Interdiscip Sci Comput Life Sci (2014) 6: 271–278 DOI: 10.1007/s12539-014-0187-z
Identification and Characterization of Alkaline Protease Producing Bacillus firmus Species EMBS023 by 16S rRNA Gene Sequencing Rohan wishard1 , Mahak Jaiswal1 , Maheshwari Parveda2, Amareshwari P2 , Sneha Singh Bhadoriya1, Pragya Rathore3 , Mukesh Yadav1 , Anuraj Nayarisseri1∗, Achuthsankar S. Nair2 1
(In silico Research Laboratory, Eminent Biosciences, Indore 452010, India) 2 (Dept. of Genetics, Osmania University, Hyderabad 500075, India) 3 (Dept. of Biotechnology, Sanghvi Institute of Management & Science, Indore 453331, India) 4 (Department of Computational Biology & Bioinformatics, North Campus, Kariavattom, University of Kerala, Thiruvananthapuram, Kerala 695581, India)
Received 12 March 2012 / Revised 10 July 2012 / Accepted 29 July 2012
Abstract: Probiotic microorganisms are those which exert a positive effect on the growth of the host, when administered as a dietary mixture in an adequate amount. They form the best alternative to the use of antibiotics for controlling enteric diseases in poultry farm animals, especially in the light of the gruesome problems of development of antibiotic resistance in enteric pathogens and the contamination of poultry products with antibiotics. 16S rDNA sequencing which has gained wide popularity amongst microbiologists for the molecular characterization and identification of newly discovered isolates provides accurate identification of isolates down to the level of sub-species (strain). It’s most important advantage over the traditional biochemical characterization methods are that it can provide an accurate identification of strains with atypical phenotypic characters as well. The following work is an application of 16S rRNA gene sequencing approach to identify a novel, alkaline protease producing bacteria, from poultry farm waste. The sample was collected from a local poultry farm in the Guntur district, Andhra Pradesh, India. Subsequently the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The results showed the isolate to be a novel, high alkaline protease producing bacteria, which was named Bacillus firmus isolate EMBS023, after characterization the sequence of isolate was deposited in GenBank with accession number JN990980. Key words: 16S rRNA Gene sequencing, Bacillus firmus species EMBS023, Alkaline Protease producing bacteria.
1 Background Probiotics are such microorganisms which when delivered live, through the diet, enhance the growth of the host. Fuller gave a well constructed definition of probiotics, which defines them as live microbial feed supplements which beneficially affect the host animal by improving its intestinal balance [1]. The concept of probiotes first came to light in the beginning of the 20th century, when researchers identified the potential of some microbial species to benefit the host by improving its intestinal microbial balance, thereby inhibiting the growth of pathogens and toxin producing bacteria. The term “probiotic” can refer to a pure or a mixed culture of micro organisms, which when applied to animals or man, benefits the host by improving the properties of indigenous microbiota [2]. The use of probiotic mi∗
Corresponding author. E-mail: [email protected]
croorganisms is an alternative to the use of antibiotics in augmenting microbial infections, in both humans and man, thus emerging as a novel field which is currently under investigation for its applications in farming and aquaculture as well in the development of prophylactic treatments for man. Probiotic products are being developed commercially for use, both, as dietary supplements for humans and as feed supplements for animals being reared in the poultry and aquaculture industries [3, 4]. The potential benefits of probiotics include improved growth and prevention of several gastrointestinal tract infections and disorders [4]. In addition to being used as prophylactic agents, probiotics are also used as therapeutic agents [5]. Thus probiotic microorganisms can be thought of as non pathogenic micro organisms which on being ingested improve the host’s health, either directly by competing with pathogens for host attachment sites and/or nutrition or indirectly by exerting a positive influence on hosts immune system [6].
272
2 Members of genus Bacilli as probiotes Presently, members of the genus Bacillus are being used as probiotic products [3, 4]. These are used primarily in their spore forms and their use has astonishing applications. The several probiotic products which are used commercially contain spores of Bacillus species at a concentration of 109 spores per gram or per mL [4]. It is difficult to understand the probiotic activity of Bacillus species due to two reasons. Firstly, it is very difficult to understand the microbial interactions which occur in the gut, and secondly, since members of this genus are considered to be of allochthonous nature [3]. The scientific interest in Bacillus species as probiotics, has only occurred in the last 15 years and three principal reviews have covered the field [3, 7, 8]. The problems encountered with the use of antibiotics in the animal feed, leading to the possibility of a ban in future, the current concern over the spread of antibiotic resistance genes, the failure to identify new antibiotics and the inherent problems with the development of new vaccines, are some important factors that have lead the concerned scientists and researchers into development of alternative prophylactics, one of which are probiotic Bacilli [4]. Of all the Bacillus species, Bacillus subtilis, Bacillus clausii, Bacillus cereus, Bacillus coagulans and Bacillus licheniformis are the ones which have been studied most extensively with regards to their use as probiotics in the poultry and aquaculture industry [7]. The greatest advantage with using Bacillus spp as probiotes over other species, namely Lactobacillus spp is that spores being the most resistant forms of life known can easily be stored at room temperature without the viability of the product being affected at all. Another advantage is that the spores are capable of surviving the low pH of the gastric barrier [7, 9] which is not the case for all species of Lactobacillus [10]. So with Bacillus spp being used, a specified dose can be stored without refrigeration etc or almost all the spores in the administered dose will reach the small intestine.
3 Mechanisms used by probiotic bacteria to control pathogenic species The probiotes can act by a variety of mechanisms to control the microbial populations in an aquaculture pond. There are, however, three most commonly used mechanisms: production of inhibitory compounds; competition with pathogens for nutrition, space, iron (competitive expulsion of pathogenic bacteria); stimulating the immune system of the host [11]. A Probiotic Bacterial population may release chemical substances that have a bactericidal (killing) or bacteriostatic (inhibitory) effect on other microbial populations, which can alter inter-specific relationships [12, 13, 14]. Such effects can be exerted on other Bacteria
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
by secretion of one or a combination of the following substances: antibiotics [15], bacteriocins [14, 16, 17], siderophores [11], lysozymes [11], proteases [11]. Such effects may also be exerted by bringing changes in pH by production of organic acids [18]. Fuller in 1992 suggested that probiotic bacteria may act by strengthening the host’s immune system. He further suggested that such a stimulation of the immune system could be brought about either by increasing the activity of phagocyte cells thus resulting in a better ability to phagocytose the microorganisms and carbon particles or by causing the host’s immune cells to increase the production and secretion of immunoglobulins and interferons or by increasing the concentration of antibodies secreted at the mucus lined surfaces such as gut wall [19]. A bacterium requires attachment on to specific host sites (internal or external) so that it is able to initially colonize and if it’s a pathogen, subsequently infect the host. Thus there must be available a sufficient number of host attachment sites for a pathogen to colonize and invade/infect the host. Also the pathogen would require proper nutrients from the the host’s body, for its sustenance and reproduction. Many probiotic bacteria eliminate pathogens by competing with them for host attachment sites and nutrients [20]. Successful probiotic bacteria are able to colonize the host’s intestinal surface [20].
