Environment Health Techniques 890
Marzia Salzillo et al.
Full Paper Identification and characterization of enolase as a collagen-binding protein in Lactobacillus plantarum Marzia Salzillo, Valeria Vastano, Ugo Capri, Lidia Muscariello, Margherita Sacco and Rosangela Marasco di Napoli, Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Universita Caserta, Italy
Collagen is a target of pathogens for adhesion, colonization, and invasion of host tissue. Probiotic bacteria can mimic the same mechanism as used by the pathogens in the colonization process, expressing cell surface proteins that specifically interact with extracellular matrix component proteins. The capability to bind collagen is expressed by several Lactobacillus isolates, including some Lactobacillus plantarum strains. In this study we report the involvement of the L. plantarum EnoA1 alfa-enolase in type I collagen (CnI) binding. By adhesion assays, we show that the mutant strain LM3-CC1, carrying a null mutation in the enoA1 gene, binds to immobilized collagen less efficiently than wild type strain. CnI overlay assay and Elisa tests, performed on the purified EnoA1, show that this protein can bind collagen both under denaturing and native conditions. By using truncated recombinant enolase proteins, we also show that the region spanning from 73rd to the 140th amino acid residues is involved in CnI binding. Keywords: Collagen I / Adhesins / Enolase / Probiotics Received: December 11, 2014; accepted: January 22, 2015 DOI 10.1002/jobm.201400942
Introduction The extracellular matrix (ECM) is an ubiquitous constituent of animal tissues whose proteins can be adhesion targets for bacterial pathogens in the infection processes [1, 2]. In many cases, adhesion to ECM components is the first critical step for virulence of several pathogens. Bacterial cell surface proteins play major roles in the adhesion of pathogens to the intestinal epithelium. Several studies show that ECMbinding proteins are not restricted to these microorganisms, as also commensal bacteria can bind to some components of the ECM, as collagen I, laminin, fibronectin, and fibrinogen [3–6]. Adhesion and colonization of host tissue are crucial steps also in the interaction of commensal bacteria with mucosal surface [7]. The adhesion ability of a strain to the intestinal
Correspondence: Dr. Rosangela Marasco, Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Universita di Napoli, via Vivaldi 43, Caserta 81100, Italy E-mail: [email protected] Phone: þ39-0823-274557 Fax: þ39-0823-274605 ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
mucosa is one of the features necessary to define a bacterium as probiotic [8, 9]. The genus Lactobacillus encompasses several species that are among the most widely commercialized probiotics, being frequently isolated from the human gastrointestinal tract of healthy individuals [10–12]. Their presence is important for equilibrating the endogenous microflora, for stimulating mucosal immunity, and for protecting the gut from invasion of pathogens by competitive exclusion [13]. The last mechanism includes the ability to adhere to host proteins, often through the same type of adhesins employed by pathogens as a strategy for gut colonization. Many pathogenic bacteria associated with respiratory, urogenital, or gastrointestinal tracts, colonize mucous surfaces by binding specific adhesins to collagen [2, 14]. Collagen (Cn) is the major glycoprotein of connective tissues and, up to date, 28 different types of collagens have been identified and described [1]. The type I collagen (CnI) is the major organic component of the human body and is the target for Cna and Ace proteins, the most studied collagen binding adhesins, characterized in Staphylococcus aureus and Enterococcus faecalis, respectively [15–17]. They belong to the family
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
of collagen-binding MSCRAMMS (microbial surface components recognizing adhesive matrix molecule), which also includes Acm from Enterococcus faecium, Cne from Streptococcus equi, and Cnm from Streptococcus mutants [18–20]. These proteins contain an N-terminal signal peptide, followed by ligand binding domain in the so-called A region, a segment composed of repeated motifs often known as the B domains and a C-terminus essential for sortase-dependent anchoring to the cell wall [21]. However, other collagen binding protein domains have been also described. Human pathogenic streptococcal M proteins bind Cn via a PARF motif (peptide associated with rheumatic fever) located in their N-terminal hypervariable region [22]. In the enteropathogen Yersinia enterocolitica, the YadA outer membrane protein forms a ``lollipop-like structure,'' whose head region is required for CnI binding [23, 24]. Cn binding proteins have been also described for different Lactobacilli species. The N-terminal region of CbsA surface (S)-layer protein binds to Cn I and IV in Lactobacillus crispatus [25]. In a recent study, Sun and coworkers [26] showed that SlpB, another L. crispatus Slayer protein, binds Cn via a N-terminus domain. A surface layer Cn binding protein from Lactobacillus plantarum 91 inhibits the adhesion of Escherichia coli 0157:H7 on immobilized Cn [5]. Several microbial ECMbinding adhesins, identified in pathogens and in some species of Lactobacillus, are moonlighting proteins expressing different functions in separate cell domains [27]. Alfa-enolase has been included in this family of ``anchorless'' surface proteins and has been reported to bind ECM components in pathogens as well as in commensal lactic acid bacteria [28]. The aim of this work was to study the adhesion ability of L. plantarum LM3 to Cn, in order to investigate putative competitive exclusion mechanisms involving this strain. In this respect, here we show the characterization of the L. plantarum enolase EnoA1 as a Cn adhesin and the identification of its Cn binding region.
Materials and methods Bacterial strains and culture conditions L. plantarum LM3 (wt), LM3-CC1 (DenoA1) [3], were used throughout this study. L. plantarum was grown in MRS medium at 30 °C, and when needed, erythromycin (5 mg/ ml) was added to the medium. E. coli was grown at 37 °C in TY broth, and when needed, ampicillin 100 mg/ml was added to the medium.
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
891
Resolution of Lactobacillus cell wall proteins by twodimensional electrophoresis (2DE) The cell wall fraction was obtained as described previously [3]. Five hundred micrograms (wet wt) of cell wall material, obtained by ultracentrifugation of Frenchpressed L. plantarum LM3 and LM3-CC1 cells, were treated as described by Vastano and coworkers [6]. The cell wall fraction was solubilized and 2DE was carried out as previously reported [3]. CnI overlay assay The proteins resolved by 2DE or recombinant EnoA1 (rEnoA1), subjected to SDS-PAGE (10%), were transferred to an Immuno-Blot PVDF membrane (Bio-Rad, Inc.) using the Mini Trans-Blot equipment (Bio-Rad, Inc.) at 35 V, 4 °C, for 16 h in Towbin Buffer (20 mM Tris base, 192 mM glycin, 20% methanol, pH 8.3). To detect binding, overlay assays were performed as described [3]. Briefly, the PVDF membrane, after blocking was incubated with 0.3 mg/ml of human CnI (Calbiochem) in PBS, overnight at 4 °C. CnI binding was detected by incubating the membrane with mouse anti-CnI IgG antibody (Calbiochem) and with peroxidase conjugated antimouse IgG (Amersham, GE Healthcare) as secondary antibody. The bound antibodies were revealed with ECL PLUS kit (Amersham, GE Healthcare). Protein identification by peptide mass fingerprinting For protein identification mass spectrometry data were searched against the NCBI_nr database using the MASCOT search algorithm (http://www.matrixscience. com/), and the parameters were described previously [3]. Adhesion of bacteria to CnI-coated surfaces Adhesion assays were performed as described previously [3]. Briefly, L. plantarum LM3 and LM3-CC1 were grown in MRS broth for 12 h at 30 °C. Cells were harvested by centrifugation at 3000 g for 15 min at 4 °C and washed for three times with PBS; the pellets were resuspended in 50 mM Tris-HCl at pH 7.5 and incubated at 30 °C for 1 h. Cells were harvested by centrifugation and resuspended in Dulbecco's modified Eagle's medium (DMEM) with 2% fetal bovine serum (FBS, Invitrogen). Microtiter plates (96 wells) were coated with CnI (0.25 mg/well) at 4 °C overnight and subsequently blocked with 2% BSA for 1 h at 37 °C. After three washes with PBS in the presence of 0.05% Tween 20 (PBST), 100 ml bacterial suspension containing 5 108 CFU in DMEM was added, and after 2 h of incubation at 37 °C the wells were washed three times with PBST. Adherent bacteria were detached from the wells by
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
892
Marzia Salzillo et al.
