Vol. 11, No. 4
MOLECULAR AND CELLULAR BIOLOGY, Apr. 1991, p. 1875-1882
0270-7306/91/041875-08$02.00/0 Copyright © 1991, American Society for Microbiology
Identification and Characterization of a Novel Enhancer for the Rat neu Promoter DUEN-HWA YAN AND MIEN-CHIE HUNG*
Department
of
Tumor Biology, The University of Texas, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 Received 26 October 1990/Accepted 11 January 1991
We used chloramphenicol acetyltransferase (CAT) assays to identify and characterize cis-acting elements responsible for rat neu promoter function. Deletion of a region of the neu promoter (-504 to -312) resulted in a marked decrease in CAT activity, indicating that this promoter region corresponds to a positive cis-acting element. Using band shift assays and methylation interference analyses, we further identified a specific protein-binding sequence, AAGATAAAACC (-466 to -456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. Our results demonstrate that RVF is the major DNA-binding protein contributing to enhancer activity. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.
The rat neu oncogene encodes a 185-kDa transmembrane protein (p185) (29, 32) that is structurally similar to the epidermal growth factor (EGF) receptor (2). Activation of the neu proto-oncogene requires a single point mutation which changes a valine to a glutamic acid residue in the transmembrane domain of p185 (3). The activated p185 exhibits a tyrosine kinase (TK) activity higher than that of its proto-oncogene product and is associated with higher tumorigenic potential (4, 5, 38). While the mutation-activated neu oncogene efficiently transformed NIH 3T3 cells, an initial attempt to amplify the rat genomic neu proto-oncogene in NIH 3T3 cells failed to do so (3, 15). Instead, amplification of the rat neu gene facilitated an oncogenic point mutation and eventually resulted in transformation of NIH 3T3 cells (16). However, when the neu cDNA was driven by a strong promoter such as the Moloney murine leukemia virus long terminal repeat, overexpression of both the rat and human neu (also called HER-2/c-erbB-2) protooncogenes could transform NIH 3T3 cells (8, 9, 14). In addition, amplification or overexpression of the human neu proto-oncogene is associated with a variety of human tumors (11, 34-36, 47, 49). In breast and ovarian cancers, overexpression of the human neu gene was further shown to correlate with poor prognosis for patients (35, 36). So far, no point mutation in the human neu gene has been found in human tumors (26, 31). Interestingly, many of the breast cancer cell lines with overexpressed neu mRNA have been found to be without significant gene amplification (21), suggesting that transcriptional or posttranscriptional mechanisms may be involved in overexpression of the human neu gene in these cancer cell lines. It has been shown that neu gene expression can be both positively and negatively regulated at the transcriptional level (13, 40, 41, 46, 48). In the case of the human neu promoter (13, 18, 43), transcription can be induced by EGF, 12-O-tetradecanoylphorbol-13-acetate (TPA), dibutyryl cy*
clic AMP (cAMP), and retinoic acid in an additive or synergistic manner, indicating the presence of multiple inducible enhancer elements in the human neu promoter region (13). In the case of the rat neu promoter, we have recently cloned the promoter region and defined the multiple cis-acting elements and trans-acting factors that may regulate neu gene expression (40). In addition, we have shown that the rat neu gene can be transcriptionally repressed by other nuclear oncogene products, such as adenovirus Ela (48) and c-myc (41). In both cases, transcriptional repression was mediated through a 140-bp StuI-XhoI fragment (nucleotides -312 to -174 relative to the first initiator codon ATG) on the rat neu gene promoter. In this study, we further identified and characterized a novel enhancer sequence located between -474 and -445 bp upstream of the first initiator codon ATG. Using Southwestern (DNA-protein) analysis, we also identified a potential trans-acting factor, a 60-kDa polypeptide that binds to this enhancer. MATERIALS AND METHODS