4 Use of probiotics in poultry feed The poultry industry has gained importance as an economic activity in the recent times [21]. The health of chicken and broiler is the most important factor for the success of poultry industry. Till now mostly antibiotics have been used for controlling diseases in the poultry farm animals, chiefly the broiler. But with increasing concern about antibiotic resistance, the ban on usage of antibiotics in Europe and with the impending ban on antibiotic usage in poultry farms and aquaculture ponds in the USA, there has been an increase in the efforts for finding alternatives to antibiotics [22]. Probiotics are one such alternative to the use of antibiotics in reduction of enteric diseases in poultry and the subsequent reduction in contamination of poultry products [22]. Some farmers are already using probiotics in preference to antibiotics [21, 23]. Probiotic strains have been shown to inhibit pathogenic bacteria both in vitro and in vivo through several different mechanisms. The ones used in the poultry farms may act by any of the following modes to serve the purpose: (i) maintaining normal intestinal microflora by competitive exclusion and antagonism [24, 25]; (ii) altering metabolism by increasing digestive enzyme activity and decreasing bacterial enzyme activity and ammonia production [26]; (iii) improving feed
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
intake and digestion [27]; and (iv) stimulating the immune system [28, 29]. Probiotic mixtures may contain yeast or bacterial cells or both, which can produce a stimulatory effect on the indigenous microbiota in such a way that a health benefit is conferred to the host [30]. Bacillus firmus, a Gram +ve, rod shaped, protease secreting bacterium has also been identified as a probiotic species [7]. But till now its exact mode of action of by which it can act as an effective probiote when used in poultry feed has not been characterized. Possibly it shows probiotic activity by exerting an immune stimulatory effect on the poultry farm animals [31, 32]. How its protease secretion adds to or is solely responsible for this effect still remains to be studied and the underlying mechanisms are yet to be elucidated.
5 Identification of a new probiotic bacterial species by 16S rRNA gene sequencing The use of the 16S r RNA gene sequence to identify and assign a scientific name to a newly isolated bacterial species or a new strain of an already identified species, has gained wide scale acceptance amongst microbiologists and biotechnologists [33, 34]. Over the last decade developments have been made in this technology to take it beyond the investigational stage, to be used clinically as a standard method for bacterial identification [33]. Earlier, bacterial identification was carried out based on phenotypic and morphologic characterization of bacterial species. These methods were based on a comparison between the morphologic and phenotypic characteristics of a type strain or a typical strain, with the morphologic and phenotypic characteristics of the isolate to be identified [35]. Although such an approach is much less expensive than 16S rRNA gene sequencing, it has one drawback, that it can be used for the identification for most of the commonly encountered bacteria, it cannot be used for the uniequivocal identification of all bacterial genera and species, not to mention strains [34]. This means to say that this approach can fail in case of rare bacteria, or bacteria with ambiguous profiles [34]. As a solution to this problem with the phenotypic and morphologic identification of bacteria, the 16S rRNA gene sequencing method was developed. This technique has proven to be one of the most powerful techniques developed till date for the classification of micro organisms [35, 36, 37, and 38]. By the end of the 1970’s rRNA sequences had been shown to provide the key to prokaryote phylogeny [38]. The idea behind the usage of the 16S rRNA gene sequence for bacterial identification started taking shape in the 1980s [35]. It was shown by Woese and others that phylogenetic relationships of bacteria could be inferred by comparing a stable part of the genetic code
273
[39]. Such stable regions in bacteria are the genes that code for the 5S, 16S and 23S ribosomal RNA and the spaces between these genes. The part of the DNA, now most commonly used for taxonomic purposes with regards to bacteria is the 16S rRNA gene [40]. The 16S rRNA gene can be compared not only across all bacterial species but also with the 16S rRNA gene of archaebacteria and the 18S rRNA gene of eukaryotes [35]. Carl Woese and others were the first ones to sequence and analyze the 16S rRNA gene for phylogenetic studies [41, 42]. After this the invention of PCR and automated DNA sequencing technology, and the work carried out on 16S rRNA sequencing of bacteria, as well as 18S rRNA sequencing of eukaryotes, has led to the accumulation of a vast amount of sequence data on the rRNA genes of the smaller subunit of the ribosome [34]. Comparison of these sequences has shown that the rRNA gene sequences are highly conserved within living organisms of the same genus and species, but that they differ between organisms of other genera and species. Using these gene sequences, Archaebacteria have been described as a separate form of life so that now there are three domains of life, Archaea, Bacteria and Eukarya, instead of only two: prokaryotes and eukaryotes, known earlier [43]. Using 16S rRNA sequences, numerous bacterial genera and species have been reclassified and renamed and several new bacterial species have been discovered (Fig. 1). In the last decade, sequencing of various bacterial genomes and comparison between genome and 16S rDNA gene phylogeny has confirmed the importance of the 16S rDNA gene in bacterial phylogeny [44]. Also the increase in the availability of PCR and DNA sequencing facilities has extended the use of 16S rDNA sequencing to clinical laboratories, where it is used for identification of pathogens. There are three major reasons behind using the 16S rRNA gene for bacterial identification and classification. These reasons include (i) it is present in almost all bacteria; (ii) its function has not changed over time, therefore the random sequence changes in the sequence of this gene can be used as a very accurate measure of evolutionary time; and (iii) its length(approximately 1, 500 bp) is large enough for it to be used for informatics purposes (45). In 1980 in the Approved Lists, 1, 791 valid names were recognized at the rank of species [37]. Today, this number has reached as high as 8, 168 species. This 456% increase in the number of recognized taxa is attributable to the ease in performance of 16S rRNA gene sequencing studies as opposed to the more cumbersome manipulations involving DNADNA hybridization investigations. The greatest advantage of 16S rRNA sequencing is that unlike phenotypic identification, which can be affected by the presence or absence of non housekeeping genes or by variability
274
Interdiscip Sci Comput Life Sci (2014) 6: 271–278 firmicutes I 2 leaves Bacillus firmus strain S26-2 16 S ribosomal RNA gene, partial sequence Bacillus sp. W-SL-2 16 S ribosomal RNA gene, partial sequence Bacillus sp. BSi20511 16 S ribosomal RNA gene, partial sequence Bacillus sp. 2BSG-MG-22 gene for 16 S rRNA, partial sequence firmicutes I 5 leaves firmicutes I 8 leaves Bacillus sp. BR028 16 S ribosomal RNA gene, partial sequence Bacillus sp. 2BSG-MG-25 gene for 16 S rRNA, partial sequence firmicutes I 10 leaves firmicutes I 2 leaves firmicutes I 50 leaves firmicutes I 12 leaves Bacillus sp. 71 16 S ribosomal RNA gene, partial sequence Bacillus sp. 81 16 S ribosomal RNA gene, partial sequence Bacillus sp. CU1+ 16 S ribosomal RNA gene, partial sequence Bacillus firmus 16 S rRNA gene, isolate AP15 sequence Bacillus firmus strain EMB5023 16 S ribosomal RNA gene, partial sequence
Fig. 1
Phylogenetic affiliation of Bacillus firmus species EMBS023 with other species of Bacillus firmus
in expression of characters, 16S rRNA sequencing provides accurate identification of isolates with atypical phenotypic characteristics. Using this technique, it has been possible to identify thermotolerant Campylobacter fetus strains as important causes of bacteraemia in immunocompromised patients [46].
quencing, as has been used in the identification of Mycobacterium species isolated from clinical specimens [47, 48].
