Interdiscip Sci Comput Life Sci (2014) 6: 1–7 DOI: 10.1007/s12539-012-0068-2
Identification and Characterization of a Pesticide Degrading Flavobacterium Species EMBS0145 by 16S rRNA Gene Sequencing Anuraj Nayarisseri1∗, Anjana Suppahia1 , Anuroopa G Nadh2 , Achuthsankar S. Nair2 1
2
(In silico Research Laboratory, Eminent Biosciences, Vijaynagar, Indore 452010, India) (2. Department of Computational Biology & Bioinformatics, North Campus, Kariavattom, University of Kerala, Thiruvananthapuram, Kerala 695581, India.)
Received 15 November 2012 / Revised 9 October 2013 / Accepted 3 December 2013
Abstract: Organophosphates (OPs) like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest-control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with accession number JN794045. Key words: Flavobacterium sp. EMBS0145, 16S rRNA Gene sequencing, organophosphorous biodegradation.
1 Introduction Pesticides are the synthetic organic compounds that kill pests like fungi, insects, worms, and nematodes etc. which cause damage to field crops. These pesticides have the potential to adversely affect the ecosystem. The excessive use of pesticides leads to accumulation of a huge amount of pesticide residues in the food chain and drinking water environment which may have lethal effects on various living forms. Indiscriminate and prevalent use of organophosphorous pesticide such as Chlorpyrifos, Disulfoton, Diazinon and Malathion for agricultural purposes has been restrained in US and few European countries. Nevertheless, it is still broadly used in developing countries like India. Chlorpyrifos [O,O–diethyl O–(3,5,6-trichloro-2pyridyl)] is a commonly used organophosphorus pesticide. It can readily intrude the human food chain and has added more sufferers to its recognition than carcinogenic air pollutants such as polycyclic aromatic hydrocarbons (PAHS). Chlorpyrifos constitute P-O-C linkage like other organophosphate pesticides, such as diazinon [1] [2], parathion [3], ∗
Corresponding author. E-mail: [email protected]
methyl parathion and fenitrothion (Fig. 1). If these pesticides are not degraded or detoxified rapidly, the risk of their off-site migration may pose a health risk to humans. Pesticides can be grouped according to the pace of chemical degradation, as susceptible and tolerant to decomposition. They can be degraded by exposure to normal atmospheric condition or by biological degradation through microorganism present in soil, such as Pseudomonas, Flavobacterium, Alcaligenes, Rhadococcus, Gliocladium, Trichoderma and Penicillium etc. Pesticides are used by these microorganisms as energy source as well as chemical source for their growth and development [4]. Numerous effort to seclude a chlorpyrifos- deteriorating microbial organism by recurring treatments or endowment of soils and other media with Chlorpyrifos have not becoming advantageous, the reason for this is resistant of Chlorpyrifos in soil [5] [6]. Chlorpyrifos is cometabolically degraded by Flavobacterium Species in liquid media; they do not utilize it as energy source. 3, 5, 6-trichloro-2-pyridinol (TCP) is the major degradation product of Chlorpyrifos. As impacts of degradation by microorganism on pesticides are very high, many researchers are working
2
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
Cl
Cl
S Cl
N
CH3
CH3 N
O P
O
CH3
H3C O CH3
N
CH3
O
O
P S
O
O
P O
CH3 (b)
Fig. 1
O (c)
N+
O−
(a) Chlorpyrifos (b) Diazinon (c) Methyl parathion
on its qualitative and quantitative aspects. Pesticides like DDT, DDD, DDF and HCH have been partially degraded by pseudomonas species under specific laboratory conditions [6]. Flavobacterium and Spingomonaspaucimobil species can degrade some type of pesticides like chlorpyrifos, diazinon, or malathion, in 48 hours of fermentation process [7]. Therefore isolation, identification and screening of microorganism for pesticide degradation in food material is very important aspect. Hence the objective of the present study is isolation and characterization of a Chlorpyrifos degrading bacteria from the genus Flavobacterium using 16S rRNA gene sequencing.
2 Methods and materials Soil sample collection
Soil sample was collected from agricultural soil highly contaminated with organophosphorous pesticides from Guntur district, Andhra Pradesh, India where Chlorpyrifos was practically used to control various insect pests. The location was inspected in advance and then the sample was collected. Samples from the site were collected in triplicates and placed into resealable plastic bags which were packed in ice in an insulated box and were subsequently transferred at 4℃ upon arrival to laboratory. Commercial-grade insecticide chlorpyrifos (20% E.C.) was obtained from local pesticide supplier in Guntur district of Andhra Pradesh, India. 2.2
O
CH3
(a)
2.1
S
H3C
Media
Mineral salts medium (MSM) (containing g/L): KH2 PO4 -4.8; K2 HPO4 -1.2; NH4 NO3 -1.0; MgSO4 ·7H2 O-0.2; Ca (NO3 )2 ·4H2 O-0.04; and Fe (SO4 )3 -0.001 with pH adjusted to 7.0. Luria-Bertani (LB) broth (containing g/L): tryptone-10, sodium chloride-10 and yeast extract-5 with pH adjusted in the range of 7.0-7.2. Nutrient Broth (containing g/L): peptic digest of animal tissue — 5, beef extract — 1.5, yeast extract — 1.5, sodium chloride — 5, agar — 15. The analytical grade chemicals and reagents used in this work were purchased from Hi-media.