adding 100 ml of 10% trypsin and quantified by real-time PCR as previously reported [3]. Expression and purification of recombinant EnoA1 (rEnoA1) L. plantarum LM3 chromosomal DNA was used as template in PCR reactions and the enoA1 gene was amplified with the oligonucleotides EnoA1 FOR and EnoA1 REV (Table 1). The PCR product was cloned in the expression vector pGEX-6P-1. GST-tagged EnoA1 was expressed in E. coli BL21 and was purified by affinity chromatography under native conditions on sepharose resin [29]. ELISA test Ninety-six well microtiter plates were coated with CnI (2 mg/well) for 1 h at 37 °C and at 4 °C overnight. After three PBST washing, plates were blocked with 200 ml of BSA 2% in PBS for 2 h at 37 °C. After PBST washing, wells were incubated with the rEnoA1 (1.35 mM) for 2 h at 37 °C and washed three times with PBST. Bound proteins were detected by the addition of mouse antiGST IgG antibody (1:2,000; Abcam) followed by goat anti-mouse IgG horseradish peroxidase (HPR)-conjugated antibody (1: 40,000; GE Healthcare). Bound HPRconjugated antibodies were detected using 1-Step Slow TMB-ELISA kit (Pierce). Wells incubated with GST were utilized as negative control for CnI binding. Absorbance at 450 nm was measured using a Bio-Rad 680 Microplate Reader (Bio-Rad). Analysis was repeated four times and CnI binding measures were repeated in triplicate. Characterization of the CnI binding region in EnoA1 The complete EnoA1 protein (442 aa) was divided into three parts, EnoA11–61 (F1), EnoA161–209 (F2), and
EnoA1209–442 (F3), which were expressed in E. coli and purified as described above, using the primers pairs EnoA1 FOR/A1_REV, A2_FOR/A2_REV, and A3_FOR/ EnoA1 REV, respectively (Table 1). Next, F1 and F2 fragments were further divided into five sub-fragments F41–73, F51–104, F6104–209, F773–140, and F8140–209 which were amplified using the primers pairs EnoA1 FOR/ A4_REV, EnoA1 FOR/A5_REV, A6_FOR/A2_REV, A7_FOR/ A7_REV, A8_FOR/A2_REV, respectively and, subsequently, expressed and purified (Table 1). CnI binding ability of all constructs was tested by CnI overlay assay as described above.
Results L. plantarum surface proteins bind human CnI To identify putative CnI binding adhesins in L. plantarum LM3, a CnI overlay assay was performed on surface proteins, resolved by two-dimensional electrophoresis (Fig. 1). Among Cn-binding proteins, we analyzed the protein spot showing an apparent molecular mass of 48 kDa and pI 4.6. (Fig. 1B). By means of MALDI-TOF analysis, this protein was identified as the a-enolase EnoA1, encoded by enoA1 gene, one of two eno genes expressed in L. plantarum [3]. In order to prove the involvement of the surface EnoA1 in LM3 adhesion to CnI, the extent of binding of LM3 and of its mutant strain LM3-CC1, carrying a null mutation in the enoA1 gene, was analyzed on CnI-coated microtiter plates [3]. Adhesion of both strains was evaluated by real-time PCR, amplifying the 16S ribosomal DNA with species-specific primers [30]. A significant difference was found in the ability of LM3 and LM3-CC1 to bind CnI, with wild type cells about sixfold more efficient than mutant cells (p < 0.05; Fig. 2).
Table 1. Primers used in this study. Sequence 50 –30
Primers EnoA1 FOR EnoA1 REV A1_REV A2_FOR A2_REV A3_FOR A4_REV A5_REV A6_FOR A7_FOR A7_REV A8_FOR
CGGGATCCATGTCTATTATTACAGATATTTATGC AACATGGTCGACTTACTTGCTAGTAATGGTGTTCCG AACATGGTCGACTTAGCCCATGAAACGGCTCTTGTCACC CGGGATCCGGCAAGGGTGTTACTAAAGCCG AACATGGTCGACTACGCAAAACCACCTTCGTCACC CGGGATCCGCGCCTGACTTGAAGAACAACG AACATGGTCGACTTACTTGTTAACATTGTCAACGGC AACATGGTCGACTTAAGCTTTGTTAGGAGTACCATC CGGGATCCGCTAAGTTAGGCGCTAACGC CGGGATCCAAGTTAATTGCTAAGGAAATTG AACATGGTCGACTTAGTGAGCGTTGAATCCGCCAAG CGGGATCCCACGTTTTACCAACACCAATG
Restriction endonuclease sites are in bold. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
893
Figure 1. Identification of CnI binding surface proteins of L. plantarum LM3 by 2DE and MALDI-TOF analysis. (A) 2DE of surface proteins stained with coomassie brilliant blue. (B) Chemiluminescent detection after peroxidase assay. The spot corresponding to EnoA1 (Acc. N. gi| 28377645) is circled [3].
Binding of CnI to recombinant EnoA1 In order to further characterize the CnI binding activity of EnoA1, the corresponding enoA1 gene was cloned in the expression vector pGEX-6P-1; the recombinant GSTtagged EnoA1 (rEnoA1) was purified by affinity chromatography and used to perform CnI overlay assays. Figure 3 shows the binding of rEnoA1 to CnI, while no interaction between CnI and GST (negative control) was detected (lanes 1 and 2, respectively). The rEnoA1 binding ability was also assessed by ELISA assays using immobilized collagen and GST as negative control. The EnoA1 and GST binding levels were expressed as difference of A450 measured in CnI and BSA coated wells. As shown in Fig. 4, rEnoA1 exhibited significant level of adhesion to CnI, with values 10-fold higher than the level obtained with the GST protein. Mapping of CnI binding region in L. plantarum EnoA1 In order to identify the region/s of EnoA1 that elicits CnI binding activity, the protein was divided into three parts, EnoA11–61 (F1), EnoA161–209 (F2), and EnoA1209–442 (F3) which were expressed and purified (Fig. 5A). CnI overlay assays were performed on the three recombinant fragments, the EnoA1 complete recombinant protein, and the GST protein. As shown in Fig. 5B, only the F2 fragment and rEnoA1 reacted with CnI while no signal was obtained for the other recombinant proteins and the GST (negative control). This suggested that the CnI binding region was localized between amino acid residues 61–209 and the N- and C-terminal regions were not required for CnI binding. Further characterization of the CnI binding region was undertaken expressing other three protein fragments, F41–73, F51–104, F6104–209. CnI overlay assays, performed on these constructs, showed that only the F5 and F6 fragments retained CnI binding ability (Fig. 5C). However, since the F1 and the F4 ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
fragments were negative in the binding assays (Fig. 5B and C), we assumed that only the C-terminal portion (amino acid residues 73–104) of the F5 fragment was involved in the CnI binding activity. To further shorten the EnoA1 fragment for binding activity analysis, we tested the F773–140 and F8140–209 fragments that include the CnI binding region of F5 and the F6 fragment. Figure 5D shows that the F7 fragment, but not the F8 fragment, retained the CnI binding activity. Taken together these results indicate that the CnI binding region of EnoA1 lies within a fragment spanning from the 73rd to the 140th amino acid residues.
Discussion Adhesion of pathogens to host tissue is a crucial early step in the infectious process. Probiotic bacteria can mimic the initial mechanisms used by the pathogens in
Figure 2. Binding of LM3 (w.t.) and LM3-CC1 (DenoA1) to CnI immobilized on microtiter plate wells. Error bars represent standard deviation of the mean values (p < 0.05).