7 Methods and materials 7.1
6 Identification of slow-growing bacteria 16S rRNA sequencing and similar molecular identification methods have the additional advantage of reducing the time required to identify slow growing bacteria, eg: mycobacteria, which may take 6–8 weeks to grow in culture sufficiently for phenotypic tests to be performed. Even for rapidly growing mycobacteria, some biochemical reactions may take up to 28 days to complete. As for whole cell fatty acid analysis by gas chromatography, special equipment and expertise are required, which are often not available in clinical microbiology laboratories. Thus the best option for us to identify slow growing bacterial species is to carry out molecular characterization by 16S rRNA gene se-
Sample collection and storage
A moist soil sample was collected from a local poultry farm at a place called Mangalagiri, in Guntur district, of the State of Andhra Pradesh, India. The site was surveyed beforehand and then the sample was collected from five different sites on the chosen piece of land. The land at all the five sites was dug about one feet deep and thus the moist, wet soil sample carrying the suspected probiote was collected. It was important to collect the sample after digging one foot deep and not from the surface, since due to the moisture being more and the level of disturbance and erosion being less at about one feet below the ground, the microbial community would be more diverse one feet below the round than on the ground. Thus the chances of collecting the desired probiote along with the sample would be more if the sample is collected from one foot below the
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
ground. Following the collection, the samples from the five sites were stored in five different zip-lock packets, so as to avoid the entry of other microbes through air. These zip-lock packets were then refrigerated (4℃). The samples instead of being frozen are simply refrigerated since the refrigeration temperature of 4℃ is sufficient to temporarily suspend the metabolism of the microbes present therein. 7.2
Sample mixing and serial dilution
1 gm of soil was taken from each of the five packets and then all the 1gm samples were mixed thoroughly and grounded in a mortar and pestle until a fine enough powder containing sufficiently small particles was obtained. Then a gram of this powder was taken and dissolved in 100 mL distilled water, to prepare a soil suspension. This suspension was serially diluted following the usual method for serial dilution. Six test tubes were taken each with 9 mL of distilled water. Then one mL of solution was serially transferred from the test tube containing the 100 mL of soil suspension, right upto the sixth test tube. It is important to note that the test tube containing the soil suspension as well as those used for serial dilution should be autoclaved under the standard conditions. Also the serial dilution should be carried out on the Laminar Air Flow platform, wile changing the micropipette tips at each step of the transfer. In routine microbial isolations, the 10−5 and 10−6 dilution tubes, after incubation yield a sufficiently scarce number of colonies, with which further testing and analysis can be carried out. The serial dilution step holds the key to proper isolation and thus to the success of the experiment. If the sample is not diluted properly then one cannot hope to be able to obtain a pure colony of the microbial species of interest, on the petri plate after isolation and Incubation. 7.3
Isolation by spread plate method
To obtain the isolated colonies, one can chose from among 70 mm, 90 mm, 120 mm diameter Petri plates, to carry out the isolation in. For our work we chose Petri plates having 90 mm diameter. Three such plates were taken and autoclaved. The culture medium was prepared by making use of “HiMedia” Nutrient Agar powder. To prepare 100 mL of nutrient agar medium (melted), we are required to dissolve 28 gm of this powder in 100 mL distilled water. According to the standard laboratory practices, 15 mL of melted nutrient agar is to be dispensed into a 90 mm diameter Petri plate so as to prepare a nutrient agar plate. Thus our total requirement turned out to be 15*3, i.e. 45 mL. so a total of 1.4 gm HiMedia nutrient agar powder was weighed and dissolved in 50 mL distilled water, to obtain 50 mL of melted nutrient agar. A pinch of agar powder (pure Agar) was also added to the solution so as to accelerate the rate of solidification of the medium.
275
The pouring of the melted agar into the plates was carried out on the laminar platform. Out of the three agar plates prepared, in two plates the contents of the 10−5 and 10−6 dilution tubes were poured respectively. The third plate served as the control plate for the experiment. It is important to note that if after the incubation period any growth of microbes (any colonies) is found on the control plates, then that would mean that either the autoclaving was not proper or the media or vessels used for media preparation were contaminated. Whatever may be the cause the experiment would be terminated at that very point and the team would have to start from the very first step of sample mixing, all over again. Thus 15 mL of melted agar was poured into each of the three Petri plates and the plates were allowed to solidify. After this the contents of the two above listed dilution tubes were poured in the Petri plates marked 10−5 and 10−6 respectively. The solutions were evenly spread on the surface of the agar medium in each plate by making use of an L-shaped rod, as is the established practice for isolating microbes by the spread plate method. The joint end of the rod must be placed precisely at the centre of the plate and the free end must lie on the periphery. The the rod should be rotated, gently and uniformly while keeping the joint end of the rod at the centre only. An important thing to be kept in mind during rotating the rod is that the rotation should take place in a single sense only, either clockwise or anti-clockwise. Good isolation will not be achieved if the sense of rotation of the rod is changed. The rotation was carried out while observing all these precautions, for 2 minutes precisely, after which the plates were placed in the incubator. An incubation period of 12 hours was allowed for the micro organisms to grow. The selection of this incubation time was based on the fact that most bacterial species divide once every half hour. Therefore an incubation period of 12 hours would allow the microbes to undergo 24 life cycles, which is a number high enough to allow for sufficient growth to occur.
8 Culturing of the bacterial isolate From the isolation plate of the 10−6 dilution tube some cells were pricked from one of the four identical colonies obtained and cultured in a nutrient broth medium, the composition of which (for 100 mL) was as shown in the Table 1. Table 1 1
Peptic Digest of Animal Tissue
5.00 Gms
2
Sodium Chloride
5.00 Gms
3
Beef Extract
1.50 Gms
4
Yeast Extract
1.50 Gms
276
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
The pH was set precisely to 7.4 through a pH meter. The liquid culture was cultivated under standard incubation conditions, i.e. at 37℃ for 24 hours.
9 DNA isolation from cultured bacterial cells A rather easy and comparatively more cost effective protocol, than the standard protocol, was used for DNA isolation. 50 µL of 18 hour old culture of the isolate was taken and was centrifuged at 10 000 rpm for 2 min. To the pellet of cells were added 100 µL of TE buffer and 150 µL of ST buffer, to lyse the cells by chemical treatment. The vial was tapped, first gently and then vigorously, until the pellet was completely dissolved in these chemicals. The dissolved pellet was subjected to incubation by keeping it in a water bath maintained in a temperature range of 90-95℃. After every two minutes during the incubation, the vial was removed from the bath and inverted 7-8 times to ensure proper mixing of the contents. The total time period of incubation was 10 minutes. In this step due to the high temperature, proteins and other bio-molecules are degraded. Nucleic acids are also denatured, but get renatured in the next step. After incubating between 90-95℃ the vial is cooled to room temperature, followed by centrifugation at 10,000 rpm for 3 min. The supernatant was drawn in a separate vial; this supernatant contains the DNA of the bacterial isolate. After completing the protocol, it is very necessary (especially in this case since it is not the standard protocol) to confirm if or not is the isolated material actually DNA. For this purpose we make use of Gel Electrophoresis. Thus 15 µL of substance was mixed with 2 µL of gel loading dye and this mixture was loaded into a well cast beforehand in the gel (actually since to minimize the chances of failure of the experiment, we carried out the entire experiment taking the culture in four identical vials, thus the sample-gel loading dye mixture was also loaded into four wells). The gel was lifted and viewed under UV transilluminator after allowing for 15 min of run approximately. The orange bands were quite clearly visible, thus we got the confirmation that we had successfully isolated the DNA of the bacterial species of our interest, using our protocol for rapid DNA isolation (Fig. 2).