2.3
Isolation and purification of chlorpyrifosdegrading bacteria
Soil bacteria capable of degrading chlorpyrifos were isolated from agricultural soil of the Guntur District, Andhra Pradesh, India by using enrichment technique. Chlorpyrifos mixed media was prepared by thoroughly mixing chlorpyrifos with media (LB and MSM) at a concentration of 90 mg/L as a sole carbon source. Chlorpyrifos was added when the media was about to solidify (45-50℃). Wet unsieved soil (10 g) from each site was used to inoculate separate 250 mL flasks containing 100 mL of MS medium supplemented with chlorpyrifos (90 mg/L). The cultures were placed on a shaker (200 rpm) at 37℃ for 7 days. At periodic intervals, 500 µL of the supernatant was spread on chlorpyrifos containing mineral agar petridishes, and incubated at room temperature. The petridishes were observed till fourth day for the appearance of resistant colonies (Fig. 2). The individual bacterial colonies that grew on the medium were subcultured onto mineral agar containing chlorpyrifos of the same concentration until pure cultures were obtained. Each isolated strain was streaked at least 3 to 4 times on MSM agar plates for purification. The single colony of bacterial strain that displayed maximum pesticide utilization potential was inoculated in 100 mL LB broth, incubated at 37℃ and then used for further characterization of isolates. 2.4
Minimum inhibitory concentration (MIC) of chlorpyrifos-degrading bacteria
24-hour old bacterial cultures grown in mineral salts medium were inoculated at 10% inoculum size into 250 mL Erlenmeyer flasks containing 100 mL of LuriaBertani broth supplemented with various concentrations (50 – 500 mg/L) of chlorpyrifos to test their ability to degrade the supplemental substrate (pesticide) [8] [9]. A control was maintained with equal volume of broth containing bacterial culture, but without pesticide. Bacterial growth was followed by viable cell counts immediately after inoculation at 0 h and 2, 4, 6 and 24 h of incubation. A bacterial inoculum (1 mL) was drawn at regular intervals from the test and con-
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
Fig. 2
Resistant colonies obtained after enrichment stem growing on MSM agar supplemented with Chlorpyrifos.
3
µL of 10% SDS and incubated at 65℃ water bath for 2 hour with gentle over end inversions for every 15-20 minutes. The samples were then mixed and extracted three times using phenol chloroform and isoamylalcohol (25:24:1 vol/vol). The aqueous layer thus separated was precipitated by using 0.7 volume of isopropanol and incubating overnight at 37℃. After centrifugation at 12 000 x g the pellet was collected and washed using 70% chilled ethanol, dried at room temperature and dissolved in 40 µL MilliQ water. The genomic DNA were resolved on 0.8% (w/v) agarose gels in TAE buffer and viewed by staining with ethidium bromide upon exposure to UV light (Alpha InnotechFluroChem SP, USA). The bands were fairly observed which indicates that we had effectively isolated the DNA from the bacterial species of our interest. 2.7
trol cultures and serial dilutions were performed using 9 mL of sterile saline (0.85% NaCl; pH 7). Appropriate dilutions were plated in triplicate on nutrient agar and the plates incubated at 37℃ for 24 hours. The bacterial colonies were counted (CFU/mL) with a colony counter [10]. 2.5
Effect of environment on bacterial growth
The optimum temperature and pH for the bacterial isolate exhibiting maximum pesticide utilization potential was determined by inoculating the pure culture in Nutrient broth. To determine the effect of temperature and pH on the growth of bacterial isolates, 100 mL of Nutrient broth was taken in 250 mL Erlenmeyer flasks and autoclaved at 121℃, 15 psi for 20 minutes. After cooling, each flask was inoculated with purified bacterial isolate in active log phase, in the proportion of 2% of medium. For determining the optimum growth temperature, flasks were incubated at five different temperatures, viz. 15℃, 25℃, 37℃ and 55℃ and checked for growth in the form of turbidity. The uninoculated sterile nutrient broth tube was kept as negative control. For effect of pH, sterile nutrient broth with pH 3.0, 5.0, 7.0, 9.0 and 11.0 were used. All sets were performed in triplicate. 2.6
DNA isolation from cultured bacterial cells by phenol-chloroform method
Genomic DNA from the pure cultures was isolated by phenol-chloroform method. All the reagents used in molecular work were prepared according to the protocol in Sambrook and Russel, 2001 [11]. The pellet of pure culture obtained after centrifugation was resuspended in 300 µL of Tris-Cl (50 mM, Ph 8.0). The samples were then treated with 100 µL of lysozyme (25 mg/mL) and were subsequently incubated at 37℃ for 1 hour. After this, the samples were treated with 100
PCR amplification of the 16S rRNA gene
A significant benefit of molecular characterization and identification of new bacterial species by using the 16S rRNA primers can be designed though sequencing has not been completed. Such primers are known as “Universal Primers”. As 16S rRNA gene is exclusive for different species as well as for different strains of the same species but their flanks are highly conserved across different species so universal primers would be perfect for this purpose [14] [15]. Thus for any novel species primers can be designed as it would have the similar flanking regions of its 16S rRNA gene, and so the primer will affix to these flanking regions and facilitate the extension of the gene by their DNA polymerase enzyme. The following primers were used in the present study. PCR master mix consists of Taq polymerase enzyme, dNTP’s and 10X PCR buffer in it. All above components are added to a 200 µL capacity PCR vial. The reaction mixture contained PCR master mix (20 µL), template (2 µL), forward primers (1 µL), reverse primers (1 µL) and distilled water (6 µL). After adding all the above listed components the vial is placed in a 1500 µL capacity bigger vial and subjected to a very concise rotation in centrifuge, so that proper mixing of the contents would be done. ForwardPrimer : 5 AGAGTTTGATCCTGGCTCAG3 ReversePrimer : 5 GGTTACCTTGTTACGACTT3 Gradient Thermal Cycler is used to amplify the gene coding for the 16S ribosomal RNA from the isolated DNA. Different steps involved in PCR amplification are: Pre-Denaturation where entire amount of isolated DNA is alienated into single strands and is carried out at 94℃ for 5 minutes. It is followed by denaturation
4
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
h and the total viable count at the initial period was 14×107 CFU/mL. After incubation for 6 h, the total viable count was 60 × 107 CFU/mL and to 180 × 107 CFU/mL at 24 h. The results also indicated that growth of the bacterial isolate in the presence of chlorpyrifos was stimulated in the concentration range of 50–400 mg/L during 24 h of incubation and a marked reduction in the bacterial count during 24 h of incubation was noted at higher concentration (500 mg/L) of chlorpyrifos, suggesting that bacterial enzymes involved in chlorpyrifos hydrolysis were suppressed at this high concentration and the growth rate thus decreased (Fig. 4). 300 Viable cell count (×107 CFU/mL)
which is carried out at 94℃ for 1 minute. During denaturation step double stranded target gene of our interest is separated into single strands. After this step annealing takes place at 52℃ for 1 minute, where single stranded primer gets attached to its complementary single stranded sequence. Then renaturation takes place at 72℃ for 1 minute in each cycle which is followed by the final step called Elongation. It is carried out at 72℃ for 7 minute after all 25 cycles are completed. It is very important step so that any remaining piece of single stranded DNA can be extended [12] [13]. After the amplification of DNA 1 µL of the sample was taken and placed in the wells of 1% agarose gel and the electrophoresis was carried for the observation of the amplified DNA (Fig. 3).