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
894
Marzia Salzillo et al.
Figure 3. CnI overlay assay. (A) PVDF membrane stained with Ponceau S. (B) Chemiluminescent signal detected by ChemiDoc XRS System. MK, molecular weight marker; lane 1, GST-tagged enolase; lane 2, GST.
the adhesion step, thus competing with them for host receptors at the intestinal mucosa. For this reason, a basic property for the selection of probiotic strains is their ability to adhere to the human intestinal cells [31]. The probiotic characteristics of L. plantarum have been extensively described in many scientific reports, and interactions of some strains with endothelial cells, mucus, and extracellular matrix (ECM) components
Figure 4. ELISA detection of EnoA1 binding to immobilized CnI. Nonspecific adherence to BSA-coated wells was subtracted from binding to Cn-coated wells and GST was chosen as a negative control. Data represent the mean standard deviation from three separate experiments (three microtiter wells per experiment) (p < 0.05). ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
have also been reported [5, 32–34]. L. plantarum adhesion to human intestinal tract is dependent on binding of specific adhesins. Some of these are cytoplasmic proteins exerting moonlighting functions when expressed on cell surface [3, 6, 35–37]. The term moonlighting was introduced to describe the ability of proteins to have more than one function. Many well-known proteins such as metabolic enzymes and molecular chaperones are now recognized as moonlighting proteins with activity of adhesion or modulation of cell signaling processes [38]. The presence of cytoplasmic enzymes on cell surfaces has been also observed in a variety of pathogenic bacteria [2, 39–41] and in commensal Lactobacillus species [4]. In previous works, we showed the involvement of the L. plantarum LM3 surface displaced enolase (EnoA1) in Fn binding and demonstrated the significance of its surface localization in adhesion to fibronectin (Fn) [3]. Bove and coworkers [42] reported that the L. plantarum enoA1 expression was induced at pH 3, which is a condition encountered during the gastric transit. Enolases are metabolic enzymes and important virulence factors for streptococci, staphylococci, and mycoplasma pathogens, where they are also expressed as surface proteins mediating cell adhesion and invasion. Indeed, some reports have demonstrated a direct role of enolase in bacterial pathogenesis [40, 43]. It has been reported that Streptococcus sorbinus recombinant enolase can be used to protect against dental caries in the rat [44]. In order to adhere to and invade host tissues, many gastrointestinal, urogenital, oral, and skin pathogens are able to bind several human collagen isotypes [2]. Antikainen and coworkers [28] have reported that the Lactobacillus crispatus and Staphylococcus aureus enolases can adhere to CnI. In this study, we demonstrated the involvement of the L. plantarum LM3 EnoA1 in CnI binding. The occurrence of CnI and Fn binding for EnoA1 shows that this protein is a multi-functional binding adhesin which can interact with more than one ECM component, as reported for other adhesins [41]. By in silico analysis we were not able to find Cn-binding domains described in other bacterial adhesins [1]. CnI overlay assay and ELISA test performed on the EnoA1 purified protein demonstrated that EnoA1 can bind CnI both under denaturing and native conditions. Analysis of the CnI binding ability of the LM3-CC1 strain, carrying a null mutation in the enoA1 gene, shows that EnoA1 contributes significantly to LM3 adhesion to CnI. Using recombinant derivatives of the protein, we also demonstrated that the EnoA1 fragment, localized between amino acid residues 73–140, is involved in CnI binding. Our results also suggest that the EnoA1 regions spanning from 73rd to 104th amino acid
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
895
Figure 5. Identification of the CnI binding region in EnoA1. (A) Schematic representation of EnoA1 and derived protein portions used for production of recombinant GST-tagged protein fragments (F1–F8). (B–D) CnI overlay assays performed on F1–F8 fragments. The GST and rEnoA1 were used as negative and positive control, respectively. (B) CnI overlay assay performed on GST (lane 1), rEnoA1 (lane 2), F1 (lane3), F2 (lane 4), and F3 (lane 5). (C) CnI overlay assay performed on GST (lane 1), F4 (lane 2), F5 (lane 3), F6 (lane 4), and F2 used as positive control (lane 5). (D) CnI overlay assay performed on GST (lane 1), rEnoA1 (lane 2), F7 (lane 3), and F8 (lane 4). MK, molecular weight marker.
residues and from 104th to 140th amino acid residues are both sufficient for CnI interaction. To our knowledge, this is the first study to characterize the interaction of a bacterial enolase to human collagen. Study of effector molecules in probiotic bacteria and of their corresponding receptors in the host cells can contribute to the development of strains with enhanced health benefits. Moreover, identification of binding domains within microbial adhesins, may be potentially useful to design inhibitors of the complex bacterial adhesins/host receptors, thus contributing to development of future antimicrobial therapies. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Conflict of interest All authors declare that there are no financial/commercial conflicts of interest.
References [1] Chagnot, C., Listrat, A., Astruc, T., Desvaux, M., 2012. Bacterial adhesion to animal tissues: protein determinants for recognition of extracellular matrix components. Cell. Microbiol., 14, 1687–1696.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
896
Marzia Salzillo et al.
[2] Singh, B., Fleury, C., Jalalvand, F., Riesbeck, K., 2012. Human pathogens utilize host extracellular matrix proteins laminin an collagen for adhesion and invasion of the host. FEMS Microbiol. Rev., 36, 1122–1180. [3] Castaldo, C., Vastano, V., Siciliano, R.A., Candela, M. et al., 2009. Surface displaced alfa-enolase of Lactobacillus plantarum is a fibronectin binding protein. Microb. Cell. Fact., 8, DOI: 10.1186/1475-2859-8-14 [4] Sengupta, R., Altermann, E., Anderson, R.C., McNabb, W.C. et al., 2013. The role cell surface architecture of lactobacilli in host-microbe interactions in the gastrointestinal tract. Mediators Inflamm., DOI: 10.1155/2013/ 237921 [5] Yadav, A.K., Tyagi, A., Kaushik, J.K., Saklani, A.C. et al., 2013. Role of surface layer collagen binding protein from indigenous Lactobacillus plantarum 91 in adhesion and its anti-adhesion potential against gut pathogen. Microbiol. Res., 168, 639–645. [6] Vastano, V., Salzillo, M., Siciliano, R.A., Muscariello, L. et al., 2014. The E1 beta-subunit of pyruvate dehydrogenase is surface-expressed in Lactobacillus plantarum and binds fibronectin. Microbiol. Res., 169, 121–127. [7] Juge, N., 2012. Microbial adhesins to gastrointestinal mucus. Trends Microbiol., 20, 30–39. [8] Martın R.L., Sanchez, B., Suarez, J.E., Urdaci, M.C., 2012. Characterization of the adherence properties of human Lactobacilli strains to be used as vaginal probiotics. FEMS Microbiol. Lett., 328, 166–173. [9] Valeriano, V.D., Parungao-Balolong, M.M., Kang, D.K., 2014. In vitro evaluation of the mucin-adhesion ability and probiotic potential of Lactobacillus mucosae LM1. J. Appl. Microbiol., 117, 485–497. [10] Gareau, M.G., Sherman, P.M., Walker, W.A., 2010. Probiotics and the gut microbiota in intestinal health and disease. Nat. Rev. Gastroenterol. Hepatol., 7, 503–514. [11] Chapman, C.M., Gibson, G.R., Rowland, I., 2011. Health benefits of probiotics: are mixtures more effective than single strains. Eur. J. Nutr., 50, 1–17. [12] Bron, P.A., Tomita, S., Mercenier, A., Kleerebezem, M., 2013. Cell surface-associated compounds of probiotic lactobacilli sustain the strain-specificity dogma. Curr. Opin. Microbiol., 16, 262–269. [13] Remus, D.M., Bongers, R.S., Meijerink, M., Fusetti, F. et al., 2013. Impact of Lactobacillus plantarum sortase on target protein sorting, gastrointestinal persistence, and host immune response modulation. J. Bacteriol., 195, 502–509. €rgelin, M., Olin, A.I., von Pawel-Rammingen, [14] Bober, M., Mo U., Collin, M., 2011. The membrane bound LRR lipoprotein Slr, and the cell wall-anchored M1 protein from Streptococcus pyogenes both interact with type I collagen. PLoS ONE 6, e20345. [15] Zong, Y., Xu, Y., Liang, X., Keene, D.R. et al., 2005. A `Collagen Hug' model for Staphylococcus aureus CNA binding to collagen. EMBO J., 24, 4224–4236. [16] Liu, Q., Ponnuraj, K., Xu, Y., Ganesh, V.K. et al., 2007. The Enterococcus faecalis MSCRAMM ACE binds its ligand by the Collagen Hug model. J. Biol. Chem., 282, 19629–19637.