DNA probes. To obtain a single-end-labeled EcoRV-AluI neu promoter element, a 346-bp EcoRV-XhoI fragment was isolated from plasmid pUC(RV/Xho) by EcoRIHindlll double digestion. The EcoRV-XhoI fragment was then dephosphorylated by calf intestine phosphatase (Boehringer Mannheim Biochemicals, Indianapolis, Ind.) and subsequently labeled with [-y-32P]ATP by T4 kinase. The endlabeled EcoRV-XhoI fragment was restricted by AluI. The reaction was then run on a 4% native polyacrylamide gel. The DNA band corresponding to the R/A fragment was excised and electroeluted by using an electroeluter (ISCO, Inc., Lincoln, Neb.). The resulting 5'-single-end-labeled R/A fragment was used in band shift assays and methylation interference analysis on the top strand of R/A DNA. On the bottom strand, the EcoRV-XhoI fragment was end labeled by reverse transcriptase with [a-32P]dATP; and restricted by AluI; the 3'-single-end-labeled R/A fragment was then separated and purified. To label a 30-mer wild-type (wt)
(R/A)
Corresponding author. 1875
1876
YAN AND HUNG
(GAGTGTTCAAGATAAAACCGGAGACTGCAA) or mutant (mut) (GAGTGTTAAAGATAAAATAGGAGACTGC AA) oligonucleotide, 1 ,ug of annealed double-stranded oligonucleotide, with 5' XbaI sticky ends (CTAG), was labeled with [_y-32P]ATP by T4 kinase, and the free [-y-32P]ATP nucleotides were removed by passing the reaction mixture through a Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Richmond, Calif.). Band shift assay. Nuclear extracts were made from Swiss Webster 3T3 (SW3T3) cells as described by Dynan (10). The binding reaction was carried out in buffer containing 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; pH 7.9), 5% glycerol, 0.1 M KCI, 0.2 mM EDTA, 2 mM dithiothreitol, and 1 mg of bovine serum albumin per ml. For a typical binding reaction, 4 ,ug of polyd(IC) polyd (IC) (Pharmacia) was added as a nonspecific carrier in addition to 10,000 cpm (0.5 to 1 ng) of end-labeled DNA with 4 to 6 ,ug of extract, which was added last. After incubation for 10 min at room temperature, the binding mixture was electrophoresed through a native 4% polyacrylamide gel (acrylamide/bisacrylamide ratio, 29:1) containing 0.5x TBE (45 mM Tris-borate, 45 mM boric acid, 1 mM EDTA [pH 8.0]). Electrophoresis was carried out at 200 V for 2 h at room temperature. The gel was then dried and autoradiographed with an intensifying screen at -70°C. For competition experiments, the conditions were exactly as described above except that specific and nonspecific competitor DNAs were included in the binding reaction prior to addition of the extract. Methylation interference analysis. As previously described (1), 5'- or 3'-single-end-labeled R/A fragment was partially methylated at the guanine residues. For a typical preparative binding reaction, the usual condition was scaled up fivefold and electrophoresed as described above. After electrophoresis, the gel was wrapped with Saran Wrap and exposed wet for 12 to 16 h at 4°C. The complex and free fragment bands were then excised and electroeluted to recover the DNA. Prior to ethanol precipitation, tRNA was added as a carrier, and the solution was extracted once with phenol-chloroform (1:1). The resulting pellet was rinsed with 70% ethanol, dried, and then redissolved in 70 RI of 10% piperidine. Base cleavage reactions were carried out for 30 min at 90°C, after which piperidine was removed with a Speed-Vac. After two additional rounds of evaporation to remove the trace amount of piperidine from water, the DNA was analyzed by being run through an 8% polyacrylamide gel in the presence of 7 M urea, followed by autoradiography at -70°C with an intensifying screen. CAT expression plasmids. pNeuEcoRVCAT and pNeu StuICAT were constructed as described previously (40). The wt oligonucleotide (with XbaI sticky ends) was subcloned into the XbaI site upstream of the TK promoter of pBLCAT-2, which is a chloramphenicol acetyltransferase (CAT) expression vector (27). Four clones (pRVFM-1, pRVFM-2, pRVFD-1, and pRVFD-2) were obtained, which contain monomer (M) or dimer (D) in either orientation, as confirmed by DNA sequencing (see Fig. 6A). The same procedure was followed to obtain a subcloned mutant oligonucleotide in pBLCAT-2 (pRVFmM-1 and pRVFmM-2; see Fig. 7). To generate pUCRVF as a competitor plasmid, pRVFD-1 was restricted by BamHI and SmaI to remove the TK promoter and CAT sequences, the BamHI sticky end was filled in by reverse transcriptase, and the ends were religated. Transfection and CAT assays. Introduction of CAT expression plasmids into all cells was performed by CaPO4 copre-
MOL. CELL. BIOL.