200 150 100 50 0
Lane 1: Marker; Lane 2: PCR Product Fig. 3 16S rRNA PCR Product on 1% Agarose Gel.
2.8
0
2 4 6 Incubation time in hours (hr)
24
Determination of Minimum inhibitory concentration of Chlorpyrifos on bacterial species.
Purification of the amplified PCR product
After amplification, purification of PCR product is carried out. 5 µL of 3M sodium acetate solution (pH=4.6) and 100 µL of absolute ethanol is mixed in PCR vial. To precipitate the PCR product, vortexing of the vial and incubation at −20℃ for 30–40 min is performed. Now product is centrifuged at 10 000 rpm for 5 min. After this 300 µL of 70% ethanol is added to the resulting pellet and again centrifugation is carried out at 10 000 rpm for 5 min. After this step, the pellet is air dried until there was no perceivable smell of ethanol. Lastly the pellet is perched in 10 µL of sterile distilled water [15] [16].
3 Results and discussion 3.1
Fig. 4
500 ppm 400 ppm 300 ppm 200 ppm 100 ppm 50 ppm Control
250
Minimum inhibitory concentration (MIC) of chlorpyrifos-degrading bacteria
Growth curve experiments were performed with different doses of chlorpyrifos in order to determine the optimum concentration of chlorpyrifos that stimulates the growth of the bacterial isolate selected. A phase of adaptation of the bacterial isolate continued up to 4
3.2
Effect of environment on bacterial growth
The bacterial isolate showed ability to grow at wide range of temperature and pH. Growth was seen in the temperature range of 15℃ to 55℃ with the maximum growth seen at 37℃. Isolates showed growth in the pH range of 3.0 to 11.0 with the optimum pH found to be 7.0. 3.3
Sequencing of the PCR product
The amplified product from three independent PCRs was gel-purified, ligated into PCR2.1 (Invitrogen Life Technologies) and transformed into Esherichia coli INVaF(Invitrogen), as recommended by the manufacturer. Plasmid DNA was isolated using a plasmid isolation kit (Bio-Rad), digested with EcoRI and resolved by agarose gel electrophoresis. Plasmids containing appropriately sized inserts were sequenced using Sanger dideoxy sequencing. DNA Baser Sequence Assembler v.1.0 was used to assemble both the forward and reverse sequence ABI files [12] [14] [15]. The sequence obtained was deposited in GenBank database with Accession Number: JN794045.
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
3.4
16S rRNA-based phylogeny
The sequence so obtained was taken up for running NCBI BLAST against nr nucleotide database using Blastn algorithm for getting homologous sequences. Sequences showing a relevant degree of similarity were downloaded batch wise and multiple sequence alignment was performed [12] [13]. Phylogenetic tree was constructed from 16S rRNA gene sequences of members of genus Flavobacterium by different algorithms: neighbour-joining, 13 maximum parsimony tree17, maximum-likelihood18 and UPGMA
Fig. 5
3.5
5
method19 using MEGA5.20 [17]. In the neighbor joining tree, the sequences form a distinct lineage, with Chlorpyrifos degrading Flavobacterium species as the closest relatives. Phylogenetic construction of Chlorpyrifos degrading Flavobacterium EMBS0145 against other species of Flavobacterium is shown in (Fig. 5). The sequence dataset Flavobacterium EMBS0145 consisted of 1417 bp (100%) is parsimony informative. The matrix was competently and manually aligned. Coding gaps as binary characters, missing data had no affect on the topology and had affect on branch support.
Phylogenetic affiliation of Chlorpyrifos degrading Flavobacterium EMBS0145 against other species of Flavobacterium.
Phylogenetic analysis and elucidation of rRNA secondary structure
In order to understand the significance in predicting the stability of chemical or biological molecules or entities of Flavobacterium EMBS0145; RNA secondary structure prediction has been performed [18] [19] [20]. The 16S RNA gene sequence obtained was used to deduce the secondary structure of RNA us-
ing UNAFOLD [21] in Linux Platform. The secondary structure showed helical regions which bind with proteins S1eS27, hairpin loops, bulge loops, interior loops and multi-branched loops that may bind to 23S rRNA in the larger subunit of the ribosome. The free energy of the secondary structure of rRNA was ΔG −293.30 kcal/mol elucidated using UNAFOLD (Fig. 6). UNAFOLD results were obtained from .ct file and .reg file. Folding bases 1 to 1417 bp of Flavobacterium
6
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
Fig. 6
RNA secondary structure of Flavobacterium EMBS0145 elucidated by UNAFOLD.