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
[17] Vengadesan, K., Narayana, S.V., 2011. Structural biology of Gram-positive bacterial adhesins. Protein Sci., 20, 759–772. [18] Nallapareddy, S.R., Weinstock, G.M., Murray, B.E., 2003. Clinical isolates of Enterococcus faecium exhibit strainspecific collagen binding mediated by Acm, a new member of the MSCRAMM family. Mol. Microbiol., 47, 1733–1747. [19] Nakano, K., Nomura, R., Taniguchi, N., Lapirattanakul, J. et al., 2010. Molecular characterization of Streptococcus mutans strains containing the cnm gene encoding a collagen-binding adhesin. Arch. Oral Biol., 55, 34–39. [20] van Wieringen, T., Kalamajski, S., Liden, A., Bihan, D. et al., 2010. The streptococcal collagen-binding protein CNE specifically interferes with alphaVbeta3-mediated cellular interactions with triple helical collagen. J. Biol. Chem., 285, 35803–35813. [21] Kang, M., Ko, Y.P., Liang, X., Ross, C.L. et al., 2013. Collagen-binding Microbial Surface Components Recognizing Adhesive Matrix Molecule (MSCRAMM) of Grampositive bacteria inhibit complement activation via the classical pathway J. Biol. Chem., 288, 20520–20531. [22] Reissmann, S., Gillen, C.M., Fulde, M., Bergmann, R. et al., 2012. Region specific and worldwide distribution of collagen-binding M proteins with PARF motifs among human pathogenic streptococcal isolates. PLoS ONE 7, e30122. [23] Leo, J.C., Elovaara, H., Bihan, D., Pugh, N. et al., 2010. First analysis of a bacterial collagen-binding protein with collagen Toolkits: promiscuous binding of YadA to collagens may explain how YadA interferes with host processes. Infect. Immun., 78, 3226–3236. [24] Mikula, K.M., Kolodziejczy, k.R., Goldman, A., 2013. Yersinia infection tools-characterization of structure and function of adhesins. Front. Cell. Infect. Microbiol., 2, 169. [25] Antikainen, J., Anton, L., Sillanpa€a€, J., Korhonen, T.K., 2002. Domains in the S-layer protein CbsA of Lactobacillus crispatus involved in adherence to collagens, laminin and lipoteichoic acids and in self-assembly. Mol. Microbiol., 46, 381–394. [26] Sun, Z., Kong, J., Hu, S., Kong, W. et al., 2013. Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen. Appl. Microbiol. Biotechnol., 97, 1941–1952. [27] Kainulainen, V1., Loimaranta, V., Pekkala, A., Edelman, S. et al., 2012. Glutamine synthetase and glucose-6-phosphate isomerase are adhesive moonlighting proteins of Lactobacillus crispatus released by epithelial cathelicidin LL37. J. Bacteriol., 194, 2509–2519. [28] Antikainen, J., Kuparinen, V., L€ahteenma€ki, K., Korhonen, T.K., 2007. Enolases from gram-positive bacterial pathogens and commensal lactobacilli share functional similarity in virulence-associated traits. FEMS Immunol. Med. Microbiol., 51, 526–534. [29] Dian, C., Eshaghi, S., Urbig, T., McSweeney, S. et al., 2002. Strategies for the purification and on-column cleavage of glutathione-S-transferase fusion target proteins. J. Chromatogr. B. Analyt. Technol. Biomed. Life Sci., 769, 133–144.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
[30] Heilig, H.G., Zoetendal, E.G., Vaughan, E.E., Marteau, P. et al., 2002. Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16 S ribosomal DNA. Appl. Environ. Microbiol., 68, 114–123. [31] Oelschlaeger, T.A., 2010. Mechanisms of probiotic actions. Int. J. Med. Microbiol., 300, 57–62. [32] Sanchez, B., Schmitter, J.M., Urdaci, M.C., 2009. Identification of novel proteins secreted by Lactobacillus plantarum that bind to mucin and fibronectin. J. Mol. Microbiol. Biotechnol., 17, 158–162. [33] Glenting, J., Beck, H.C., Vrang, A, Riemann, H. et al., 2013. Anchorless surface associated glycolytic enzymes from Lactobacillus plantarum 299v bind to epithelial cells and extracellular matrix proteins. Microbiol. Res., 168, 245–253. [34] Botta, C., Langerholc, T., Cencic, A., Cocolin, L., 2014. In vitro selection and characterization of new probiotic candidates from table olive microbiota. PLoS ONE 9, e94457. [35] Kinoshita, H., Uchida, H., Kawai, Y., Kawasaki, T. et al., 2008. Cell surface Lactobacillus plantarum LA 318 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) adheres to human colonic mucin. J. Appl. Microbiol., 104, 1667–1674. [36] Ramiah, K., van Reenen, C.A., Dicks, L.M., 2007. Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus plantarum 423, monitored with real-time PCR. Int. J. Food Microbiol., 116, 405–409. [37] Vastano, V., Capri, U., Candela, M., Siciliano, R.A. et al., 2013. Identification of binding sites of Lactobacillus
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
897
plantarum enolase involved in the interaction with human plasminogen. Microbiol. Res., 168, 65–72. [38] Kainulainen, V., Korhonen, T.K., 2014. Dancing to another tune-adhesive moonlighting proteins in bacteria. Biology (Basel), 3, 178–204. [39] Dallo, S.F., Kannan, T.R., Blaylock, M.W., Baseman, J.B., 2002. Elongation factor Tu and E1 beta subunit of pyruvate dehydrogenase complex act as fibronectin binding proteins in Mycoplasma pneumoniae. Mol. Microbiol., 46, 1041– 1051. [40] Bergmann, S., Wild, D., Diekmann, O., Frank, R. et al., 2003. Identification of a novel plasmin(ogen)-binding motif in surface displayed alpha-enolase of Streptococcus pneumoniae. Mol. Microbiol., 49, 411–423. [41] Thomas, C., Jacobs, E., Dumke, R., 2013. Characterization of pyruvate dehydrogenase subunit B and enolase as plasminogen-binding proteins in Mycoplasma pneumoniae. Microbiology, 159, 352–365. [42] Bove, P., Russo, P., Capozzi, V., Gallone, A. et al., 2013. Lactobacillus plantarum passage through an oro-gastrointestinal tract simulator: carrier matrix effect and transcriptional analysis of genes associated to stress and probiosis. Microbiol. Res., 168, 351–359. [43] Feng, Y., Pan, X., Sun, W., Wamg, C. et al., 2009. Streptococcus suis enolase functions as a protective antigen displayed on the bacterial cell surface. J. Infect. Dis., 200, 1583–1592. [44] Dinis, M., Tavares, D., Veiga-Malta, I., Fonseca, A.J. et al., 2009. Oral therapeutic vaccination with Streptococcus sobrinus recombinant enolase confers protection against dental caries in rats. J. Infect. Dis., 199, 116–123.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Marzia Salzillo et al.
