induced by 1.8- to 3.01-fold at different intervals exposed to LC10 concentration of beta-cypermethrin. LC50 amount of betacypermethrin only enhanced CPR expression by 1.5-fold at 6 h of treatment. Transcriptions of b5 were increased by 1.77- to 1.92-fold after 6–24 h of 12 mg L−1 beta-cypermethrin treatment. Its expression was significantly augmented by 1.78-fold at 2 h, and then recovered to normal levels at 6–24 h after treated with 50 mg L−1 beta-cypermethrin (Fig. 5). 4. Discussion The P450-mediated metabolism is a common mechanism by which insects become resistant to insecticides as evidenced by the numerous insect species and insecticides affected (Li et al., 2007; Scott, 1999). The classic catalytic reaction of P450s is based on heterolytic cleavage of dioxygen resulting in hydroxylation of the substrate and simulation formation of water. In this process, CPR is indispensable in transferring the electron(s) from NADPH to P450s (Hannemann et al., 2007; Laursen et al., 2011; Porter, 2002), and b5 may stimulate, inhibit or have no effects on the P450-catalyzed reactions depending on the individual P450s, type of substrate, and reaction conditions (Porter, 2002; Schenkman and Jansson, 1999, 2003). Understanding the functions of insect CPR and b5 in the detoxification of insecticides and other xenobiotics metabolized by P450 systems would be helpful to further reveal the mechanism of insecticide resistance, as well as may facilitate the identification of new targets for insecticides. In this study, a CPR cDNA and a b5 cDNA were isolated from DBM. Multiple alignment analysis showed high identities of their deduced amino acid sequences with other insect CPRs and b5s, respectively. Structure analysis revealed that the DBM CPR contained a hydrophobic N-terminal transmembrane domain which functions as membrane
anchor (Lamb et al., 2006; Wang et al., 1997), and a hydrophilic Cterminal catalytic domain comprising three distinct binding domains for FMN, FAD, and NADPH (Fig. 1A). The FMN binding domain in DBM CRP, with two binding sites interacting with the redox-partner binding site of the P450s (Lamb et al., 2006), is conserved among those in CPRs of other organisms (Horike et al., 2000; Liu et al., 2013; Mizutani and Ohta, 1998; Zhao et al., 2014). The complete function loss of yeast (Saccharomyces cerevisiae) CPR toward CYP51 was observed when the residues Thr 71 and Asp 187 in FMN binding sites were mutated to Ala (Lamb et al., 2006). It was suggested that a hydride ion derived from NADPH was transferred to FAD, and then FAD passed electrons to FMN, from where they were delivered to P450s or other acceptor proteins (Oprian and Coon, 1982; Vermilion et al., 1981). The CPR anchored on the membrane of the endoplasmic reticulum by its N-terminal hydrophobic segment which makes its remainder facing the cytoplasmic side of the membrane is important to allow electron transfer between the CPR and P450s (Pandey et al., 2007; Tang et al., 2001; Wang et al., 1997). The DBM b5 consisted of a conserved N-terminal heme binding site that was crucial for its function, and a hydrophobic C-terminal transmembrane domain anchoring it to the membrane of the endoplasmic reticulum. Fifteen residues that are involved in the heme binding (Lee et al., 1990), as well as thirteen residues constituted the “b5 fold” (Mathews, 1985), were highly conserved among b5s of divergent insect species. An identical residue proline in the transmembrane domains of various b5s was thought to be involved in the cis/trans conformation of the membrane anchor (Fig. 1B) (Vergeres and Waskell, 1995). Our results showed that both DBM CPR and b5 were structurally related to those of other species indicating that they possess similar functions with the known CPRs and b5s. And the small cluster formed by CPRs from Lepidoptera insects in the polygenetic trees indicated their close evolutionary relationship (Fig. 2A). The relative low identities in the amino acid sequences of b5s from Lepidoptera insects might explain why they could not be included in a single cluster (Fig. 2B). Some known insect CPR and b5 displayed variable expression profiles across developmental stages. The mRNA of H. armigera CPR was detected in all life stages (egg stage excluded), with the highest level occurring in the 5th instar larvae and the lowest level presenting in pupae (Zhao et al., 2014). In C. suppressalis, the CPR mRNA transcription was most abundantly expressed in adults, and the lowest expressed in the 3rd instar larvae (Liu et al., 2013). The N. lugens CPR showed fluctuated expression levels through different developmental stages. The
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
5
Fig. 3. Relative expression levels of DBM CPR and b5 at different developmental stages (A) and in various tissues (B). The relative levels of DBM CPR and b5 expression at different developmental stages and in various tissues were normalized to the level in the egg and head, respectively. Data are presented as mean ± SE; different letters denote a significant difference among different samples (P b 0.05, one-way ANOVA).