EMBS0145 at 37℃ shows the Gibb’s free energy, ΔG = −293.30 kcal/mol. The thermodynamics result from each base wise of the dataset shows the average of External closing pair Helix ΔG −8.80, Stack ΔG −2.50, Multi-loop ΔG −3.30, Bulge loop ΔG 0.50, Hairpin loop ΔG −4.20, Closing pair and Interior loop of ΔG -2.10 kcal/mol respectively. All rRNAs appear to be identical in function, because all are involved in the production of proteins. The overall three dimensional rRNA structure that corresponds to this function shows only minor-but highly significantvariation. However, within this nearly constant overall structure, molecular sequences in most regions of the molecule are continually evolving and undergoing change at the level of its primary structure while maintaining homologous secondary and tertiary structure,
which never alters molecular function.
4 Conclusion The described results of phylogenetic distinctiveness and phenotypic disparities indicate that strain 2b represents a novel strain within Flavobacterium species, for which the name Flavobacterium EMBS0145 is proposed. The sequence obtained was deposited in GenBank database with Accession Number: JN794045.
References [1] Sethunathan, N., & Pathak, M.D. 1972. Increased biological hydrolysis of diazinon after repeated application in rice paddies. Journal of agricultural and food chemistry, 20(3), 586-589.
Interdiscip Sci Comput Life Sci (2014) 6: 1–7 [2] Sethunathan, N., Yoshida, T. Jul. 1973. A Flavobacterium sp. that degrades diazinon and parathion. Can J Microbiol 19(7), 873-875. [3] Mallick, K., Bharati, K., Banerji, A., Shakil, N.A., & Sethunathan, N. 1999. Bacterial degradation of chlorpyrifos in pure cultures and in soil. Bulletin of environmental contamination and toxicology, 62(1), 48-54. [4] Aislabie, J., & Lloyd-Jones, G. 1995. A review of bacterial-degradation of pesticides. Soil Research, 33(6), 925-942. [5] Racke, K.D., & Frink, C.R. 1989. Fate of organic contaminants during sewage sludge composting. Bulletin of environmental contamination and toxicology, 42(4), 526-533. [6] Mallick, B.K., A. Banerji, N.A. Shakil, and N.N. Sethunathan. 1999. Bacterial degradation of chlorpyrifos in pure culture and in soil. Bull. Environ. Contam. Toxicol. 62, 48-55. [7] Karpouzas, D.G., Fotopoulou, A., MenkissogluSpiroudi, U., & Singh, B.K. 2005. Non-specific biodegradation of the organophosphorus pesticides, cadusafos and ethoprophos, by two bacterial isolates. FEMS microbiology ecology, 53(3), 369-378. [8] Maria, K., Graciela, C., Zauscher, F., 2002. Biodegradation of two commercial herbicides (Gramoxone and Matancha) by the bacteria Pseudomonas putida. E.J. Env. Biotech. 5(2), 182-195. [9] Mulbry, W.W., Del Valle, D.L., Karns, J.S., 1996. Biodegradation of the organophosphorous insecticide coumaphos in highly contaminated soils and in liquid wastes. Pestic. Sci. 48, 149-155. [10] Murugesan, A.G., Jeyasanthi, T., & Maheswari, S. 2010. Isolation and characterization of cypermethrin utilizing bacteria from Brinjal cultivated soil. African Journal of Microbiology Research, 4(1), 010-013. [11] Shetty, R.P., Endy, D., & Knight Jr, T.F. 2008. Engineering BioBrick vectors from BioBrick parts. Journal of biological engineering, 2(1), 1-12. [12] Acharya Nagarjun Pyde, P. Nagaraja Rao, Aditya Jain, Divya Soni, Shailesh Saket, Sheaza Ahmed, Sugunakar Vuree, Anuraj Nayarisseri. 2013. Identification and characterization of foodborne pathogen Listeria monocytogenes strain Pyde1 and Pyde2 using 16S rRNA gene sequencing. Journal of Pharmacy Research. 6(7), 736-741.
7 [13] Nandini Phanse, Pragya Rathore, Bhavesh Patel, Anuraj Nayarisseri. 2013. Characterization of an industrially important alkalophilic bacterium, Bacillus agaradhaerens strain nandiniphanse 5. Journal of Pharmacy Research. 6(5), 543-550. [14] Shah, K.P., Chandok, K.H., Rathore, P., Sharma, M.V., Yadav, M., & Anuraj Nayarisseri 2013. Screening, Isolation and Identification of Polygalacturonase Producing Bacillus tequilensis Strain EMBS083 Using 16S rRNA Gene Sequencing. European Journal of Biological Sciences, 5(1), 09-13. [15] Anuraj Nayarisseri. Sabnani M.K., Mukesh Yadav, Jyotsana, K., Deepika, S., and Rachna, C. 2012. Identification And Characterization of Proteases and Amylases Producing Bacillus licheniformis Strain EMBS026 By 16S rRNA Gene Sequencing. International Journal of Microbiology Research. 4(5), 231-235. [16] Anuraj, N.S., Sheaza Ahmed, Mukesh Yadav, Sneha Singh, Meer Asif A, Mayura Maynal and Urvashi Pisal. 2012. Identification And Characterization of Neutral Protease Producing Paenibacillus Polymyxa Species EMBS024 By 16S rRNA Gene Sequencing. International Journal of Microbiology Research. 4(5), 236-239. [17] Tamura, K., Dudley, J., Nei, M., & Kumar, S. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular biology and evolution, 24(8), 1596-1599. [18] Zuker, Michael, David H. Mathews, and Douglas H. Turner. 1999. Algorithms and thermodynamics for RNA secondary structure prediction: a practical guide. RNA biochemistry and biotechnology. Springer Netherlands, 11-43. [19] Mathews, D.H., Sabina, J., Zuker, M., & Turner, D.H. 1999. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of molecular biology, 288(5), 911-940. [20] SantaLucia, J., & Turner, D.H. 1997. Measuring the thermodynamics of RNA secondary structure formation. Biopolymers, 44(3), 309-319. [21] Markham, Nicholas R., and Michael Zuker. 2008. “UNAFold.” Bioinformatics. Humana Press, 3-31.