Full Paper Identification and characterization of enolase as a collagen-binding protein in Lactobacillus plantarum Marzia Salzillo, Valeria Vastano, Ugo Capri, Lidia Muscariello, Margherita Sacco and Rosangela Marasco di Napoli, Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Universita Caserta, Italy
Collagen is a target of pathogens for adhesion, colonization, and invasion of host tissue. Probiotic bacteria can mimic the same mechanism as used by the pathogens in the colonization process, expressing cell surface proteins that specifically interact with extracellular matrix component proteins. The capability to bind collagen is expressed by several Lactobacillus isolates, including some Lactobacillus plantarum strains. In this study we report the involvement of the L. plantarum EnoA1 alfa-enolase in type I collagen (CnI) binding. By adhesion assays, we show that the mutant strain LM3-CC1, carrying a null mutation in the enoA1 gene, binds to immobilized collagen less efficiently than wild type strain. CnI overlay assay and Elisa tests, performed on the purified EnoA1, show that this protein can bind collagen both under denaturing and native conditions. By using truncated recombinant enolase proteins, we also show that the region spanning from 73rd to the 140th amino acid residues is involved in CnI binding. Keywords: Collagen I / Adhesins / Enolase / Probiotics Received: December 11, 2014; accepted: January 22, 2015 DOI 10.1002/jobm.201400942
Introduction The extracellular matrix (ECM) is an ubiquitous constituent of animal tissues whose proteins can be adhesion targets for bacterial pathogens in the infection processes [1, 2]. In many cases, adhesion to ECM components is the first critical step for virulence of several pathogens. Bacterial cell surface proteins play major roles in the adhesion of pathogens to the intestinal epithelium. Several studies show that ECMbinding proteins are not restricted to these microorganisms, as also commensal bacteria can bind to some components of the ECM, as collagen I, laminin, fibronectin, and fibrinogen [3–6]. Adhesion and colonization of host tissue are crucial steps also in the interaction of commensal bacteria with mucosal surface [7]. The adhesion ability of a strain to the intestinal
Correspondence: Dr. Rosangela Marasco, Dipartimento di Scienze e Tecnologie Ambientali, Biologiche e Farmaceutiche, Seconda Universita di Napoli, via Vivaldi 43, Caserta 81100, Italy E-mail: [email protected] Phone: þ39-0823-274557 Fax: þ39-0823-274605 ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
mucosa is one of the features necessary to define a bacterium as probiotic [8, 9]. The genus Lactobacillus encompasses several species that are among the most widely commercialized probiotics, being frequently isolated from the human gastrointestinal tract of healthy individuals [10–12]. Their presence is important for equilibrating the endogenous microflora, for stimulating mucosal immunity, and for protecting the gut from invasion of pathogens by competitive exclusion [13]. The last mechanism includes the ability to adhere to host proteins, often through the same type of adhesins employed by pathogens as a strategy for gut colonization. Many pathogenic bacteria associated with respiratory, urogenital, or gastrointestinal tracts, colonize mucous surfaces by binding specific adhesins to collagen [2, 14]. Collagen (Cn) is the major glycoprotein of connective tissues and, up to date, 28 different types of collagens have been identified and described [1]. The type I collagen (CnI) is the major organic component of the human body and is the target for Cna and Ace proteins, the most studied collagen binding adhesins, characterized in Staphylococcus aureus and Enterococcus faecalis, respectively [15–17]. They belong to the family
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
of collagen-binding MSCRAMMS (microbial surface components recognizing adhesive matrix molecule), which also includes Acm from Enterococcus faecium, Cne from Streptococcus equi, and Cnm from Streptococcus mutants [18–20]. These proteins contain an N-terminal signal peptide, followed by ligand binding domain in the so-called A region, a segment composed of repeated motifs often known as the B domains and a C-terminus essential for sortase-dependent anchoring to the cell wall [21]. However, other collagen binding protein domains have been also described. Human pathogenic streptococcal M proteins bind Cn via a PARF motif (peptide associated with rheumatic fever) located in their N-terminal hypervariable region [22]. In the enteropathogen Yersinia enterocolitica, the YadA outer membrane protein forms a ``lollipop-like structure,'' whose head region is required for CnI binding [23, 24]. Cn binding proteins have been also described for different Lactobacilli species. The N-terminal region of CbsA surface (S)-layer protein binds to Cn I and IV in Lactobacillus crispatus [25]. In a recent study, Sun and coworkers [26] showed that SlpB, another L. crispatus Slayer protein, binds Cn via a N-terminus domain. A surface layer Cn binding protein from Lactobacillus plantarum 91 inhibits the adhesion of Escherichia coli 0157:H7 on immobilized Cn [5]. Several microbial ECMbinding adhesins, identified in pathogens and in some species of Lactobacillus, are moonlighting proteins expressing different functions in separate cell domains [27]. Alfa-enolase has been included in this family of ``anchorless'' surface proteins and has been reported to bind ECM components in pathogens as well as in commensal lactic acid bacteria [28]. The aim of this work was to study the adhesion ability of L. plantarum LM3 to Cn, in order to investigate putative competitive exclusion mechanisms involving this strain. In this respect, here we show the characterization of the L. plantarum enolase EnoA1 as a Cn adhesin and the identification of its Cn binding region.
Materials and methods Bacterial strains and culture conditions L. plantarum LM3 (wt), LM3-CC1 (DenoA1) [3], were used throughout this study. L. plantarum was grown in MRS medium at 30 °C, and when needed, erythromycin (5 mg/ ml) was added to the medium. E. coli was grown at 37 °C in TY broth, and when needed, ampicillin 100 mg/ml was added to the medium.
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
891
Resolution of Lactobacillus cell wall proteins by twodimensional electrophoresis (2DE) The cell wall fraction was obtained as described previously [3]. Five hundred micrograms (wet wt) of cell wall material, obtained by ultracentrifugation of Frenchpressed L. plantarum LM3 and LM3-CC1 cells, were treated as described by Vastano and coworkers [6]. The cell wall fraction was solubilized and 2DE was carried out as previously reported [3]. CnI overlay assay The proteins resolved by 2DE or recombinant EnoA1 (rEnoA1), subjected to SDS-PAGE (10%), were transferred to an Immuno-Blot PVDF membrane (Bio-Rad, Inc.) using the Mini Trans-Blot equipment (Bio-Rad, Inc.) at 35 V, 4 °C, for 16 h in Towbin Buffer (20 mM Tris base, 192 mM glycin, 20% methanol, pH 8.3). To detect binding, overlay assays were performed as described [3]. Briefly, the PVDF membrane, after blocking was incubated with 0.3 mg/ml of human CnI (Calbiochem) in PBS, overnight at 4 °C. CnI binding was detected by incubating the membrane with mouse anti-CnI IgG antibody (Calbiochem) and with peroxidase conjugated antimouse IgG (Amersham, GE Healthcare) as secondary antibody. The bound antibodies were revealed with ECL PLUS kit (Amersham, GE Healthcare). Protein identification by peptide mass fingerprinting For protein identification mass spectrometry data were searched against the NCBI_nr database using the MASCOT search algorithm (http://www.matrixscience. com/), and the parameters were described previously [3]. Adhesion of bacteria to CnI-coated surfaces Adhesion assays were performed as described previously [3]. Briefly, L. plantarum LM3 and LM3-CC1 were grown in MRS broth for 12 h at 30 °C. Cells were harvested by centrifugation at 3000 g for 15 min at 4 °C and washed for three times with PBS; the pellets were resuspended in 50 mM Tris-HCl at pH 7.5 and incubated at 30 °C for 1 h. Cells were harvested by centrifugation and resuspended in Dulbecco's modified Eagle's medium (DMEM) with 2% fetal bovine serum (FBS, Invitrogen). Microtiter plates (96 wells) were coated with CnI (0.25 mg/well) at 4 °C overnight and subsequently blocked with 2% BSA for 1 h at 37 °C. After three washes with PBS in the presence of 0.05% Tween 20 (PBST), 100 ml bacterial suspension containing 5 108 CFU in DMEM was added, and after 2 h of incubation at 37 °C the wells were washed three times with PBST. Adherent bacteria were detached from the wells by
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
892
Marzia Salzillo et al.