10 PCR amplification of the 16S rRNA gene The gene coding for the 16S ribosomal RNA from the isolated DNA was amplified across 25 cycles, using the “Corbett Research Ltd, Gradient Thermal Cycler” machine. Pre-Denaturation, in which the entire amount of isolated DNA is separated into single strands. This process was carried out at 94℃ for 5 minutes. Denatu-
Fig. 2
ration was carried out at 94℃ for 1 minute in each PCR cycle. Since in the denaturation steps of each cycle after the denaturation, only the double stranded target gene of our interest was to be separated into single strands, this step was carried out only for one minute in each cycle. Annealing, here the single stranded primer gets attached on to its complementary single stranded sequence (16S rRNA gene, in this work). It was carried out at 52℃ for 1 minute in each cycle. Renaturation was carried out at 72℃ for 1 minute in each cycle.The Final elongation was carried out at 72℃ for 7 minute after all 25 cycles were over. This step is important to extend any remaining piece of single stranded DNA. PCR Primers Used: one very big advantage in using the 16S rRNA gene for molecular characterization of bacteria and identification of new bacterial species/strains is that even though the sequence of the 16S rRNA coding gene of the isolate is yet to be sequenced, as a matter of fact is the very motive behind some research works like ours, it is possible to design primers for the PCR amplification of such yet to be sequenced genes too. Such primers are designated as “Universal Primers”. The idea behind the usage of universal primers is that the 16S rRNA gene is unique for different species as well as for different strains of the same species but the flanking regions of the 16S rRNA gene remains highly conserved across different species. Therefore the primers can be designed for a novel species also since it would have the same flanking regions of its 16S rRNA gene, and so the primer will attach to these flanking regions and facilitate the extension of the gene by the respective DNA polymerase enzyme. The following PCR primers were used:Forward Primer- 27F: AGAGTTTGATCCTGGCTCAG Reverse Primer- 1391R: GGTTACCTTGTTACGACTT The PCR reaction mixture used had four components in it. It contained the PCR master mix (20 µL), which consisted of Taq polymerase enzyme , dNTP’s and 10X PCR buffer in it; the template (2 µL); the forward and reverse primers (1 µL each); distilled water (6 µL). All
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
these components were added to a 200L capacity PCR vial in the sequence as described above and in the respective amounts. After adding all the above listed components in the above listed sequence to the 200 µL PCR vial, the vial was placed in a 1500 µL capacity bigger vial and subjected to a very brief spinning in centrifuge, only for the purpose of proper mixing of the contents. 10.1
Purification of the amplified PCR product
After amplifying the 16S rRNA gene using the thermal cycle as described above. To the PCR vial was added 5 µL of 3M sodium acetate solution (pH=4.6) and 100 µL of absolute ethanol. This was followed by vortexing the vial and incubating it at -200 C for 30-40 min, to precipitate the PCR product. Then the product was subjected to centrifugation at 10, 000 rpm for 5 min. Next, we added 300 µL of 70% ethanol to the resulting pellet and again carried out centrifugation at 10, 000 rpm for 5 min. The resulting pellet was air dried until there was no perceivable smell of ethanol. Finally the pellet was suspended in 10 µL of sterile distilled water 10.2
277 [8] Sanders M, Morelli L, and Tompkins T. Comprehensive Reviews in Food Science and Food Safety 2003 2: 101. [9] Spinosa M et al. Research in Microbiology 2000 151: 361 [PMID: 10919516]. [10] Tuohy K et al. J Appl Microbiol 2007 102: 1026 [PMID: 17381746]. [11] Verschuere L, Rombaut G, Sorgeloos P and Verstraete W. Microbiol Mol Biol R 2000 64: 655 [PMC99008]. [12] Fredrickson A & Stephanopoulos G. Science 1981 213: 972 [PMID: 7268409]. [13] Lemos M, Dopazo C, Toranzo A, and Barja J. J Appl Bacteriol 1991 71: 228 [PMID: 1955417]. [14] Pybus V, Loutit M, Lamont I, and Tagg J. J Fish Dis 1994 17: 311. [15] Williams S & Vickers J. Microb Ecol 1986 12: 43. [16] Bruno M & Montville T. Appl Environ Microbiol 59: 3003 [PMC182399]. [17] Vandenbergh P. FEMS Microbiol Rev 1993 12: 221. [18] Sugita H et al. Appl Environ Microbiol 1997 63: 4986 [PMC168829]. [19] Smith P & Davey S. J Fish Dis 1993 16: 521. [20] Farzanfar A. FEMS Immunol Med Microbiol 2006 48: 149 [PMID: 17064272].
Sequencing of the PCR product
The PCR product was sequenced using the ABI Prism. Sequencing reactions were carried out with ABI PRISM Dye Terminator Cycle Sequence Ready Reaction Kit (Applied Biosystems Inc., USA). The sequence obtained was as follows:-
[21] Kabir S. Int J Mol Sci 2009 10: 3531 [PMC2812824].
GenBank Accession Number:
[24] Nurmi E & Rantala M. New aspects of Salmonella infection in broiler production. Nature 1973 241: 210 [PMID: 4700893].
The sequence so obtained was deposited in the GenBank Database, maintained by the National Centre for Biotechnology Information (NCBI), housed at the National Institute of Health (NIH), Rockville, Maryland, USA. The GenBank Accession Number fro the same is JN990980.
[22] Patterson J & Burkholder K. Poult Sci 2003 82: 627 [PMID: 12710484] [23] Griggs J & Jacob J. J Appl Poult Res 2005 14: 750 [PMID: 15844827]
[25] Jin L, Ho Y, Abdullah N & Jalaludin S. Poult Sci 1998 77: 1259 [PMID: 9733111]. [26] Cole C, Fuller R and Newport M. Food Microbiol 1987 4: 83 [27] Nahaston S, Nakaue H and Mirosh L. Poult Sci 1992 71: 111.
References 365 [PMID:
[28] Kabir S, Rahman M.M, Rahman M.B and Ahmed S. Int J Poult Sci 2004 3 361.
[2] Balcazar J et al. Vet Microbiol 2006 114: 173 [PMID: 16490324]
[29] Haghighi H et al. Clin Diagn Lab Immunol 2005 12: 1387 [PMID: 16339061].
[3] Hong H, Duc L and Cutting S. FEMS Microbiology Reviews 2005 29: 813 [PMID: 16102604]
[30] Dierck N. Arch Anim Nutr Berl. 1989 39: 241 [PMID: 2665690].
[4] Duc L et al. Appl Environ Microbiol 2004 70: 2161 [PMC383048].
[31] Prokesov´ a L, Nov´ aov´ a M, Jul´ ak J and M´ ara M. Folia Microbiologica 1994 39: 501 [PMID: 8549999].
[5] Mazza P. Boll Chim Farm 1994 133: 8166962].
3 [PMID:
[32] L. Prokeˇsov´ a et al. Folia Microbiologica 2002 47: 193 [PMID: 12058402].
[6] Marteau P, De-Vrese M, Cellier C, and Schrezenmeir J. Am J Clin Nutr 2001 73: 430S [PMID: 11157353].
[33] Woo P et al. J Med Microbiol 2009 58: 1030 [PMID: 19528178].
[7] Barbosa T et al. Appl Environ Microbiol 2005 71: 968 [PMID: 15691955].
[34] Woo P et al. Clin Microbiol Infec 2008 14: 908 [PMID: 18828852].
[1] Fuller R. J Appl Bacteriol 1989 66: 2666378]
278
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
[35] Clarridge J. Clin Microbiol Rev 2004 17: 840 [PMID: 15489351].
[43] Woese C, Kandler O and Wheelis M. PNAS 1990 87: 4576 [PMID: 2112744].
[36] Lal D, Verma M and Lal R. Ann Clin Microbiol Antimicrob 2011 10: 28 [PMC3151204].
[44] Snel B, Bork P and Huynen M. Nat Genet 1999 21: 108 [PMID: 9916801].
[37] Janda J & Abbott S. J Clin Microbiol. 2007 45: 2761 [PMID: 17626177].
[45] Patel J. Mol Diagn 2001 6: 313 [PMID: 11774196].
[38] Olsen G, Woese C and Overbeek R. J Bacteriol 1994 176: 1 [PMC205007].
[46] Woo P et al. J Med Microbiol 2002 51: 740 [PMID: 12358064].
[39] Woese C. Microbiol Rev. 1987 51: 221.
[47] Woo P et al. J Clin Microbiol 2000 38: 3515 [PMID: PMC87424].
[40] Palys T, Nakamura L and Cohan F. Int J Syst Bacteriol 47: 1145.
[48] Heller R et al. Eur J Clin Microbiol Infect Dis 1996 15: 172 [PMID: 8801093].
[41] Fox G et al. PNAS 1977 74: 4537 [PMID: 16592452]. [42] Gupta R Lanter J and Woese C. Science 1983 221: 656.