Identification and Characterization of a Pesticide Degrading Flavobacterium Species EMBS0145 by 16S rRNA Gene Sequencing Anuraj Nayarisseri1∗, Anjana Suppahia1 , Anuroopa G Nadh2 , Achuthsankar S. Nair2 1
2
(In silico Research Laboratory, Eminent Biosciences, Vijaynagar, Indore 452010, India) (2. Department of Computational Biology & Bioinformatics, North Campus, Kariavattom, University of Kerala, Thiruvananthapuram, Kerala 695581, India.)
Received 15 November 2012 / Revised 9 October 2013 / Accepted 3 December 2013
Abstract: Organophosphates (OPs) like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest-control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with accession number JN794045. Key words: Flavobacterium sp. EMBS0145, 16S rRNA Gene sequencing, organophosphorous biodegradation.
1 Introduction Pesticides are the synthetic organic compounds that kill pests like fungi, insects, worms, and nematodes etc. which cause damage to field crops. These pesticides have the potential to adversely affect the ecosystem. The excessive use of pesticides leads to accumulation of a huge amount of pesticide residues in the food chain and drinking water environment which may have lethal effects on various living forms. Indiscriminate and prevalent use of organophosphorous pesticide such as Chlorpyrifos, Disulfoton, Diazinon and Malathion for agricultural purposes has been restrained in US and few European countries. Nevertheless, it is still broadly used in developing countries like India. Chlorpyrifos [O,O–diethyl O–(3,5,6-trichloro-2pyridyl)] is a commonly used organophosphorus pesticide. It can readily intrude the human food chain and has added more sufferers to its recognition than carcinogenic air pollutants such as polycyclic aromatic hydrocarbons (PAHS). Chlorpyrifos constitute P-O-C linkage like other organophosphate pesticides, such as diazinon [1] [2], parathion [3], ∗
Corresponding author. E-mail: [email protected]
methyl parathion and fenitrothion (Fig. 1). If these pesticides are not degraded or detoxified rapidly, the risk of their off-site migration may pose a health risk to humans. Pesticides can be grouped according to the pace of chemical degradation, as susceptible and tolerant to decomposition. They can be degraded by exposure to normal atmospheric condition or by biological degradation through microorganism present in soil, such as Pseudomonas, Flavobacterium, Alcaligenes, Rhadococcus, Gliocladium, Trichoderma and Penicillium etc. Pesticides are used by these microorganisms as energy source as well as chemical source for their growth and development [4]. Numerous effort to seclude a chlorpyrifos- deteriorating microbial organism by recurring treatments or endowment of soils and other media with Chlorpyrifos have not becoming advantageous, the reason for this is resistant of Chlorpyrifos in soil [5] [6]. Chlorpyrifos is cometabolically degraded by Flavobacterium Species in liquid media; they do not utilize it as energy source. 3, 5, 6-trichloro-2-pyridinol (TCP) is the major degradation product of Chlorpyrifos. As impacts of degradation by microorganism on pesticides are very high, many researchers are working
2
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
Cl
Cl
S Cl
N
CH3
CH3 N
O P
O
CH3
H3C O CH3
N
CH3
O
O
P S
O
O
P O
CH3 (b)
Fig. 1
O (c)
N+
O−
(a) Chlorpyrifos (b) Diazinon (c) Methyl parathion
on its qualitative and quantitative aspects. Pesticides like DDT, DDD, DDF and HCH have been partially degraded by pseudomonas species under specific laboratory conditions [6]. Flavobacterium and Spingomonaspaucimobil species can degrade some type of pesticides like chlorpyrifos, diazinon, or malathion, in 48 hours of fermentation process [7]. Therefore isolation, identification and screening of microorganism for pesticide degradation in food material is very important aspect. Hence the objective of the present study is isolation and characterization of a Chlorpyrifos degrading bacteria from the genus Flavobacterium using 16S rRNA gene sequencing.
2 Methods and materials Soil sample collection
Soil sample was collected from agricultural soil highly contaminated with organophosphorous pesticides from Guntur district, Andhra Pradesh, India where Chlorpyrifos was practically used to control various insect pests. The location was inspected in advance and then the sample was collected. Samples from the site were collected in triplicates and placed into resealable plastic bags which were packed in ice in an insulated box and were subsequently transferred at 4℃ upon arrival to laboratory. Commercial-grade insecticide chlorpyrifos (20% E.C.) was obtained from local pesticide supplier in Guntur district of Andhra Pradesh, India. 2.2
O
CH3
(a)
2.1
S
H3C
Media
Mineral salts medium (MSM) (containing g/L): KH2 PO4 -4.8; K2 HPO4 -1.2; NH4 NO3 -1.0; MgSO4 ·7H2 O-0.2; Ca (NO3 )2 ·4H2 O-0.04; and Fe (SO4 )3 -0.001 with pH adjusted to 7.0. Luria-Bertani (LB) broth (containing g/L): tryptone-10, sodium chloride-10 and yeast extract-5 with pH adjusted in the range of 7.0-7.2. Nutrient Broth (containing g/L): peptic digest of animal tissue — 5, beef extract — 1.5, yeast extract — 1.5, sodium chloride — 5, agar — 15. The analytical grade chemicals and reagents used in this work were purchased from Hi-media.