adding 100 ml of 10% trypsin and quantified by real-time PCR as previously reported [3]. Expression and purification of recombinant EnoA1 (rEnoA1) L. plantarum LM3 chromosomal DNA was used as template in PCR reactions and the enoA1 gene was amplified with the oligonucleotides EnoA1 FOR and EnoA1 REV (Table 1). The PCR product was cloned in the expression vector pGEX-6P-1. GST-tagged EnoA1 was expressed in E. coli BL21 and was purified by affinity chromatography under native conditions on sepharose resin [29]. ELISA test Ninety-six well microtiter plates were coated with CnI (2 mg/well) for 1 h at 37 °C and at 4 °C overnight. After three PBST washing, plates were blocked with 200 ml of BSA 2% in PBS for 2 h at 37 °C. After PBST washing, wells were incubated with the rEnoA1 (1.35 mM) for 2 h at 37 °C and washed three times with PBST. Bound proteins were detected by the addition of mouse antiGST IgG antibody (1:2,000; Abcam) followed by goat anti-mouse IgG horseradish peroxidase (HPR)-conjugated antibody (1: 40,000; GE Healthcare). Bound HPRconjugated antibodies were detected using 1-Step Slow TMB-ELISA kit (Pierce). Wells incubated with GST were utilized as negative control for CnI binding. Absorbance at 450 nm was measured using a Bio-Rad 680 Microplate Reader (Bio-Rad). Analysis was repeated four times and CnI binding measures were repeated in triplicate. Characterization of the CnI binding region in EnoA1 The complete EnoA1 protein (442 aa) was divided into three parts, EnoA11–61 (F1), EnoA161–209 (F2), and
EnoA1209–442 (F3), which were expressed in E. coli and purified as described above, using the primers pairs EnoA1 FOR/A1_REV, A2_FOR/A2_REV, and A3_FOR/ EnoA1 REV, respectively (Table 1). Next, F1 and F2 fragments were further divided into five sub-fragments F41–73, F51–104, F6104–209, F773–140, and F8140–209 which were amplified using the primers pairs EnoA1 FOR/ A4_REV, EnoA1 FOR/A5_REV, A6_FOR/A2_REV, A7_FOR/ A7_REV, A8_FOR/A2_REV, respectively and, subsequently, expressed and purified (Table 1). CnI binding ability of all constructs was tested by CnI overlay assay as described above.
Results L. plantarum surface proteins bind human CnI To identify putative CnI binding adhesins in L. plantarum LM3, a CnI overlay assay was performed on surface proteins, resolved by two-dimensional electrophoresis (Fig. 1). Among Cn-binding proteins, we analyzed the protein spot showing an apparent molecular mass of 48 kDa and pI 4.6. (Fig. 1B). By means of MALDI-TOF analysis, this protein was identified as the a-enolase EnoA1, encoded by enoA1 gene, one of two eno genes expressed in L. plantarum [3]. In order to prove the involvement of the surface EnoA1 in LM3 adhesion to CnI, the extent of binding of LM3 and of its mutant strain LM3-CC1, carrying a null mutation in the enoA1 gene, was analyzed on CnI-coated microtiter plates [3]. Adhesion of both strains was evaluated by real-time PCR, amplifying the 16S ribosomal DNA with species-specific primers [30]. A significant difference was found in the ability of LM3 and LM3-CC1 to bind CnI, with wild type cells about sixfold more efficient than mutant cells (p < 0.05; Fig. 2).
Table 1. Primers used in this study. Sequence 50 –30
Primers EnoA1 FOR EnoA1 REV A1_REV A2_FOR A2_REV A3_FOR A4_REV A5_REV A6_FOR A7_FOR A7_REV A8_FOR
CGGGATCCATGTCTATTATTACAGATATTTATGC AACATGGTCGACTTACTTGCTAGTAATGGTGTTCCG AACATGGTCGACTTAGCCCATGAAACGGCTCTTGTCACC CGGGATCCGGCAAGGGTGTTACTAAAGCCG AACATGGTCGACTACGCAAAACCACCTTCGTCACC CGGGATCCGCGCCTGACTTGAAGAACAACG AACATGGTCGACTTACTTGTTAACATTGTCAACGGC AACATGGTCGACTTAAGCTTTGTTAGGAGTACCATC CGGGATCCGCTAAGTTAGGCGCTAACGC CGGGATCCAAGTTAATTGCTAAGGAAATTG AACATGGTCGACTTAGTGAGCGTTGAATCCGCCAAG CGGGATCCCACGTTTTACCAACACCAATG
Restriction endonuclease sites are in bold. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
893
Figure 1. Identification of CnI binding surface proteins of L. plantarum LM3 by 2DE and MALDI-TOF analysis. (A) 2DE of surface proteins stained with coomassie brilliant blue. (B) Chemiluminescent detection after peroxidase assay. The spot corresponding to EnoA1 (Acc. N. gi| 28377645) is circled [3].
Binding of CnI to recombinant EnoA1 In order to further characterize the CnI binding activity of EnoA1, the corresponding enoA1 gene was cloned in the expression vector pGEX-6P-1; the recombinant GSTtagged EnoA1 (rEnoA1) was purified by affinity chromatography and used to perform CnI overlay assays. Figure 3 shows the binding of rEnoA1 to CnI, while no interaction between CnI and GST (negative control) was detected (lanes 1 and 2, respectively). The rEnoA1 binding ability was also assessed by ELISA assays using immobilized collagen and GST as negative control. The EnoA1 and GST binding levels were expressed as difference of A450 measured in CnI and BSA coated wells. As shown in Fig. 4, rEnoA1 exhibited significant level of adhesion to CnI, with values 10-fold higher than the level obtained with the GST protein. Mapping of CnI binding region in L. plantarum EnoA1 In order to identify the region/s of EnoA1 that elicits CnI binding activity, the protein was divided into three parts, EnoA11–61 (F1), EnoA161–209 (F2), and EnoA1209–442 (F3) which were expressed and purified (Fig. 5A). CnI overlay assays were performed on the three recombinant fragments, the EnoA1 complete recombinant protein, and the GST protein. As shown in Fig. 5B, only the F2 fragment and rEnoA1 reacted with CnI while no signal was obtained for the other recombinant proteins and the GST (negative control). This suggested that the CnI binding region was localized between amino acid residues 61–209 and the N- and C-terminal regions were not required for CnI binding. Further characterization of the CnI binding region was undertaken expressing other three protein fragments, F41–73, F51–104, F6104–209. CnI overlay assays, performed on these constructs, showed that only the F5 and F6 fragments retained CnI binding ability (Fig. 5C). However, since the F1 and the F4 ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
fragments were negative in the binding assays (Fig. 5B and C), we assumed that only the C-terminal portion (amino acid residues 73–104) of the F5 fragment was involved in the CnI binding activity. To further shorten the EnoA1 fragment for binding activity analysis, we tested the F773–140 and F8140–209 fragments that include the CnI binding region of F5 and the F6 fragment. Figure 5D shows that the F7 fragment, but not the F8 fragment, retained the CnI binding activity. Taken together these results indicate that the CnI binding region of EnoA1 lies within a fragment spanning from the 73rd to the 140th amino acid residues.
Discussion Adhesion of pathogens to host tissue is a crucial early step in the infectious process. Probiotic bacteria can mimic the initial mechanisms used by the pathogens in
Figure 2. Binding of LM3 (w.t.) and LM3-CC1 (DenoA1) to CnI immobilized on microtiter plate wells. Error bars represent standard deviation of the mean values (p < 0.05).
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
894
Marzia Salzillo et al.