highest transcription was found in the 1st instar larvae and the lowest transcription was observed in adults (Liu et al., 2014). We found that DBM CPR was expressed at various degrees from eggs to adults. It seems that CPRs form different insect species have diverse expression profiles in the entire life stages. Compared to insect CPRs, knowledge about insect b5s expressions in different stages is less. The transcription of H. armigera b5 was undetectable in eggs but was expressed at similar levels in all six larvae stages, and decreased to very low levels in pupae and adult moths (Ranasinghe and Hobbs, 1999b). A gradually increasing trend of DBM b5 mRNA levels from eggs to the 4th instar larvae was observed, then its transcription significantly down-regulated in pupae and adults. Both DBM CPR and b5 were minimum expressed in eggs and maximum expressed in the 4th instar larvae indicating their involvement in the same physiological processes. In addition, CPR and b5 that were expressed in all developmental stages suggested that they may also play important roles in the development of DBM. Generally, the distribution of certain protein in tissues is usually related to its function. The mRNA levels of CPR in C. lectularius tissues were associated with the potential localization of P450 activities indicating its involvement in the function of P450s (Zhu et al., 2012). The high abundance of CPR mRNA in antennae and embryos of D. melanogaster demonstrated the roles it played in embryonic development and odorant clearance (Hovemann et al., 1997). As showed in our results, the mRNA levels of both DBM CPR and b5 were most abundant in gut which is similar to those of in other insects, such as H. armigera
Fig. 4. Relative expression levels of DBM CPR and b5 in the beta-cypermethrin susceptible strain (L-SS) and in the beta-cypermethrin resistant strain (TB-RS). The expression levels of DBM CPR and b5 in L-SS were set to 1. Data were presented as mean ± SE; * denotes a significant difference in expression levels between L-SS and TB-RS (***P b 0.001, Student's t-test).
(Ranasinghe and Hobbs, 1999b; Zhao et al., 2014), C. suppressalis (Liu et al., 2013), and N. lugens (Liu et al., 2014), indicating the great possibility of their involvement in the metabolism of xenobiotics in the midgut. Previous study reported that CPR was involved in the biosynthesis of cuticular hydrocarbon and was highly expressed in the cuticle of Drosophila (Qiu et al., 2012). However, we found that CPR mRNA was not detected in the DBM cuticle. This difference indicated that the function of DBM CPR might differ from Drosophila CPR. This difference might be due to the distinct function of CPR in various insects. Another reasonable explanation is that the expression profiles of DBM CPR might be varied in the cuticle of different developmental stages, and we only detected its expression in the 4th instar larvae in this work. Inducibility is considered to be a general characteristic of P450 systems (Harrison et al., 2001). Induction of P450s has been taken as an indication of their roles in the metabolism of xenobiotics (Stevens et al., 2000). Numerous studies have suggested that the inducible expression of P450s was associated with resistance to pyrethroid insecticides (Guo et al., 2012; Jiang et al., 2010; Ranasinghe et al., 1998). However, little is known about the expression profiles of CPR and b5 after exposure to these insecticides. Ranasinghe and Hobbs (1999b) found that three pyrethroid insecticides, fenvalerate, cypermethrin, and permethrin could induce the expression of b5 and a pyrethroid-resistant P450, CYP6B7. In the present work, we found that both DBM CPR and b5 could be more efficiently induced by lower dose (LC10) of beta-cypermethrin than higher dose (LC50), as well as both genes were significantly induced only in short exposure intervals by higher dose (LC50) which were consistent with previous report about DBM P450 induction (Baek et al., 2010). It is likely that higher doses of insecticides could trigger severe physiological stresses leading to the rapid response of many genes, which could overwhelm many subtle processes such as CPR and b5 induction (Baek et al., 2010). Furthermore, the overexpressions of these two genes were also observed in a field collected betacypermethrin population. And a P450 gene, CYP9G2, was also highly overexpressed in this population (data not