2.3
Isolation and purification of chlorpyrifosdegrading bacteria
Soil bacteria capable of degrading chlorpyrifos were isolated from agricultural soil of the Guntur District, Andhra Pradesh, India by using enrichment technique. Chlorpyrifos mixed media was prepared by thoroughly mixing chlorpyrifos with media (LB and MSM) at a concentration of 90 mg/L as a sole carbon source. Chlorpyrifos was added when the media was about to solidify (45-50℃). Wet unsieved soil (10 g) from each site was used to inoculate separate 250 mL flasks containing 100 mL of MS medium supplemented with chlorpyrifos (90 mg/L). The cultures were placed on a shaker (200 rpm) at 37℃ for 7 days. At periodic intervals, 500 µL of the supernatant was spread on chlorpyrifos containing mineral agar petridishes, and incubated at room temperature. The petridishes were observed till fourth day for the appearance of resistant colonies (Fig. 2). The individual bacterial colonies that grew on the medium were subcultured onto mineral agar containing chlorpyrifos of the same concentration until pure cultures were obtained. Each isolated strain was streaked at least 3 to 4 times on MSM agar plates for purification. The single colony of bacterial strain that displayed maximum pesticide utilization potential was inoculated in 100 mL LB broth, incubated at 37℃ and then used for further characterization of isolates. 2.4
Minimum inhibitory concentration (MIC) of chlorpyrifos-degrading bacteria
24-hour old bacterial cultures grown in mineral salts medium were inoculated at 10% inoculum size into 250 mL Erlenmeyer flasks containing 100 mL of LuriaBertani broth supplemented with various concentrations (50 – 500 mg/L) of chlorpyrifos to test their ability to degrade the supplemental substrate (pesticide) [8] [9]. A control was maintained with equal volume of broth containing bacterial culture, but without pesticide. Bacterial growth was followed by viable cell counts immediately after inoculation at 0 h and 2, 4, 6 and 24 h of incubation. A bacterial inoculum (1 mL) was drawn at regular intervals from the test and con-
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
Fig. 2
Resistant colonies obtained after enrichment stem growing on MSM agar supplemented with Chlorpyrifos.
3
µL of 10% SDS and incubated at 65℃ water bath for 2 hour with gentle over end inversions for every 15-20 minutes. The samples were then mixed and extracted three times using phenol chloroform and isoamylalcohol (25:24:1 vol/vol). The aqueous layer thus separated was precipitated by using 0.7 volume of isopropanol and incubating overnight at 37℃. After centrifugation at 12 000 x g the pellet was collected and washed using 70% chilled ethanol, dried at room temperature and dissolved in 40 µL MilliQ water. The genomic DNA were resolved on 0.8% (w/v) agarose gels in TAE buffer and viewed by staining with ethidium bromide upon exposure to UV light (Alpha InnotechFluroChem SP, USA). The bands were fairly observed which indicates that we had effectively isolated the DNA from the bacterial species of our interest. 2.7
trol cultures and serial dilutions were performed using 9 mL of sterile saline (0.85% NaCl; pH 7). Appropriate dilutions were plated in triplicate on nutrient agar and the plates incubated at 37℃ for 24 hours. The bacterial colonies were counted (CFU/mL) with a colony counter [10]. 2.5
Effect of environment on bacterial growth
The optimum temperature and pH for the bacterial isolate exhibiting maximum pesticide utilization potential was determined by inoculating the pure culture in Nutrient broth. To determine the effect of temperature and pH on the growth of bacterial isolates, 100 mL of Nutrient broth was taken in 250 mL Erlenmeyer flasks and autoclaved at 121℃, 15 psi for 20 minutes. After cooling, each flask was inoculated with purified bacterial isolate in active log phase, in the proportion of 2% of medium. For determining the optimum growth temperature, flasks were incubated at five different temperatures, viz. 15℃, 25℃, 37℃ and 55℃ and checked for growth in the form of turbidity. The uninoculated sterile nutrient broth tube was kept as negative control. For effect of pH, sterile nutrient broth with pH 3.0, 5.0, 7.0, 9.0 and 11.0 were used. All sets were performed in triplicate. 2.6
DNA isolation from cultured bacterial cells by phenol-chloroform method
Genomic DNA from the pure cultures was isolated by phenol-chloroform method. All the reagents used in molecular work were prepared according to the protocol in Sambrook and Russel, 2001 [11]. The pellet of pure culture obtained after centrifugation was resuspended in 300 µL of Tris-Cl (50 mM, Ph 8.0). The samples were then treated with 100 µL of lysozyme (25 mg/mL) and were subsequently incubated at 37℃ for 1 hour. After this, the samples were treated with 100
PCR amplification of the 16S rRNA gene
A significant benefit of molecular characterization and identification of new bacterial species by using the 16S rRNA primers can be designed though sequencing has not been completed. Such primers are known as “Universal Primers”. As 16S rRNA gene is exclusive for different species as well as for different strains of the same species but their flanks are highly conserved across different species so universal primers would be perfect for this purpose [14] [15]. Thus for any novel species primers can be designed as it would have the similar flanking regions of its 16S rRNA gene, and so the primer will affix to these flanking regions and facilitate the extension of the gene by their DNA polymerase enzyme. The following primers were used in the present study. PCR master mix consists of Taq polymerase enzyme, dNTP’s and 10X PCR buffer in it. All above components are added to a 200 µL capacity PCR vial. The reaction mixture contained PCR master mix (20 µL), template (2 µL), forward primers (1 µL), reverse primers (1 µL) and distilled water (6 µL). After adding all the above listed components the vial is placed in a 1500 µL capacity bigger vial and subjected to a very concise rotation in centrifuge, so that proper mixing of the contents would be done. ForwardPrimer : 5 AGAGTTTGATCCTGGCTCAG3 ReversePrimer : 5 GGTTACCTTGTTACGACTT3 Gradient Thermal Cycler is used to amplify the gene coding for the 16S ribosomal RNA from the isolated DNA. Different steps involved in PCR amplification are: Pre-Denaturation where entire amount of isolated DNA is alienated into single strands and is carried out at 94℃ for 5 minutes. It is followed by denaturation
4
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
h and the total viable count at the initial period was 14×107 CFU/mL. After incubation for 6 h, the total viable count was 60 × 107 CFU/mL and to 180 × 107 CFU/mL at 24 h. The results also indicated that growth of the bacterial isolate in the presence of chlorpyrifos was stimulated in the concentration range of 50–400 mg/L during 24 h of incubation and a marked reduction in the bacterial count during 24 h of incubation was noted at higher concentration (500 mg/L) of chlorpyrifos, suggesting that bacterial enzymes involved in chlorpyrifos hydrolysis were suppressed at this high concentration and the growth rate thus decreased (Fig. 4). 300 Viable cell count (×107 CFU/mL)
which is carried out at 94℃ for 1 minute. During denaturation step double stranded target gene of our interest is separated into single strands. After this step annealing takes place at 52℃ for 1 minute, where single stranded primer gets attached to its complementary single stranded sequence. Then renaturation takes place at 72℃ for 1 minute in each cycle which is followed by the final step called Elongation. It is carried out at 72℃ for 7 minute after all 25 cycles are completed. It is very important step so that any remaining piece of single stranded DNA can be extended [12] [13]. After the amplification of DNA 1 µL of the sample was taken and placed in the wells of 1% agarose gel and the electrophoresis was carried for the observation of the amplified DNA (Fig. 3).