Figure 3. CnI overlay assay. (A) PVDF membrane stained with Ponceau S. (B) Chemiluminescent signal detected by ChemiDoc XRS System. MK, molecular weight marker; lane 1, GST-tagged enolase; lane 2, GST.
the adhesion step, thus competing with them for host receptors at the intestinal mucosa. For this reason, a basic property for the selection of probiotic strains is their ability to adhere to the human intestinal cells [31]. The probiotic characteristics of L. plantarum have been extensively described in many scientific reports, and interactions of some strains with endothelial cells, mucus, and extracellular matrix (ECM) components
Figure 4. ELISA detection of EnoA1 binding to immobilized CnI. Nonspecific adherence to BSA-coated wells was subtracted from binding to Cn-coated wells and GST was chosen as a negative control. Data represent the mean standard deviation from three separate experiments (three microtiter wells per experiment) (p < 0.05). ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
have also been reported [5, 32–34]. L. plantarum adhesion to human intestinal tract is dependent on binding of specific adhesins. Some of these are cytoplasmic proteins exerting moonlighting functions when expressed on cell surface [3, 6, 35–37]. The term moonlighting was introduced to describe the ability of proteins to have more than one function. Many well-known proteins such as metabolic enzymes and molecular chaperones are now recognized as moonlighting proteins with activity of adhesion or modulation of cell signaling processes [38]. The presence of cytoplasmic enzymes on cell surfaces has been also observed in a variety of pathogenic bacteria [2, 39–41] and in commensal Lactobacillus species [4]. In previous works, we showed the involvement of the L. plantarum LM3 surface displaced enolase (EnoA1) in Fn binding and demonstrated the significance of its surface localization in adhesion to fibronectin (Fn) [3]. Bove and coworkers [42] reported that the L. plantarum enoA1 expression was induced at pH 3, which is a condition encountered during the gastric transit. Enolases are metabolic enzymes and important virulence factors for streptococci, staphylococci, and mycoplasma pathogens, where they are also expressed as surface proteins mediating cell adhesion and invasion. Indeed, some reports have demonstrated a direct role of enolase in bacterial pathogenesis [40, 43]. It has been reported that Streptococcus sorbinus recombinant enolase can be used to protect against dental caries in the rat [44]. In order to adhere to and invade host tissues, many gastrointestinal, urogenital, oral, and skin pathogens are able to bind several human collagen isotypes [2]. Antikainen and coworkers [28] have reported that the Lactobacillus crispatus and Staphylococcus aureus enolases can adhere to CnI. In this study, we demonstrated the involvement of the L. plantarum LM3 EnoA1 in CnI binding. The occurrence of CnI and Fn binding for EnoA1 shows that this protein is a multi-functional binding adhesin which can interact with more than one ECM component, as reported for other adhesins [41]. By in silico analysis we were not able to find Cn-binding domains described in other bacterial adhesins [1]. CnI overlay assay and ELISA test performed on the EnoA1 purified protein demonstrated that EnoA1 can bind CnI both under denaturing and native conditions. Analysis of the CnI binding ability of the LM3-CC1 strain, carrying a null mutation in the enoA1 gene, shows that EnoA1 contributes significantly to LM3 adhesion to CnI. Using recombinant derivatives of the protein, we also demonstrated that the EnoA1 fragment, localized between amino acid residues 73–140, is involved in CnI binding. Our results also suggest that the EnoA1 regions spanning from 73rd to 104th amino acid
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
895
Figure 5. Identification of the CnI binding region in EnoA1. (A) Schematic representation of EnoA1 and derived protein portions used for production of recombinant GST-tagged protein fragments (F1–F8). (B–D) CnI overlay assays performed on F1–F8 fragments. The GST and rEnoA1 were used as negative and positive control, respectively. (B) CnI overlay assay performed on GST (lane 1), rEnoA1 (lane 2), F1 (lane3), F2 (lane 4), and F3 (lane 5). (C) CnI overlay assay performed on GST (lane 1), F4 (lane 2), F5 (lane 3), F6 (lane 4), and F2 used as positive control (lane 5). (D) CnI overlay assay performed on GST (lane 1), rEnoA1 (lane 2), F7 (lane 3), and F8 (lane 4). MK, molecular weight marker.
residues and from 104th to 140th amino acid residues are both sufficient for CnI interaction. To our knowledge, this is the first study to characterize the interaction of a bacterial enolase to human collagen. Study of effector molecules in probiotic bacteria and of their corresponding receptors in the host cells can contribute to the development of strains with enhanced health benefits. Moreover, identification of binding domains within microbial adhesins, may be potentially useful to design inhibitors of the complex bacterial adhesins/host receptors, thus contributing to development of future antimicrobial therapies. ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
Conflict of interest All authors declare that there are no financial/commercial conflicts of interest.
References [1] Chagnot, C., Listrat, A., Astruc, T., Desvaux, M., 2012. Bacterial adhesion to animal tissues: protein determinants for recognition of extracellular matrix components. Cell. Microbiol., 14, 1687–1696.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
896
Marzia Salzillo et al.
[2] Singh, B., Fleury, C., Jalalvand, F., Riesbeck, K., 2012. Human pathogens utilize host extracellular matrix proteins laminin an collagen for adhesion and invasion of the host. FEMS Microbiol. Rev., 36, 1122–1180. [3] Castaldo, C., Vastano, V., Siciliano, R.A., Candela, M. et al., 2009. Surface displaced alfa-enolase of Lactobacillus plantarum is a fibronectin binding protein. Microb. Cell. Fact., 8, DOI: 10.1186/1475-2859-8-14 [4] Sengupta, R., Altermann, E., Anderson, R.C., McNabb, W.C. et al., 2013. The role cell surface architecture of lactobacilli in host-microbe interactions in the gastrointestinal tract. Mediators Inflamm., DOI: 10.1155/2013/ 237921 [5] Yadav, A.K., Tyagi, A., Kaushik, J.K., Saklani, A.C. et al., 2013. Role of surface layer collagen binding protein from indigenous Lactobacillus plantarum 91 in adhesion and its anti-adhesion potential against gut pathogen. Microbiol. Res., 168, 639–645. [6] Vastano, V., Salzillo, M., Siciliano, R.A., Muscariello, L. et al., 2014. The E1 beta-subunit of pyruvate dehydrogenase is surface-expressed in Lactobacillus plantarum and binds fibronectin. Microbiol. Res., 169, 121–127. [7] Juge, N., 2012. Microbial adhesins to gastrointestinal mucus. Trends Microbiol., 20, 30–39. [8] Martın R.L., Sanchez, B., Suarez, J.E., Urdaci, M.C., 2012. Characterization of the adherence properties of human Lactobacilli strains to be used as vaginal probiotics. FEMS Microbiol. Lett., 328, 166–173. [9] Valeriano, V.D., Parungao-Balolong, M.M., Kang, D.K., 2014. In vitro evaluation of the mucin-adhesion ability and probiotic potential of Lactobacillus mucosae LM1. J. Appl. Microbiol., 117, 485–497. [10] Gareau, M.G., Sherman, P.M., Walker, W.A., 2010. Probiotics and the gut microbiota in intestinal health and disease. Nat. Rev. Gastroenterol. Hepatol., 7, 503–514. [11] Chapman, C.M., Gibson, G.R., Rowland, I., 2011. Health benefits of probiotics: are mixtures more effective than single strains. Eur. J. Nutr., 50, 1–17. [12] Bron, P.A., Tomita, S., Mercenier, A., Kleerebezem, M., 2013. Cell surface-associated compounds of probiotic lactobacilli sustain the strain-specificity dogma. Curr. Opin. Microbiol., 16, 262–269. [13] Remus, D.M., Bongers, R.S., Meijerink, M., Fusetti, F. et al., 2013. Impact of Lactobacillus plantarum sortase on target protein sorting, gastrointestinal persistence, and host immune response modulation. J. Bacteriol., 195, 502–509. €rgelin, M., Olin, A.I., von Pawel-Rammingen, [14] Bober, M., Mo U., Collin, M., 2011. The membrane bound LRR lipoprotein Slr, and the cell wall-anchored M1 protein from Streptococcus pyogenes both interact with type I collagen. PLoS ONE 6, e20345. [15] Zong, Y., Xu, Y., Liang, X., Keene, D.R. et al., 2005. A `Collagen Hug' model for Staphylococcus aureus CNA binding to collagen. EMBO J., 24, 4224–4236. [16] Liu, Q., Ponnuraj, K., Xu, Y., Ganesh, V.K. et al., 2007. The Enterococcus faecalis MSCRAMM ACE binds its ligand by the Collagen Hug model. J. Biol. Chem., 282, 19629–19637.