shown). Our results indicated that DBM CPR and b5 were highly likely involved in the P450mediated metabolism of beta-cypermethrin. Further investigations, such as RNA interference of CPR and/or b5 (Liu et al., 2014; Lycett et al., 2006; Tang et al., 2012; Zhu et al., 2012), will be needed to confirm this inference. Except for their crucial roles in the P450 system in vivo, many studies have also demonstrated that the CPR or b5 is required for the activities of recombinant P450 enzyme in vitro (Andersen et al., 1994; Kaspera et al., 2011; Iwata et al., 1998; Stevenson et al., 2011). With the completion of DBM genome sequencing (You et al., 2013), we can anticipate the discovery of more P450s that is related to the insecticide resistance. It will be of interest to study the metabolic ability of individual DBM P450 against insecticides or other xenobiotics in vitro. A co-
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
6
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx
Fig. 5. Relative expression levels of DBM CPR and b5 in L-SS treated by beta-cypermethrin. Data were presented as mean ± SE; * denotes a significant difference in expression levels between treatment and corresponding control (*P b 0.05, **P b 0.01, ***P b 0.001, Student's t-test).
expression system containing DBM CPR and b5 designed for recombinant DBM P450 expression in Escherichia coli is being carried out. As both CPR and b5 are indispensible for P450 functions, CPR or b5 inhibitors are promising tools to conquer the P450-meditated insecticide resistance. In conclusion, the present work provides preliminary information on the sequence, phylogenicity and expression pattern of two important components of P450 systems, CPR and b5, in the diamondback moth (DBM), Plutella xylostella. These two genes were up-regulately expressed in the beta-cypermethrin resistance DBM population, and their expression could be induced by low concentration of beta-cypermethrin. Our results indicated their roles in DBM resistance to beta-cypermethrin. Further studies are needed to investigate their functions in individual P450mediated metabolic reaction and in other physiological processes in DBM. Conflict of interest The authors declare that there is no conflict of interest in this paper. Acknowledgments We sincerely appreciate Prof. J. R. Schrock (Emporia State University, USA) for revising the manuscript. This research is supported by the Special Fund for the Public Interest (Agriculture) (200903052) of the Ministry of Agriculture of China, and the ‘13115’ Sci-Tech Innovation Project of Shaanxi Province (2007ZDKG-14). References Andersen, J.F., Utermohlen, J.G., Feyereisen, R., 1994. Expression of housefly CYP6A1 and NADPH–cytochrome P450 reductase in Escherichia coli and reconstitution of an insecticide-metabolizing P450 system. Biochemistry 33, 2171–2177. APRD, 2014. Arthropod Pesticide Resistance Database. Michigan State Univ., East Lansing (http://www.pesticidesresistance.com/index.php [Accessed 10 June 2014]). Baek, J.H., Clark, J.M., Lee, S.H., 2010. Cross-strain comparison of cypermethrin-induced cytochrome P450 transcription under different induction conditions in diamondback moth. Pestic. Biochem. Physiol. 96, 43–50. Eziah, V.Y., Rose, H.A., Wilkes, M., Clift, A.D., 2009. Biochemical mechanisms of insecticide resistance in the diamondback moth (DBM) Plutella xylostella L. (Lepidoptera: Yponomeutidae), in the Sydney region, Australia. Aust. J. Entomol. 48, 321–327. Feyereisen, R., 1999. Insect P450 enzymes. Annu. Rev. Entomol. 44, 507–533. Furlong, M.J., Wright, D.J., Dosdall, L.M., 2013. Diamondback moth ecology and management: problems, progress, and prospects. Annu. Rev. Entomol. 58, 517–541. Gan, L., von Moltke, L.L., Trepanier, L.A., Harmatz, J.S., Greenblatt, D.J., Court, M.H., 2009. Role of NADPH–cytochrome P450 reductase and cytochrome-b5/NADH-b5 reductase in variability of CYP3A activity in human liver microsomes. Drug Metab. Dispos. 37, 90–96. Guo, Y.Q., Zhang, J.Z., Yang, M.L., Yan, L.Z., Zhu, K.Y., Guo, Y.P., Ma, E.B., 2012. Comparative analysis of cytochrome P450-like genes from Locusta migratoria manilensis: expression profiling and response to insecticide exposure. Insect Sci. 19, 75–85. Hannemann, F., Bichet, A., Ewen, K.M., Bernhardt, R., 2007. Cytochrome P450 systems—biological variations of electron transport chains. Biochim. Biophys. Acta Gen. Subj. 1770, 330–344.