cipitation (6), using 10 to 20 pug of a CAT construct and 5 ,ug of a Rous sarcoma virus long terminal repeat-lacZ construct. Cells were harvested 48 to 72 h after transfection. To normalize transfection efficiency, P-galactosidase assays (12, 25) were first performed with 20% of the cell extract to provide relative values. The resulting values were used to standardize the amount of extract added to the subsequent CAT assays. CAT activity was determined by measuring the amount of [14C]chloramphenicol (Amersham) converted to its acetylated forms during incubation at 37°C in the presence of 30 p.l of 4 mM acetyl coenzyme A in a 150-,ul reaction. The products were separated by thin-layer chromatography, and spots were analyzed by a Betascope 603 blot analyzer (Betagen, Waltham, Mass.). Southwestern analysis. Southwestern blotting was performed as described previously (28), with minor modifications. Briefly, 100 pug of SW3T3 nuclear extract was electrophoresed through an 8% sodium dodecyl sulfate (SDS) polyacrylamide gel (23) at room temperature. Prior to protein transfer, the gel, nitrocellulose membrane, and 3MM filter papers were soaked in the transfer buffer (48 mM Tris, 39 mM glycine, 1.3 mM SDS, 20% methanol) for at least 15 min. The proteins were transferred to the nitrocellulose membrane electrophoretically by using a semidry electroblotter (Sartoblot II S; Sartorius Co., Long Island, N.Y.). After transfer, the nitrocellulose membrane was covered with 5% (wt/vol) nonfat dry milk (Carnation) in 10 mM HEPES (pH 7.9), incubated for 1 h at room temperature, and then incubated for 1 h at room temperature in binding buffer (10 mM HEPES [pH 7.9], 50 mM NaCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol, 0.25% nonfat dry milk) containing 10,000 cpm of 32P-labeled oligonucleotide per ml. The nitrocellulose membrane was washed in two changes of binding buffer containing 0.3 M NaCl over a period of 1 to 2 h, air dried, and autoradiographed. RESULTS Identification of a novel trans-acting factor-binding site in the neu promoter. We have previously isolated a 33-kb genomic clone containing about 2 kb of the 5' untranslated region of the rat neu oncogene. Functional analysis by CAT assay revealed the presence of both positive and negative regulatory elements. Among a series of neu-CAT promoter deletion constructs, pNeuEcoRVCAT (Fig. IA) gave the highest CAT activity in Rat-i cells (40) and in a mouse fibroblast cell line, SW3T3 (data not shown). A further deletion, pNeuStuICAT (Fig. 1A), resulted in an approximately 40% reduction in CAT activity, suggesting that the region between EcoRV and StuI may contain a positive cis-acting element (40; Fig. 1A) and that positive trans-acting factors may interact with the EcoRV-StuI fragment to stimulate neu transcription. To investigate this possibility, we used the band shift assay by incubating either the endlabeled R/A fragment (see Fig. 1A) or the end-labeled EcoRV-StuI fragment with SW3T3 nuclear extract. Since the band shift patterns obtained by using the EcoRV-StuI and R/A probes were identical (data not shown), only the results with the shorter fragment (R/A) are shown. Multiple shifted bands were observed in the presence of nonspecific competitor DNA, polyd(IC) polyd(IC) (Fig. 1B, lane 0), suggesting that the R/A fragment may interact with multiple DNA-binding proteins. To identify specific binding factors for the R/A fragment in the neu promoter, the following cold competitor DNAs were coincubated in the binding reactions: R/A fragment, EGF receptor promoter (19), and simian virus
VOL.