Identification and Characterization of Alkaline Protease Producing Bacillus firmus Species EMBS023 by 16S rRNA Gene Sequencing Rohan wishard1 , Mahak Jaiswal1 , Maheshwari Parveda2, Amareshwari P2 , Sneha Singh Bhadoriya1, Pragya Rathore3 , Mukesh Yadav1 , Anuraj Nayarisseri1∗, Achuthsankar S. Nair2 1
(In silico Research Laboratory, Eminent Biosciences, Indore 452010, India) 2 (Dept. of Genetics, Osmania University, Hyderabad 500075, India) 3 (Dept. of Biotechnology, Sanghvi Institute of Management & Science, Indore 453331, India) 4 (Department of Computational Biology & Bioinformatics, North Campus, Kariavattom, University of Kerala, Thiruvananthapuram, Kerala 695581, India)
Received 12 March 2012 / Revised 10 July 2012 / Accepted 29 July 2012
Abstract: Probiotic microorganisms are those which exert a positive effect on the growth of the host, when administered as a dietary mixture in an adequate amount. They form the best alternative to the use of antibiotics for controlling enteric diseases in poultry farm animals, especially in the light of the gruesome problems of development of antibiotic resistance in enteric pathogens and the contamination of poultry products with antibiotics. 16S rDNA sequencing which has gained wide popularity amongst microbiologists for the molecular characterization and identification of newly discovered isolates provides accurate identification of isolates down to the level of sub-species (strain). It’s most important advantage over the traditional biochemical characterization methods are that it can provide an accurate identification of strains with atypical phenotypic characters as well. The following work is an application of 16S rRNA gene sequencing approach to identify a novel, alkaline protease producing bacteria, from poultry farm waste. The sample was collected from a local poultry farm in the Guntur district, Andhra Pradesh, India. Subsequently the sample was serially diluted and the aliquots were incubated for a suitable time period following which the suspected colony was subjected to 16S rDNA sequencing. The results showed the isolate to be a novel, high alkaline protease producing bacteria, which was named Bacillus firmus isolate EMBS023, after characterization the sequence of isolate was deposited in GenBank with accession number JN990980. Key words: 16S rRNA Gene sequencing, Bacillus firmus species EMBS023, Alkaline Protease producing bacteria.
1 Background Probiotics are such microorganisms which when delivered live, through the diet, enhance the growth of the host. Fuller gave a well constructed definition of probiotics, which defines them as live microbial feed supplements which beneficially affect the host animal by improving its intestinal balance [1]. The concept of probiotes first came to light in the beginning of the 20th century, when researchers identified the potential of some microbial species to benefit the host by improving its intestinal microbial balance, thereby inhibiting the growth of pathogens and toxin producing bacteria. The term “probiotic” can refer to a pure or a mixed culture of micro organisms, which when applied to animals or man, benefits the host by improving the properties of indigenous microbiota [2]. The use of probiotic mi∗
Corresponding author. E-mail: [email protected]
croorganisms is an alternative to the use of antibiotics in augmenting microbial infections, in both humans and man, thus emerging as a novel field which is currently under investigation for its applications in farming and aquaculture as well in the development of prophylactic treatments for man. Probiotic products are being developed commercially for use, both, as dietary supplements for humans and as feed supplements for animals being reared in the poultry and aquaculture industries [3, 4]. The potential benefits of probiotics include improved growth and prevention of several gastrointestinal tract infections and disorders [4]. In addition to being used as prophylactic agents, probiotics are also used as therapeutic agents [5]. Thus probiotic microorganisms can be thought of as non pathogenic micro organisms which on being ingested improve the host’s health, either directly by competing with pathogens for host attachment sites and/or nutrition or indirectly by exerting a positive influence on hosts immune system [6].
272
2 Members of genus Bacilli as probiotes Presently, members of the genus Bacillus are being used as probiotic products [3, 4]. These are used primarily in their spore forms and their use has astonishing applications. The several probiotic products which are used commercially contain spores of Bacillus species at a concentration of 109 spores per gram or per mL [4]. It is difficult to understand the probiotic activity of Bacillus species due to two reasons. Firstly, it is very difficult to understand the microbial interactions which occur in the gut, and secondly, since members of this genus are considered to be of allochthonous nature [3]. The scientific interest in Bacillus species as probiotics, has only occurred in the last 15 years and three principal reviews have covered the field [3, 7, 8]. The problems encountered with the use of antibiotics in the animal feed, leading to the possibility of a ban in future, the current concern over the spread of antibiotic resistance genes, the failure to identify new antibiotics and the inherent problems with the development of new vaccines, are some important factors that have lead the concerned scientists and researchers into development of alternative prophylactics, one of which are probiotic Bacilli [4]. Of all the Bacillus species, Bacillus subtilis, Bacillus clausii, Bacillus cereus, Bacillus coagulans and Bacillus licheniformis are the ones which have been studied most extensively with regards to their use as probiotics in the poultry and aquaculture industry [7]. The greatest advantage with using Bacillus spp as probiotes over other species, namely Lactobacillus spp is that spores being the most resistant forms of life known can easily be stored at room temperature without the viability of the product being affected at all. Another advantage is that the spores are capable of surviving the low pH of the gastric barrier [7, 9] which is not the case for all species of Lactobacillus [10]. So with Bacillus spp being used, a specified dose can be stored without refrigeration etc or almost all the spores in the administered dose will reach the small intestine.
3 Mechanisms used by probiotic bacteria to control pathogenic species The probiotes can act by a variety of mechanisms to control the microbial populations in an aquaculture pond. There are, however, three most commonly used mechanisms: production of inhibitory compounds; competition with pathogens for nutrition, space, iron (competitive expulsion of pathogenic bacteria); stimulating the immune system of the host [11]. A Probiotic Bacterial population may release chemical substances that have a bactericidal (killing) or bacteriostatic (inhibitory) effect on other microbial populations, which can alter inter-specific relationships [12, 13, 14]. Such effects can be exerted on other Bacteria
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
by secretion of one or a combination of the following substances: antibiotics [15], bacteriocins [14, 16, 17], siderophores [11], lysozymes [11], proteases [11]. Such effects may also be exerted by bringing changes in pH by production of organic acids [18]. Fuller in 1992 suggested that probiotic bacteria may act by strengthening the host’s immune system. He further suggested that such a stimulation of the immune system could be brought about either by increasing the activity of phagocyte cells thus resulting in a better ability to phagocytose the microorganisms and carbon particles or by causing the host’s immune cells to increase the production and secretion of immunoglobulins and interferons or by increasing the concentration of antibodies secreted at the mucus lined surfaces such as gut wall [19]. A bacterium requires attachment on to specific host sites (internal or external) so that it is able to initially colonize and if it’s a pathogen, subsequently infect the host. Thus there must be available a sufficient number of host attachment sites for a pathogen to colonize and invade/infect the host. Also the pathogen would require proper nutrients from the the host’s body, for its sustenance and reproduction. Many probiotic bacteria eliminate pathogens by competing with them for host attachment sites and nutrients [20]. Successful probiotic bacteria are able to colonize the host’s intestinal surface [20].