Harrison, T.L., Zangerl, A.R., Schuler, M.A., Berenbaum, M.R., 2001. Developmental variation in cytochrome P450 expression in Papilio polyxenes in response to xanthotoxin, a hostplant allelochemicals. Arch. Insect Biochem. Physiol. 48, 179–189. Horike, N., Takemori, H., Nonaka, Y., Sonobe, H., Okamoto, M., 2000. Molecular cloning of NADPH–cytochrome P450 oxidoreductase from silkworm eggs. Eur. J. Biochem. 267, 6914–6920. Hovemann, B.T., Sehlmeyer, F., Malz, J., 1997. Drosophila melanogaster NADPH–cytochrome P450 oxidoreductase: pronounced expression in antennae may be related to odorant clearance. Gene 189, 213–219. Iqbal, M., Wright, D.J., 1997. Evaluation of resistance, cross-resistance and synergism of abamectin and teflubenzuron in a multi-resistant field population of Plutella xylostella (Lepidoptera: Plutellidae). Bull. Entomol. Res. 87, 481–486. Iwata, H., Fujita, K.I., Kushida, H., Suzuki, A., Konno, Y., Nakamura, K., Kamataki, T., 1998. High catalytic activity of human cytochrome P450 co-expressed with human NADPH–cytochrome P450 reductase in Escherichia coli. Biochem. Pharmacol. 55, 1315–1325. Jiang, H.B., Tang, P.A., Xu, Y.Q., An, F.M., Wang, J.J., 2010. Molecular characterization of two novel deltamethrin-inducible P450 genes from Liposcelis bostrychophila Badonnel (Psocoptera: Liposcelididae). Arch. Insect Biochem. Physiol. 74, 17–37. Jouraku, A., Yamamoto, K., Kuwazaki, S., Urio, M., Suetsugu, Y., Narukawa, J., Miyamoto, K., Kurita, K., Kanamori, H., Katayose, Y., Matsumoto, T., Noda, H., 2013. KONAGAbase: a genomic and transcriptomic database for the diamondback moth, Plutella xylostella. BMC Genomics 14, 464. Kaewpa, D., Boonsuepsakul, S., Rongnoparut, P., 2007. Functional expression of mosquito NADPH–cytochrome P450 reductase in Escherichia coli. J. Econ. Entomol. 100, 946–953. Kaspera, R., Naraharisetti, S.B., Evangelista, E.A., Marciante, K.D., Psaty, B.M., Totah, R.A., 2011. Drug metabolism by CYP2C8.3 is determined by substrate dependent interactions with cytochrome P450 reductase and cytochrome b5. Biochem. Pharmacol. 82, 681–691. Koener, J.F., Carino, F.A., Feyereisen, R., 1993. The cDNA and deduced protein sequence of house fly NADPH–cytochrome P450 reductase. Insect Biochem. Mol. Biol. 23, 439–447. Lamb, D.C., Kim, Y., Yermalitskaya, L.V., Yermalitsky, V.N., Lepesheva, G.I., Kelly, S.L., Waterman, M.R., Podust, L.M., 2006. A second FMN binding site in yeast NADPH–cytochrome P450 reductase suggests a mechanism of electron transfer by diflavin reductases. Structure 14, 51–61. Laursen, T., Jensen, K., Møller, B.L., 2011. Conformational changes of the NADPH–dependent cytochrome P450 reductase in the course of electron transfer to cytochromes P450. Biochim. Biophys. Acta Protein Proteomics 1814, 132–138. Lee, K.B., La Mar, G.N., Kehres, L.A., Fujinari, E.M., Smith, K.M., Pochapsky, T.C., Sligar, S.G., 1990. Proton NMR study of the influence of hydrophobic contacts on protein prosthetic group recognition in bovine and rat ferricytochrome b5. Biochemistry 29, 9623–9631. Li, X., Schuler, M.A., Berenbaum, M.R., 2007. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 52, 231–253. Liu, S., Liang, Q.M., Huang, Y.J., Yuan, X., Zhou, W.W., Qiao, F., Cheng, J., Gurr, G.M., Zhu, Z.R., 2013. Cloning, functional characterization, and expression profiles of NADPH–cytochrome P450 reductase gene from the Asiatic rice striped stem borer, Chilo suppressalis (Lepidoptera: Pyralidae). Comp. Biochem. Physiol. B 166, 225–231. Liu, S., Liang, Q.M., Zhou, W.W., Jiang, Y.D., Zhu, Q.Z., Yu, H., Zhang, C.X., Gurr, G.M., Zhu, Z.R., 2014. RNA interference of NADPH–cytochrome P450 reductase of the rice brown planthopper, Nilaparvata lugens, increases susceptibility to insecticides. Pest Manag. Sci. http://dx.doi.org/10.1002/ps.3760. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(− Delta Delta C(T)) method. Methods 25, 402–408. Lycett, G.J., McLaughlin, L.A., Ranson, H., Hemingway, J., Kafatos, F.C., Loukeris, T.G., Paine, M.J.I., 2006. Anopheles gambiae P450 reductase is highly expressed in oenocytes and in vivo knockdown increases permethrin susceptibility. Insect Mol. Biol. 15, 321–327. Maibeche-Coisne, M., Merlin, C., Francois, M.C., Porcheron, P., Jacquin-Joly, E., 2005. P450 and P450 reductase cDNAs from the moth Mamestra brassicae: cloning and expression patterns in male antennae. Gene 346, 195–203. Mathews, F.S., 1985. The structure, function and evolution of cytochromes. Prog. Biophys. Mol. Biol. 45, 1–56.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
X. Chen, Y. Zhang / Gene xxx (2014) xxx–xxx Mizutani, M., Ohta, D., 1998. Two isoforms of NADPH: cytochrome P450 reductase in Arabidopsis thaliana. Plant Physiol. 116, 357–367. Oprian, D.D., Coon, M.J., 1982. Oxidation-reduction states of FMN and FAD in NADPH–cytochrome P-450 reductase during reduction by NADPH. J. Biol. Chem. 257, 8935–8944. Pandey, A.V., Kempná, P., Hofer, G., Mullis, P.E., Flück, C.E., 2007. Modulation of human CYP19A1 activity by mutant NADPH P450 oxidoreductase. Mol. Endocrinol. 21, 2579–2595. Porter, T.D., 2002. The roles of cytochrome b5 in cytochrome P450 reactions. J. Biochem. Mol. Toxicol. 16, 311–316. Qiu, Y., Tittiger, C., Wicker-Thomas, C., Le Goff, G., Young, S., Wajnberg, E., Fricaux, T., Taquet, N., Blomquist, G., Feyereisen, R., 2012. An insect-specific P450 oxidative decarbonylase for cuticular hydrocarbon biosynthesis. Proc. Natl. Acad. Sci. U. S. A. 109, 14858–14863. Ranasinghe, C., Hobbs, A.A., 1999a. Induction of cytochrome P450 CYP6B7 and cytochrome b5 mRNAs from Helicoverpa armigera (Hubner) by pyrethroid insecticides in organ culture. Insect Mol. Biol. 8, 443–447. Ranasinghe, C., Hobbs, A.A., 1999b. Isolation and characterisation of a cytochrome b5 cDNA clone from Helicoverpa armigera (Hubner): possible involvement of cytochrome b5 in cytochrome P450 CYP6B7 activity towards pyrethroids. Insect Biochem. Mol. Biol. 29, 145–151. Ranasinghe, C., Campbell, B., Hobbs, A.A., 1998. Over-expression of cytochrome P450 CYP6B7 mRNA and pyrethroid resistance in Australian populations of Helicoverpa armigera (Hübner). Pestic. Sci. 54, 195–202. Schenkman, J.B., Jansson, I., 1999. Interactions between cytochrome P450 and cytochrome b5. Drug Metab. Rev. 31, 351–364. Schenkman, J.B., Jansson, I., 2003. The many roles of cytochrome b5. Pharmacol. Ther. 97, 139–152. Scott, J.G., 1999. Cytochromes P450 and insecticide resistance. Insect Biochem. Mol. Biol. 29, 757–777. Stevens, J.L., Snyder, M.J., Koener, J.F., Feyereisen, R., 2000. Inducible P450s of the CYP9 family from larval Manduca sexta midgut. Insect Biochem. Mol. Biol. 30, 559–568. Stevenson, B.J., Bibby, J., Pignatelli, P., Pignatelli, P., Muangnoicharoen, S., O'Neill, P.M., Lian, L.Y., Müller, P., Nikou, D., Steven, A., Hemingway, J., Sutcliffe, M.J., Paine, M.J., 2011. Cytochrome P450 6M2 from the malaria vector Anopheles gambiae metabolizes pyrethroids: sequential metabolism of deltamethrin revealed. Insect Biochem. Mol. Biol. 41, 492–502.