11, 1991
NOVEL ENHANCER FOR THE RAT neu PROMOTER
Average CAT
A.
activity
EcoRV
Alul Stul
504
-346 -31 2
-
1877
ICAT
pNeuEcoRVCAT
1 00
Stu
HCAT
B. Fo
am
a
0
1
0.
LLC wi
4-
40 promoter (37). The cold R/A fragment could efficiently abolish the slowest-migrating protein-DNA complex (arrow in Fig. 1B) as well as several fast-migrating complexes. In contrast, the protein-DNA complexes could not be abolished to the same extent by other promoter elements, such as the EGF receptor and simian virus 40 promoters. These data suggest that the slowest-migrating complex and several fast-migrating complexes contain DNA-binding proteins that interact specifically with the R/A fragment. Of these specific protein-DNA complexes, we focused on the slowest-migrating complex because it was the dominant one among the R/A-specific bands and could be easily separated from the other nonspecific bands. To study the protein-DNA interaction within this slowest-migrating complex, we performed methylation interference analyses. The top strand of the R/A fragment was 5' end labeled, and the bottom strand was 3' end labeled. The single-end-labeled R/A elements were then partially methylated and used as probes in binding reactions with SW3T3 nuclear extract. Piperidine cleavage of DNA in the slowest-migrating complex indicated clear binding interference as a result of methylation of the indicated G residues on the top and bottom strands (Fig. 2). On the top strand, three moderately interfering G residues at positions -464, -455, and -454 were identified. These G residues overlapped with three G residues on the bottom strand (nucleotides -467, -457, and -456; solid arrowheads in Fig. 2) which strongly interfered with protein binding. The proteinbinding site covers 14 bp (CAAGATAAAACCGG) and resides between -474 and -445 bp upstream of the initiator codon ATG. This region was also protected by the copper orthophenanthroline footprinting method (22) in the slowestmigrating complex (data not shown). Therefore, this 14-bp sequence represents a potential trans-acting factor-binding sequence on the neu promoter. This observation was confirmed by further band shift competition assays (Fig. 3A), which revealed that when a labeled R/A fragment was used, only the wt oligonucleotide
j
62 pNeuStuICAT FIG. 1. (A) Expression of rat neu promoter-CAT constructs with or without an EcoRV-StuI fragment in SW3T3 cells. Activities of the vectors were tested in transient CAT assays. The CAT expression level of pNeuEcoRVCAT was arbitrarily designated as 100. The positions of various restriction sites were numbered in relation to the initiator codon ATG. (B) Interaction between specific DNAbinding factors and the R/A fragment. A band shift assay was performed by incubating single-end-labeled R/A fragment (10,000 cpm) with or without 5 p.g of SW3T3 nuclear extract, 4 ,ug of polyd(IC) polyd(IC), and various competitor DNAs: 0, without competitor DNA; R/A, cold R/A fragment; EGFRp, EGF receptor promoter derived from pERCAT-9 (19); and SV40p, simian virus 40 promoter isolated from pSV2-neo (37). F, R/A probe alone; the minor band is due to partial denaturation of the probe during ethanol precipitation (42). All competitions were done in the presence of a 50-fold molar excess of the competitor DNAs. The arrow indicates the slowest-migrating protein-DNA complex.