4 Use of probiotics in poultry feed The poultry industry has gained importance as an economic activity in the recent times [21]. The health of chicken and broiler is the most important factor for the success of poultry industry. Till now mostly antibiotics have been used for controlling diseases in the poultry farm animals, chiefly the broiler. But with increasing concern about antibiotic resistance, the ban on usage of antibiotics in Europe and with the impending ban on antibiotic usage in poultry farms and aquaculture ponds in the USA, there has been an increase in the efforts for finding alternatives to antibiotics [22]. Probiotics are one such alternative to the use of antibiotics in reduction of enteric diseases in poultry and the subsequent reduction in contamination of poultry products [22]. Some farmers are already using probiotics in preference to antibiotics [21, 23]. Probiotic strains have been shown to inhibit pathogenic bacteria both in vitro and in vivo through several different mechanisms. The ones used in the poultry farms may act by any of the following modes to serve the purpose: (i) maintaining normal intestinal microflora by competitive exclusion and antagonism [24, 25]; (ii) altering metabolism by increasing digestive enzyme activity and decreasing bacterial enzyme activity and ammonia production [26]; (iii) improving feed
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
intake and digestion [27]; and (iv) stimulating the immune system [28, 29]. Probiotic mixtures may contain yeast or bacterial cells or both, which can produce a stimulatory effect on the indigenous microbiota in such a way that a health benefit is conferred to the host [30]. Bacillus firmus, a Gram +ve, rod shaped, protease secreting bacterium has also been identified as a probiotic species [7]. But till now its exact mode of action of by which it can act as an effective probiote when used in poultry feed has not been characterized. Possibly it shows probiotic activity by exerting an immune stimulatory effect on the poultry farm animals [31, 32]. How its protease secretion adds to or is solely responsible for this effect still remains to be studied and the underlying mechanisms are yet to be elucidated.
5 Identification of a new probiotic bacterial species by 16S rRNA gene sequencing The use of the 16S r RNA gene sequence to identify and assign a scientific name to a newly isolated bacterial species or a new strain of an already identified species, has gained wide scale acceptance amongst microbiologists and biotechnologists [33, 34]. Over the last decade developments have been made in this technology to take it beyond the investigational stage, to be used clinically as a standard method for bacterial identification [33]. Earlier, bacterial identification was carried out based on phenotypic and morphologic characterization of bacterial species. These methods were based on a comparison between the morphologic and phenotypic characteristics of a type strain or a typical strain, with the morphologic and phenotypic characteristics of the isolate to be identified [35]. Although such an approach is much less expensive than 16S rRNA gene sequencing, it has one drawback, that it can be used for the identification for most of the commonly encountered bacteria, it cannot be used for the uniequivocal identification of all bacterial genera and species, not to mention strains [34]. This means to say that this approach can fail in case of rare bacteria, or bacteria with ambiguous profiles [34]. As a solution to this problem with the phenotypic and morphologic identification of bacteria, the 16S rRNA gene sequencing method was developed. This technique has proven to be one of the most powerful techniques developed till date for the classification of micro organisms [35, 36, 37, and 38]. By the end of the 1970’s rRNA sequences had been shown to provide the key to prokaryote phylogeny [38]. The idea behind the usage of the 16S rRNA gene sequence for bacterial identification started taking shape in the 1980s [35]. It was shown by Woese and others that phylogenetic relationships of bacteria could be inferred by comparing a stable part of the genetic code
273
[39]. Such stable regions in bacteria are the genes that code for the 5S, 16S and 23S ribosomal RNA and the spaces between these genes. The part of the DNA, now most commonly used for taxonomic purposes with regards to bacteria is the 16S rRNA gene [40]. The 16S rRNA gene can be compared not only across all bacterial species but also with the 16S rRNA gene of archaebacteria and the 18S rRNA gene of eukaryotes [35]. Carl Woese and others were the first ones to sequence and analyze the 16S rRNA gene for phylogenetic studies [41, 42]. After this the invention of PCR and automated DNA sequencing technology, and the work carried out on 16S rRNA sequencing of bacteria, as well as 18S rRNA sequencing of eukaryotes, has led to the accumulation of a vast amount of sequence data on the rRNA genes of the smaller subunit of the ribosome [34]. Comparison of these sequences has shown that the rRNA gene sequences are highly conserved within living organisms of the same genus and species, but that they differ between organisms of other genera and species. Using these gene sequences, Archaebacteria have been described as a separate form of life so that now there are three domains of life, Archaea, Bacteria and Eukarya, instead of only two: prokaryotes and eukaryotes, known earlier [43]. Using 16S rRNA sequences, numerous bacterial genera and species have been reclassified and renamed and several new bacterial species have been discovered (Fig. 1). In the last decade, sequencing of various bacterial genomes and comparison between genome and 16S rDNA gene phylogeny has confirmed the importance of the 16S rDNA gene in bacterial phylogeny [44]. Also the increase in the availability of PCR and DNA sequencing facilities has extended the use of 16S rDNA sequencing to clinical laboratories, where it is used for identification of pathogens. There are three major reasons behind using the 16S rRNA gene for bacterial identification and classification. These reasons include (i) it is present in almost all bacteria; (ii) its function has not changed over time, therefore the random sequence changes in the sequence of this gene can be used as a very accurate measure of evolutionary time; and (iii) its length(approximately 1, 500 bp) is large enough for it to be used for informatics purposes (45). In 1980 in the Approved Lists, 1, 791 valid names were recognized at the rank of species [37]. Today, this number has reached as high as 8, 168 species. This 456% increase in the number of recognized taxa is attributable to the ease in performance of 16S rRNA gene sequencing studies as opposed to the more cumbersome manipulations involving DNADNA hybridization investigations. The greatest advantage of 16S rRNA sequencing is that unlike phenotypic identification, which can be affected by the presence or absence of non housekeeping genes or by variability
274
Interdiscip Sci Comput Life Sci (2014) 6: 271–278 firmicutes I 2 leaves Bacillus firmus strain S26-2 16 S ribosomal RNA gene, partial sequence Bacillus sp. W-SL-2 16 S ribosomal RNA gene, partial sequence Bacillus sp. BSi20511 16 S ribosomal RNA gene, partial sequence Bacillus sp. 2BSG-MG-22 gene for 16 S rRNA, partial sequence firmicutes I 5 leaves firmicutes I 8 leaves Bacillus sp. BR028 16 S ribosomal RNA gene, partial sequence Bacillus sp. 2BSG-MG-25 gene for 16 S rRNA, partial sequence firmicutes I 10 leaves firmicutes I 2 leaves firmicutes I 50 leaves firmicutes I 12 leaves Bacillus sp. 71 16 S ribosomal RNA gene, partial sequence Bacillus sp. 81 16 S ribosomal RNA gene, partial sequence Bacillus sp. CU1+ 16 S ribosomal RNA gene, partial sequence Bacillus firmus 16 S rRNA gene, isolate AP15 sequence Bacillus firmus strain EMB5023 16 S ribosomal RNA gene, partial sequence
Fig. 1
Phylogenetic affiliation of Bacillus firmus species EMBS023 with other species of Bacillus firmus
in expression of characters, 16S rRNA sequencing provides accurate identification of isolates with atypical phenotypic characteristics. Using this technique, it has been possible to identify thermotolerant Campylobacter fetus strains as important causes of bacteraemia in immunocompromised patients [46].
quencing, as has been used in the identification of Mycobacterium species isolated from clinical specimens [47, 48].