7
Talekar, N.S., Shelton, A.M., 1993. Biology, ecology, and management of the diamondback moth. Annu. Rev. Entomol. 38, 275–301. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tang, J., Cao, Y., Rose, R.L., Brimfield, A.A., Dai, D., Goldstein, J.A., Hodgson, E., 2001. Metabolism of chlorpyrifos by human cytochrome P450 isoforms and human, mouse, and rat liver microsomes. Drug Metab. Dispos. 29, 1201–1204. Tang, T., Zhao, C., Feng, X., Liu, X., Qiu, L., 2012. Knockdown of several components of cytochrome P450 enzyme systems by RNA interference enhances the susceptibility of Helicoverpa armigera to fenvalerate. Pest Manag. Sci. 68, 1501–1511. Vergeres, G., Waskell, L., 1995. Cytochrome b5, its functions, structure and membrane topology. Biochimie 77, 604–620. Vermilion, J.L., Ballou, D.P., Massey, V., Coon, M.J., 1981. Separate roles for FMN and FAD in catalysis by liver microsomal NADPH–cytochrome P-450 reductase. J. Biol. Chem. 256, 266–277. Wang, M., Roberts, D.L., Paschke, R., Shea, T.M., Masters, B.S.S., Kim, J.J.P., 1997. Threedimensional structure of NADPH–cytochrome P450 reductase: prototype for FMNand FAD-containing enzymes. Proc. Natl. Acad. Sci. U. S. A. 94, 8411–8416. You, M., Yue, Z., He, W., Yang, X., Yang, G., Xie, M., Zhan, D., Baxter, S.W., Vasseur, L., Gurr, G.M., Douglas, C.J., Bai, J., Wang, P., Cui, K., Huang, S., Li, X., Zhou, Q., Wu, Z., Chen, Q., Liu, C., Wang, B., Li, X., Xu, X., Lu, C., Hu, M., Davey, J.W., Smith, S.M., Chen, M., Xia, X., Tang, W., Ke, F., Zheng, D., Hu, Y., Song, F., You, Y., Ma, X., Peng, L., Zheng, Y., Liang, Y., Chen, Y., Yu, L., Zhang, Y., Liu, Y., Li, G., Fang, L., Li, J., Zhou, X., Luo, Y., Gou, C., Wang, J., Wang, J., Yang, H., Wang, J., 2013. A heterozygous moth genome provides insights into herbivory and detoxification. Nat. Genet. 45, 220–225. Zhang, H., Myshkin, E., Waskell, L., 2005. Role of cytochrome b5 in catalysis by cytochrome P450 2B4. Biochem. Biophys. Res. Commun. 338, 499–506. Zhao, C., Tang, T., Feng, X., Qiu, L., 2014. Cloning and characterisation of NADPHdependent cytochrome P450 reductase gene in the cotton bollworm, Helicoverpa armigera. Pest Manag. Sci. 70, 130–139. Zhu, F., Sams, S., Moural, T., Haynes, K.F., Potter, M.F., Palli, S.R., 2012. RNA interference of NADPH–cytochrome P450 reductase results in reduced insecticide resistance in the bed bug, Cimex lectularius. PLoS One 7, e31037.
Please cite this article as: Chen, X., Zhang, Y., Identification and characterization of NADPH-dependent cytochrome P450 reductase gene and cytochrome b5 gene from Plutella xyloste..., Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.053