200 150 100 50 0
Lane 1: Marker; Lane 2: PCR Product Fig. 3 16S rRNA PCR Product on 1% Agarose Gel.
2.8
0
2 4 6 Incubation time in hours (hr)
24
Determination of Minimum inhibitory concentration of Chlorpyrifos on bacterial species.
Purification of the amplified PCR product
After amplification, purification of PCR product is carried out. 5 µL of 3M sodium acetate solution (pH=4.6) and 100 µL of absolute ethanol is mixed in PCR vial. To precipitate the PCR product, vortexing of the vial and incubation at −20℃ for 30–40 min is performed. Now product is centrifuged at 10 000 rpm for 5 min. After this 300 µL of 70% ethanol is added to the resulting pellet and again centrifugation is carried out at 10 000 rpm for 5 min. After this step, the pellet is air dried until there was no perceivable smell of ethanol. Lastly the pellet is perched in 10 µL of sterile distilled water [15] [16].
3 Results and discussion 3.1
Fig. 4
500 ppm 400 ppm 300 ppm 200 ppm 100 ppm 50 ppm Control
250
Minimum inhibitory concentration (MIC) of chlorpyrifos-degrading bacteria
Growth curve experiments were performed with different doses of chlorpyrifos in order to determine the optimum concentration of chlorpyrifos that stimulates the growth of the bacterial isolate selected. A phase of adaptation of the bacterial isolate continued up to 4
3.2
Effect of environment on bacterial growth
The bacterial isolate showed ability to grow at wide range of temperature and pH. Growth was seen in the temperature range of 15℃ to 55℃ with the maximum growth seen at 37℃. Isolates showed growth in the pH range of 3.0 to 11.0 with the optimum pH found to be 7.0. 3.3
Sequencing of the PCR product
The amplified product from three independent PCRs was gel-purified, ligated into PCR2.1 (Invitrogen Life Technologies) and transformed into Esherichia coli INVaF(Invitrogen), as recommended by the manufacturer. Plasmid DNA was isolated using a plasmid isolation kit (Bio-Rad), digested with EcoRI and resolved by agarose gel electrophoresis. Plasmids containing appropriately sized inserts were sequenced using Sanger dideoxy sequencing. DNA Baser Sequence Assembler v.1.0 was used to assemble both the forward and reverse sequence ABI files [12] [14] [15]. The sequence obtained was deposited in GenBank database with Accession Number: JN794045.
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
3.4
16S rRNA-based phylogeny
The sequence so obtained was taken up for running NCBI BLAST against nr nucleotide database using Blastn algorithm for getting homologous sequences. Sequences showing a relevant degree of similarity were downloaded batch wise and multiple sequence alignment was performed [12] [13]. Phylogenetic tree was constructed from 16S rRNA gene sequences of members of genus Flavobacterium by different algorithms: neighbour-joining, 13 maximum parsimony tree17, maximum-likelihood18 and UPGMA
Fig. 5
3.5
5
method19 using MEGA5.20 [17]. In the neighbor joining tree, the sequences form a distinct lineage, with Chlorpyrifos degrading Flavobacterium species as the closest relatives. Phylogenetic construction of Chlorpyrifos degrading Flavobacterium EMBS0145 against other species of Flavobacterium is shown in (Fig. 5). The sequence dataset Flavobacterium EMBS0145 consisted of 1417 bp (100%) is parsimony informative. The matrix was competently and manually aligned. Coding gaps as binary characters, missing data had no affect on the topology and had affect on branch support.
Phylogenetic affiliation of Chlorpyrifos degrading Flavobacterium EMBS0145 against other species of Flavobacterium.
Phylogenetic analysis and elucidation of rRNA secondary structure
In order to understand the significance in predicting the stability of chemical or biological molecules or entities of Flavobacterium EMBS0145; RNA secondary structure prediction has been performed [18] [19] [20]. The 16S RNA gene sequence obtained was used to deduce the secondary structure of RNA us-
ing UNAFOLD [21] in Linux Platform. The secondary structure showed helical regions which bind with proteins S1eS27, hairpin loops, bulge loops, interior loops and multi-branched loops that may bind to 23S rRNA in the larger subunit of the ribosome. The free energy of the secondary structure of rRNA was ΔG −293.30 kcal/mol elucidated using UNAFOLD (Fig. 6). UNAFOLD results were obtained from .ct file and .reg file. Folding bases 1 to 1417 bp of Flavobacterium
6
Interdiscip Sci Comput Life Sci (2014) 6: 1–7
Fig. 6
RNA secondary structure of Flavobacterium EMBS0145 elucidated by UNAFOLD.