(a 30-mer) containing the intact trans-acting factor-binding site could efficiently and exclusively abolish the slowestmigrating complex, but not the fast-migrating complexes, in the presence of SW3T3 nuclear extract. The mut oligonucleotide (a 30-mer with three bottom-strand interfering G residues substituted with other nucleotides) and a nonspecific (ns) oligonucleotide (a 16-mer with a totally unrelated sequence) failed to efficiently abolish the slowest-migrating complex bound to the R/A fragment (Fig. 3A). The slowestmigrating complex was also observed when human HeLa cell nuclear extract was used in the binding reactions. This complex was most sensitive to wt oligonucleotide competition but much less so to mut or ns oligonucleotide competition (Fig. 3B). These results suggest that a sequence-specific trans-acting factor(s) interacting with the 14-bp element is present in both mouse and human cells. Band shift assays with the labeled wt oligonucleotide as a probe yielded similar results (Fig. 3C and D). Again, the slowest-migrating complex could be efficiently abolished by the cold wt oligonucleotide but not by the mut or ns oligonucleotide (Fig. 3C and D). However, there were several fast-migrating complexes (bracket in Fig. 3D) that could be abolished not only by the wt but also by the mut oligonucleotide. This result indicates the presence of multiple wt oligonucleotide-binding factors, whose binding activity was not affected by the base substitutions within the 14-bp region. To further confirm this observation, the labeled mut oligonucleotide was used as a probe in a band shift assay in the presence of SW3T3 nuclear extract. The mut oligonucleotide failed to form the slowest-migrating complex, but the fast-migrating complexes (bracket in Fig. 3D) were still retained (data not shown). Therefore, we conclude that the slowest-migrating complex includes a potential trans-acting factor that specifically interacts with the 14-bp proteinbinding sequence. We have named this putative factor RVF (for EcoRV factor on the neu promoter). It has been reported recently that estrogen receptor selectively binds to the single-stranded coding strand of an estrogen-responsive element with a much higher affinity than to the double-stranded estrogen-responsive element' (24).
1878
MOL. CELL. BIOL.
YAN AND HUNG
BOTTOM
TOP
F
F B
_SW3T3
B
F
1C
3C
10
o
wt
ns
mut
wt
30
1C
30
1C
2
_Hela mut 10
30
ns
30
0
30
(X)
.9l
is a
is Al _
MOLECULAR AND CELLULAR BIOLOGY, Apr. 1991, p. 1875-1882
0270-7306/91/041875-08$02.00/0 Copyright © 1991, American Society for Microbiology
Identification and Characterization of a Novel Enhancer for the Rat neu Promoter DUEN-HWA YAN AND MIEN-CHIE HUNG*
Department
of
Tumor Biology, The University of Texas, M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 Received 26 October 1990/Accepted 11 January 1991
We used chloramphenicol acetyltransferase (CAT) assays to identify and characterize cis-acting elements responsible for rat neu promoter function. Deletion of a region of the neu promoter (-504 to -312) resulted in a marked decrease in CAT activity, indicating that this promoter region corresponds to a positive cis-acting element. Using band shift assays and methylation interference analyses, we further identified a specific protein-binding sequence, AAGATAAAACC (-466 to -456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. Our results demonstrate that RVF is the major DNA-binding protein contributing to enhancer activity. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.