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
[17] Vengadesan, K., Narayana, S.V., 2011. Structural biology of Gram-positive bacterial adhesins. Protein Sci., 20, 759–772. [18] Nallapareddy, S.R., Weinstock, G.M., Murray, B.E., 2003. Clinical isolates of Enterococcus faecium exhibit strainspecific collagen binding mediated by Acm, a new member of the MSCRAMM family. Mol. Microbiol., 47, 1733–1747. [19] Nakano, K., Nomura, R., Taniguchi, N., Lapirattanakul, J. et al., 2010. Molecular characterization of Streptococcus mutans strains containing the cnm gene encoding a collagen-binding adhesin. Arch. Oral Biol., 55, 34–39. [20] van Wieringen, T., Kalamajski, S., Liden, A., Bihan, D. et al., 2010. The streptococcal collagen-binding protein CNE specifically interferes with alphaVbeta3-mediated cellular interactions with triple helical collagen. J. Biol. Chem., 285, 35803–35813. [21] Kang, M., Ko, Y.P., Liang, X., Ross, C.L. et al., 2013. Collagen-binding Microbial Surface Components Recognizing Adhesive Matrix Molecule (MSCRAMM) of Grampositive bacteria inhibit complement activation via the classical pathway J. Biol. Chem., 288, 20520–20531. [22] Reissmann, S., Gillen, C.M., Fulde, M., Bergmann, R. et al., 2012. Region specific and worldwide distribution of collagen-binding M proteins with PARF motifs among human pathogenic streptococcal isolates. PLoS ONE 7, e30122. [23] Leo, J.C., Elovaara, H., Bihan, D., Pugh, N. et al., 2010. First analysis of a bacterial collagen-binding protein with collagen Toolkits: promiscuous binding of YadA to collagens may explain how YadA interferes with host processes. Infect. Immun., 78, 3226–3236. [24] Mikula, K.M., Kolodziejczy, k.R., Goldman, A., 2013. Yersinia infection tools-characterization of structure and function of adhesins. Front. Cell. Infect. Microbiol., 2, 169. [25] Antikainen, J., Anton, L., Sillanpa€a€, J., Korhonen, T.K., 2002. Domains in the S-layer protein CbsA of Lactobacillus crispatus involved in adherence to collagens, laminin and lipoteichoic acids and in self-assembly. Mol. Microbiol., 46, 381–394. [26] Sun, Z., Kong, J., Hu, S., Kong, W. et al., 2013. Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen. Appl. Microbiol. Biotechnol., 97, 1941–1952. [27] Kainulainen, V1., Loimaranta, V., Pekkala, A., Edelman, S. et al., 2012. Glutamine synthetase and glucose-6-phosphate isomerase are adhesive moonlighting proteins of Lactobacillus crispatus released by epithelial cathelicidin LL37. J. Bacteriol., 194, 2509–2519. [28] Antikainen, J., Kuparinen, V., L€ahteenma€ki, K., Korhonen, T.K., 2007. Enolases from gram-positive bacterial pathogens and commensal lactobacilli share functional similarity in virulence-associated traits. FEMS Immunol. Med. Microbiol., 51, 526–534. [29] Dian, C., Eshaghi, S., Urbig, T., McSweeney, S. et al., 2002. Strategies for the purification and on-column cleavage of glutathione-S-transferase fusion target proteins. J. Chromatogr. B. Analyt. Technol. Biomed. Life Sci., 769, 133–144.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
Enolase is a collagen-binding protein in Lactobacillus plantarum
[30] Heilig, H.G., Zoetendal, E.G., Vaughan, E.E., Marteau, P. et al., 2002. Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16 S ribosomal DNA. Appl. Environ. Microbiol., 68, 114–123. [31] Oelschlaeger, T.A., 2010. Mechanisms of probiotic actions. Int. J. Med. Microbiol., 300, 57–62. [32] Sanchez, B., Schmitter, J.M., Urdaci, M.C., 2009. Identification of novel proteins secreted by Lactobacillus plantarum that bind to mucin and fibronectin. J. Mol. Microbiol. Biotechnol., 17, 158–162. [33] Glenting, J., Beck, H.C., Vrang, A, Riemann, H. et al., 2013. Anchorless surface associated glycolytic enzymes from Lactobacillus plantarum 299v bind to epithelial cells and extracellular matrix proteins. Microbiol. Res., 168, 245–253. [34] Botta, C., Langerholc, T., Cencic, A., Cocolin, L., 2014. In vitro selection and characterization of new probiotic candidates from table olive microbiota. PLoS ONE 9, e94457. [35] Kinoshita, H., Uchida, H., Kawai, Y., Kawasaki, T. et al., 2008. Cell surface Lactobacillus plantarum LA 318 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) adheres to human colonic mucin. J. Appl. Microbiol., 104, 1667–1674. [36] Ramiah, K., van Reenen, C.A., Dicks, L.M., 2007. Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus plantarum 423, monitored with real-time PCR. Int. J. Food Microbiol., 116, 405–409. [37] Vastano, V., Capri, U., Candela, M., Siciliano, R.A. et al., 2013. Identification of binding sites of Lactobacillus
ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA,Weinheim
897
plantarum enolase involved in the interaction with human plasminogen. Microbiol. Res., 168, 65–72. [38] Kainulainen, V., Korhonen, T.K., 2014. Dancing to another tune-adhesive moonlighting proteins in bacteria. Biology (Basel), 3, 178–204. [39] Dallo, S.F., Kannan, T.R., Blaylock, M.W., Baseman, J.B., 2002. Elongation factor Tu and E1 beta subunit of pyruvate dehydrogenase complex act as fibronectin binding proteins in Mycoplasma pneumoniae. Mol. Microbiol., 46, 1041– 1051. [40] Bergmann, S., Wild, D., Diekmann, O., Frank, R. et al., 2003. Identification of a novel plasmin(ogen)-binding motif in surface displayed alpha-enolase of Streptococcus pneumoniae. Mol. Microbiol., 49, 411–423. [41] Thomas, C., Jacobs, E., Dumke, R., 2013. Characterization of pyruvate dehydrogenase subunit B and enolase as plasminogen-binding proteins in Mycoplasma pneumoniae. Microbiology, 159, 352–365. [42] Bove, P., Russo, P., Capozzi, V., Gallone, A. et al., 2013. Lactobacillus plantarum passage through an oro-gastrointestinal tract simulator: carrier matrix effect and transcriptional analysis of genes associated to stress and probiosis. Microbiol. Res., 168, 351–359. [43] Feng, Y., Pan, X., Sun, W., Wamg, C. et al., 2009. Streptococcus suis enolase functions as a protective antigen displayed on the bacterial cell surface. J. Infect. Dis., 200, 1583–1592. [44] Dinis, M., Tavares, D., Veiga-Malta, I., Fonseca, A.J. et al., 2009. Oral therapeutic vaccination with Streptococcus sobrinus recombinant enolase confers protection against dental caries in rats. J. Infect. Dis., 199, 116–123.
www.jbm-journal.com
J. Basic Microbiol. 2015, 55, 890–897