EMBS0145 at 37℃ shows the Gibb’s free energy, ΔG = −293.30 kcal/mol. The thermodynamics result from each base wise of the dataset shows the average of External closing pair Helix ΔG −8.80, Stack ΔG −2.50, Multi-loop ΔG −3.30, Bulge loop ΔG 0.50, Hairpin loop ΔG −4.20, Closing pair and Interior loop of ΔG -2.10 kcal/mol respectively. All rRNAs appear to be identical in function, because all are involved in the production of proteins. The overall three dimensional rRNA structure that corresponds to this function shows only minor-but highly significantvariation. However, within this nearly constant overall structure, molecular sequences in most regions of the molecule are continually evolving and undergoing change at the level of its primary structure while maintaining homologous secondary and tertiary structure,
which never alters molecular function.
4 Conclusion The described results of phylogenetic distinctiveness and phenotypic disparities indicate that strain 2b represents a novel strain within Flavobacterium species, for which the name Flavobacterium EMBS0145 is proposed. The sequence obtained was deposited in GenBank database with Accession Number: JN794045.
References [1] Sethunathan, N., & Pathak, M.D. 1972. Increased biological hydrolysis of diazinon after repeated application in rice paddies. Journal of agricultural and food chemistry, 20(3), 586-589.
Interdiscip Sci Comput Life Sci (2014) 6: 1–7 [2] Sethunathan, N., Yoshida, T. Jul. 1973. A Flavobacterium sp. that degrades diazinon and parathion. Can J Microbiol 19(7), 873-875. [3] Mallick, K., Bharati, K., Banerji, A., Shakil, N.A., & Sethunathan, N. 1999. Bacterial degradation of chlorpyrifos in pure cultures and in soil. Bulletin of environmental contamination and toxicology, 62(1), 48-54. [4] Aislabie, J., & Lloyd-Jones, G. 1995. A review of bacterial-degradation of pesticides. Soil Research, 33(6), 925-942. [5] Racke, K.D., & Frink, C.R. 1989. Fate of organic contaminants during sewage sludge composting. Bulletin of environmental contamination and toxicology, 42(4), 526-533. [6] Mallick, B.K., A. Banerji, N.A. Shakil, and N.N. Sethunathan. 1999. Bacterial degradation of chlorpyrifos in pure culture and in soil. Bull. Environ. Contam. Toxicol. 62, 48-55. [7] Karpouzas, D.G., Fotopoulou, A., MenkissogluSpiroudi, U., & Singh, B.K. 2005. Non-specific biodegradation of the organophosphorus pesticides, cadusafos and ethoprophos, by two bacterial isolates. FEMS microbiology ecology, 53(3), 369-378. [8] Maria, K., Graciela, C., Zauscher, F., 2002. Biodegradation of two commercial herbicides (Gramoxone and Matancha) by the bacteria Pseudomonas putida. E.J. Env. Biotech. 5(2), 182-195. [9] Mulbry, W.W., Del Valle, D.L., Karns, J.S., 1996. Biodegradation of the organophosphorous insecticide coumaphos in highly contaminated soils and in liquid wastes. Pestic. Sci. 48, 149-155. [10] Murugesan, A.G., Jeyasanthi, T., & Maheswari, S. 2010. Isolation and characterization of cypermethrin utilizing bacteria from Brinjal cultivated soil. African Journal of Microbiology Research, 4(1), 010-013. [11] Shetty, R.P., Endy, D., & Knight Jr, T.F. 2008. Engineering BioBrick vectors from BioBrick parts. Journal of biological engineering, 2(1), 1-12. [12] Acharya Nagarjun Pyde, P. Nagaraja Rao, Aditya Jain, Divya Soni, Shailesh Saket, Sheaza Ahmed, Sugunakar Vuree, Anuraj Nayarisseri. 2013. Identification and characterization of foodborne pathogen Listeria monocytogenes strain Pyde1 and Pyde2 using 16S rRNA gene sequencing. Journal of Pharmacy Research. 6(7), 736-741.
7 [13] Nandini Phanse, Pragya Rathore, Bhavesh Patel, Anuraj Nayarisseri. 2013. Characterization of an industrially important alkalophilic bacterium, Bacillus agaradhaerens strain nandiniphanse 5. Journal of Pharmacy Research. 6(5), 543-550. [14] Shah, K.P., Chandok, K.H., Rathore, P., Sharma, M.V., Yadav, M., & Anuraj Nayarisseri 2013. Screening, Isolation and Identification of Polygalacturonase Producing Bacillus tequilensis Strain EMBS083 Using 16S rRNA Gene Sequencing. European Journal of Biological Sciences, 5(1), 09-13. [15] Anuraj Nayarisseri. Sabnani M.K., Mukesh Yadav, Jyotsana, K., Deepika, S., and Rachna, C. 2012. Identification And Characterization of Proteases and Amylases Producing Bacillus licheniformis Strain EMBS026 By 16S rRNA Gene Sequencing. International Journal of Microbiology Research. 4(5), 231-235. [16] Anuraj, N.S., Sheaza Ahmed, Mukesh Yadav, Sneha Singh, Meer Asif A, Mayura Maynal and Urvashi Pisal. 2012. Identification And Characterization of Neutral Protease Producing Paenibacillus Polymyxa Species EMBS024 By 16S rRNA Gene Sequencing. International Journal of Microbiology Research. 4(5), 236-239. [17] Tamura, K., Dudley, J., Nei, M., & Kumar, S. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular biology and evolution, 24(8), 1596-1599. [18] Zuker, Michael, David H. Mathews, and Douglas H. Turner. 1999. Algorithms and thermodynamics for RNA secondary structure prediction: a practical guide. RNA biochemistry and biotechnology. Springer Netherlands, 11-43. [19] Mathews, D.H., Sabina, J., Zuker, M., & Turner, D.H. 1999. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of molecular biology, 288(5), 911-940. [20] SantaLucia, J., & Turner, D.H. 1997. Measuring the thermodynamics of RNA secondary structure formation. Biopolymers, 44(3), 309-319. [21] Markham, Nicholas R., and Michael Zuker. 2008. “UNAFold.” Bioinformatics. Humana Press, 3-31.