7 Methods and materials 7.1
6 Identification of slow-growing bacteria 16S rRNA sequencing and similar molecular identification methods have the additional advantage of reducing the time required to identify slow growing bacteria, eg: mycobacteria, which may take 6–8 weeks to grow in culture sufficiently for phenotypic tests to be performed. Even for rapidly growing mycobacteria, some biochemical reactions may take up to 28 days to complete. As for whole cell fatty acid analysis by gas chromatography, special equipment and expertise are required, which are often not available in clinical microbiology laboratories. Thus the best option for us to identify slow growing bacterial species is to carry out molecular characterization by 16S rRNA gene se-
Sample collection and storage
A moist soil sample was collected from a local poultry farm at a place called Mangalagiri, in Guntur district, of the State of Andhra Pradesh, India. The site was surveyed beforehand and then the sample was collected from five different sites on the chosen piece of land. The land at all the five sites was dug about one feet deep and thus the moist, wet soil sample carrying the suspected probiote was collected. It was important to collect the sample after digging one foot deep and not from the surface, since due to the moisture being more and the level of disturbance and erosion being less at about one feet below the ground, the microbial community would be more diverse one feet below the round than on the ground. Thus the chances of collecting the desired probiote along with the sample would be more if the sample is collected from one foot below the
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
ground. Following the collection, the samples from the five sites were stored in five different zip-lock packets, so as to avoid the entry of other microbes through air. These zip-lock packets were then refrigerated (4℃). The samples instead of being frozen are simply refrigerated since the refrigeration temperature of 4℃ is sufficient to temporarily suspend the metabolism of the microbes present therein. 7.2
Sample mixing and serial dilution
1 gm of soil was taken from each of the five packets and then all the 1gm samples were mixed thoroughly and grounded in a mortar and pestle until a fine enough powder containing sufficiently small particles was obtained. Then a gram of this powder was taken and dissolved in 100 mL distilled water, to prepare a soil suspension. This suspension was serially diluted following the usual method for serial dilution. Six test tubes were taken each with 9 mL of distilled water. Then one mL of solution was serially transferred from the test tube containing the 100 mL of soil suspension, right upto the sixth test tube. It is important to note that the test tube containing the soil suspension as well as those used for serial dilution should be autoclaved under the standard conditions. Also the serial dilution should be carried out on the Laminar Air Flow platform, wile changing the micropipette tips at each step of the transfer. In routine microbial isolations, the 10−5 and 10−6 dilution tubes, after incubation yield a sufficiently scarce number of colonies, with which further testing and analysis can be carried out. The serial dilution step holds the key to proper isolation and thus to the success of the experiment. If the sample is not diluted properly then one cannot hope to be able to obtain a pure colony of the microbial species of interest, on the petri plate after isolation and Incubation. 7.3
Isolation by spread plate method
To obtain the isolated colonies, one can chose from among 70 mm, 90 mm, 120 mm diameter Petri plates, to carry out the isolation in. For our work we chose Petri plates having 90 mm diameter. Three such plates were taken and autoclaved. The culture medium was prepared by making use of “HiMedia” Nutrient Agar powder. To prepare 100 mL of nutrient agar medium (melted), we are required to dissolve 28 gm of this powder in 100 mL distilled water. According to the standard laboratory practices, 15 mL of melted nutrient agar is to be dispensed into a 90 mm diameter Petri plate so as to prepare a nutrient agar plate. Thus our total requirement turned out to be 15*3, i.e. 45 mL. so a total of 1.4 gm HiMedia nutrient agar powder was weighed and dissolved in 50 mL distilled water, to obtain 50 mL of melted nutrient agar. A pinch of agar powder (pure Agar) was also added to the solution so as to accelerate the rate of solidification of the medium.
275
The pouring of the melted agar into the plates was carried out on the laminar platform. Out of the three agar plates prepared, in two plates the contents of the 10−5 and 10−6 dilution tubes were poured respectively. The third plate served as the control plate for the experiment. It is important to note that if after the incubation period any growth of microbes (any colonies) is found on the control plates, then that would mean that either the autoclaving was not proper or the media or vessels used for media preparation were contaminated. Whatever may be the cause the experiment would be terminated at that very point and the team would have to start from the very first step of sample mixing, all over again. Thus 15 mL of melted agar was poured into each of the three Petri plates and the plates were allowed to solidify. After this the contents of the two above listed dilution tubes were poured in the Petri plates marked 10−5 and 10−6 respectively. The solutions were evenly spread on the surface of the agar medium in each plate by making use of an L-shaped rod, as is the established practice for isolating microbes by the spread plate method. The joint end of the rod must be placed precisely at the centre of the plate and the free end must lie on the periphery. The the rod should be rotated, gently and uniformly while keeping the joint end of the rod at the centre only. An important thing to be kept in mind during rotating the rod is that the rotation should take place in a single sense only, either clockwise or anti-clockwise. Good isolation will not be achieved if the sense of rotation of the rod is changed. The rotation was carried out while observing all these precautions, for 2 minutes precisely, after which the plates were placed in the incubator. An incubation period of 12 hours was allowed for the micro organisms to grow. The selection of this incubation time was based on the fact that most bacterial species divide once every half hour. Therefore an incubation period of 12 hours would allow the microbes to undergo 24 life cycles, which is a number high enough to allow for sufficient growth to occur.
8 Culturing of the bacterial isolate From the isolation plate of the 10−6 dilution tube some cells were pricked from one of the four identical colonies obtained and cultured in a nutrient broth medium, the composition of which (for 100 mL) was as shown in the Table 1. Table 1 1
Peptic Digest of Animal Tissue
5.00 Gms
2
Sodium Chloride
5.00 Gms
3
Beef Extract
1.50 Gms
4
Yeast Extract
1.50 Gms
276
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
The pH was set precisely to 7.4 through a pH meter. The liquid culture was cultivated under standard incubation conditions, i.e. at 37℃ for 24 hours.
9 DNA isolation from cultured bacterial cells A rather easy and comparatively more cost effective protocol, than the standard protocol, was used for DNA isolation. 50 µL of 18 hour old culture of the isolate was taken and was centrifuged at 10 000 rpm for 2 min. To the pellet of cells were added 100 µL of TE buffer and 150 µL of ST buffer, to lyse the cells by chemical treatment. The vial was tapped, first gently and then vigorously, until the pellet was completely dissolved in these chemicals. The dissolved pellet was subjected to incubation by keeping it in a water bath maintained in a temperature range of 90-95℃. After every two minutes during the incubation, the vial was removed from the bath and inverted 7-8 times to ensure proper mixing of the contents. The total time period of incubation was 10 minutes. In this step due to the high temperature, proteins and other bio-molecules are degraded. Nucleic acids are also denatured, but get renatured in the next step. After incubating between 90-95℃ the vial is cooled to room temperature, followed by centrifugation at 10,000 rpm for 3 min. The supernatant was drawn in a separate vial; this supernatant contains the DNA of the bacterial isolate. After completing the protocol, it is very necessary (especially in this case since it is not the standard protocol) to confirm if or not is the isolated material actually DNA. For this purpose we make use of Gel Electrophoresis. Thus 15 µL of substance was mixed with 2 µL of gel loading dye and this mixture was loaded into a well cast beforehand in the gel (actually since to minimize the chances of failure of the experiment, we carried out the entire experiment taking the culture in four identical vials, thus the sample-gel loading dye mixture was also loaded into four wells). The gel was lifted and viewed under UV transilluminator after allowing for 15 min of run approximately. The orange bands were quite clearly visible, thus we got the confirmation that we had successfully isolated the DNA of the bacterial species of our interest, using our protocol for rapid DNA isolation (Fig. 2).
10 PCR amplification of the 16S rRNA gene The gene coding for the 16S ribosomal RNA from the isolated DNA was amplified across 25 cycles, using the “Corbett Research Ltd, Gradient Thermal Cycler” machine. Pre-Denaturation, in which the entire amount of isolated DNA is separated into single strands. This process was carried out at 94℃ for 5 minutes. Denatu-
Fig. 2
ration was carried out at 94℃ for 1 minute in each PCR cycle. Since in the denaturation steps of each cycle after the denaturation, only the double stranded target gene of our interest was to be separated into single strands, this step was carried out only for one minute in each cycle. Annealing, here the single stranded primer gets attached on to its complementary single stranded sequence (16S rRNA gene, in this work). It was carried out at 52℃ for 1 minute in each cycle. Renaturation was carried out at 72℃ for 1 minute in each cycle.The Final elongation was carried out at 72℃ for 7 minute after all 25 cycles were over. This step is important to extend any remaining piece of single stranded DNA. PCR Primers Used: one very big advantage in using the 16S rRNA gene for molecular characterization of bacteria and identification of new bacterial species/strains is that even though the sequence of the 16S rRNA coding gene of the isolate is yet to be sequenced, as a matter of fact is the very motive behind some research works like ours, it is possible to design primers for the PCR amplification of such yet to be sequenced genes too. Such primers are designated as “Universal Primers”. The idea behind the usage of universal primers is that the 16S rRNA gene is unique for different species as well as for different strains of the same species but the flanking regions of the 16S rRNA gene remains highly conserved across different species. Therefore the primers can be designed for a novel species also since it would have the same flanking regions of its 16S rRNA gene, and so the primer will attach to these flanking regions and facilitate the extension of the gene by the respective DNA polymerase enzyme. The following PCR primers were used:Forward Primer- 27F: AGAGTTTGATCCTGGCTCAG Reverse Primer- 1391R: GGTTACCTTGTTACGACTT The PCR reaction mixture used had four components in it. It contained the PCR master mix (20 µL), which consisted of Taq polymerase enzyme , dNTP’s and 10X PCR buffer in it; the template (2 µL); the forward and reverse primers (1 µL each); distilled water (6 µL). All
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
these components were added to a 200L capacity PCR vial in the sequence as described above and in the respective amounts. After adding all the above listed components in the above listed sequence to the 200 µL PCR vial, the vial was placed in a 1500 µL capacity bigger vial and subjected to a very brief spinning in centrifuge, only for the purpose of proper mixing of the contents. 10.1
Purification of the amplified PCR product
After amplifying the 16S rRNA gene using the thermal cycle as described above. To the PCR vial was added 5 µL of 3M sodium acetate solution (pH=4.6) and 100 µL of absolute ethanol. This was followed by vortexing the vial and incubating it at -200 C for 30-40 min, to precipitate the PCR product. Then the product was subjected to centrifugation at 10, 000 rpm for 5 min. Next, we added 300 µL of 70% ethanol to the resulting pellet and again carried out centrifugation at 10, 000 rpm for 5 min. The resulting pellet was air dried until there was no perceivable smell of ethanol. Finally the pellet was suspended in 10 µL of sterile distilled water 10.2
277 [8] Sanders M, Morelli L, and Tompkins T. Comprehensive Reviews in Food Science and Food Safety 2003 2: 101. [9] Spinosa M et al. Research in Microbiology 2000 151: 361 [PMID: 10919516]. [10] Tuohy K et al. J Appl Microbiol 2007 102: 1026 [PMID: 17381746]. [11] Verschuere L, Rombaut G, Sorgeloos P and Verstraete W. Microbiol Mol Biol R 2000 64: 655 [PMC99008]. [12] Fredrickson A & Stephanopoulos G. Science 1981 213: 972 [PMID: 7268409]. [13] Lemos M, Dopazo C, Toranzo A, and Barja J. J Appl Bacteriol 1991 71: 228 [PMID: 1955417]. [14] Pybus V, Loutit M, Lamont I, and Tagg J. J Fish Dis 1994 17: 311. [15] Williams S & Vickers J. Microb Ecol 1986 12: 43. [16] Bruno M & Montville T. Appl Environ Microbiol 59: 3003 [PMC182399]. [17] Vandenbergh P. FEMS Microbiol Rev 1993 12: 221. [18] Sugita H et al. Appl Environ Microbiol 1997 63: 4986 [PMC168829]. [19] Smith P & Davey S. J Fish Dis 1993 16: 521. [20] Farzanfar A. FEMS Immunol Med Microbiol 2006 48: 149 [PMID: 17064272].
Sequencing of the PCR product
The PCR product was sequenced using the ABI Prism. Sequencing reactions were carried out with ABI PRISM Dye Terminator Cycle Sequence Ready Reaction Kit (Applied Biosystems Inc., USA). The sequence obtained was as follows:-
[21] Kabir S. Int J Mol Sci 2009 10: 3531 [PMC2812824].
GenBank Accession Number:
[24] Nurmi E & Rantala M. New aspects of Salmonella infection in broiler production. Nature 1973 241: 210 [PMID: 4700893].
The sequence so obtained was deposited in the GenBank Database, maintained by the National Centre for Biotechnology Information (NCBI), housed at the National Institute of Health (NIH), Rockville, Maryland, USA. The GenBank Accession Number fro the same is JN990980.
[22] Patterson J & Burkholder K. Poult Sci 2003 82: 627 [PMID: 12710484] [23] Griggs J & Jacob J. J Appl Poult Res 2005 14: 750 [PMID: 15844827]
[25] Jin L, Ho Y, Abdullah N & Jalaludin S. Poult Sci 1998 77: 1259 [PMID: 9733111]. [26] Cole C, Fuller R and Newport M. Food Microbiol 1987 4: 83 [27] Nahaston S, Nakaue H and Mirosh L. Poult Sci 1992 71: 111.
References 365 [PMID:
[28] Kabir S, Rahman M.M, Rahman M.B and Ahmed S. Int J Poult Sci 2004 3 361.
[2] Balcazar J et al. Vet Microbiol 2006 114: 173 [PMID: 16490324]
[29] Haghighi H et al. Clin Diagn Lab Immunol 2005 12: 1387 [PMID: 16339061].
[3] Hong H, Duc L and Cutting S. FEMS Microbiology Reviews 2005 29: 813 [PMID: 16102604]
[30] Dierck N. Arch Anim Nutr Berl. 1989 39: 241 [PMID: 2665690].
[4] Duc L et al. Appl Environ Microbiol 2004 70: 2161 [PMC383048].
[31] Prokesov´ a L, Nov´ aov´ a M, Jul´ ak J and M´ ara M. Folia Microbiologica 1994 39: 501 [PMID: 8549999].
[5] Mazza P. Boll Chim Farm 1994 133: 8166962].
3 [PMID:
[32] L. Prokeˇsov´ a et al. Folia Microbiologica 2002 47: 193 [PMID: 12058402].
[6] Marteau P, De-Vrese M, Cellier C, and Schrezenmeir J. Am J Clin Nutr 2001 73: 430S [PMID: 11157353].
[33] Woo P et al. J Med Microbiol 2009 58: 1030 [PMID: 19528178].
[7] Barbosa T et al. Appl Environ Microbiol 2005 71: 968 [PMID: 15691955].
[34] Woo P et al. Clin Microbiol Infec 2008 14: 908 [PMID: 18828852].
[1] Fuller R. J Appl Bacteriol 1989 66: 2666378]
278
Interdiscip Sci Comput Life Sci (2014) 6: 271–278
[35] Clarridge J. Clin Microbiol Rev 2004 17: 840 [PMID: 15489351].
[43] Woese C, Kandler O and Wheelis M. PNAS 1990 87: 4576 [PMID: 2112744].
[36] Lal D, Verma M and Lal R. Ann Clin Microbiol Antimicrob 2011 10: 28 [PMC3151204].
[44] Snel B, Bork P and Huynen M. Nat Genet 1999 21: 108 [PMID: 9916801].
[37] Janda J & Abbott S. J Clin Microbiol. 2007 45: 2761 [PMID: 17626177].
[45] Patel J. Mol Diagn 2001 6: 313 [PMID: 11774196].
[38] Olsen G, Woese C and Overbeek R. J Bacteriol 1994 176: 1 [PMC205007].
[46] Woo P et al. J Med Microbiol 2002 51: 740 [PMID: 12358064].
[39] Woese C. Microbiol Rev. 1987 51: 221.
[47] Woo P et al. J Clin Microbiol 2000 38: 3515 [PMID: PMC87424].
[40] Palys T, Nakamura L and Cohan F. Int J Syst Bacteriol 47: 1145.
[48] Heller R et al. Eur J Clin Microbiol Infect Dis 1996 15: 172 [PMID: 8801093].
[41] Fox G et al. PNAS 1977 74: 4537 [PMID: 16592452]. [42] Gupta R Lanter J and Woese C. Science 1983 221: 656.