The rat neu oncogene encodes a 185-kDa transmembrane protein (p185) (29, 32) that is structurally similar to the epidermal growth factor (EGF) receptor (2). Activation of the neu proto-oncogene requires a single point mutation which changes a valine to a glutamic acid residue in the transmembrane domain of p185 (3). The activated p185 exhibits a tyrosine kinase (TK) activity higher than that of its proto-oncogene product and is associated with higher tumorigenic potential (4, 5, 38). While the mutation-activated neu oncogene efficiently transformed NIH 3T3 cells, an initial attempt to amplify the rat genomic neu proto-oncogene in NIH 3T3 cells failed to do so (3, 15). Instead, amplification of the rat neu gene facilitated an oncogenic point mutation and eventually resulted in transformation of NIH 3T3 cells (16). However, when the neu cDNA was driven by a strong promoter such as the Moloney murine leukemia virus long terminal repeat, overexpression of both the rat and human neu (also called HER-2/c-erbB-2) protooncogenes could transform NIH 3T3 cells (8, 9, 14). In addition, amplification or overexpression of the human neu proto-oncogene is associated with a variety of human tumors (11, 34-36, 47, 49). In breast and ovarian cancers, overexpression of the human neu gene was further shown to correlate with poor prognosis for patients (35, 36). So far, no point mutation in the human neu gene has been found in human tumors (26, 31). Interestingly, many of the breast cancer cell lines with overexpressed neu mRNA have been found to be without significant gene amplification (21), suggesting that transcriptional or posttranscriptional mechanisms may be involved in overexpression of the human neu gene in these cancer cell lines. It has been shown that neu gene expression can be both positively and negatively regulated at the transcriptional level (13, 40, 41, 46, 48). In the case of the human neu promoter (13, 18, 43), transcription can be induced by EGF, 12-O-tetradecanoylphorbol-13-acetate (TPA), dibutyryl cy*
clic AMP (cAMP), and retinoic acid in an additive or synergistic manner, indicating the presence of multiple inducible enhancer elements in the human neu promoter region (13). In the case of the rat neu promoter, we have recently cloned the promoter region and defined the multiple cis-acting elements and trans-acting factors that may regulate neu gene expression (40). In addition, we have shown that the rat neu gene can be transcriptionally repressed by other nuclear oncogene products, such as adenovirus Ela (48) and c-myc (41). In both cases, transcriptional repression was mediated through a 140-bp StuI-XhoI fragment (nucleotides -312 to -174 relative to the first initiator codon ATG) on the rat neu gene promoter. In this study, we further identified and characterized a novel enhancer sequence located between -474 and -445 bp upstream of the first initiator codon ATG. Using Southwestern (DNA-protein) analysis, we also identified a potential trans-acting factor, a 60-kDa polypeptide that binds to this enhancer. MATERIALS AND METHODS
DNA probes. To obtain a single-end-labeled EcoRV-AluI neu promoter element, a 346-bp EcoRV-XhoI fragment was isolated from plasmid pUC(RV/Xho) by EcoRIHindlll double digestion. The EcoRV-XhoI fragment was then dephosphorylated by calf intestine phosphatase (Boehringer Mannheim Biochemicals, Indianapolis, Ind.) and subsequently labeled with [-y-32P]ATP by T4 kinase. The endlabeled EcoRV-XhoI fragment was restricted by AluI. The reaction was then run on a 4% native polyacrylamide gel. The DNA band corresponding to the R/A fragment was excised and electroeluted by using an electroeluter (ISCO, Inc., Lincoln, Neb.). The resulting 5'-single-end-labeled R/A fragment was used in band shift assays and methylation interference analysis on the top strand of R/A DNA. On the bottom strand, the EcoRV-XhoI fragment was end labeled by reverse transcriptase with [a-32P]dATP; and restricted by AluI; the 3'-single-end-labeled R/A fragment was then separated and purified. To label a 30-mer wild-type (wt)
(R/A)
Corresponding author. 1875
1876
YAN AND HUNG
(GAGTGTTCAAGATAAAACCGGAGACTGCAA) or mutant (mut) (GAGTGTTAAAGATAAAATAGGAGACTGC AA) oligonucleotide, 1 ,ug of annealed double-stranded oligonucleotide, with 5' XbaI sticky ends (CTAG), was labeled with [_y-32P]ATP by T4 kinase, and the free [-y-32P]ATP nucleotides were removed by passing the reaction mixture through a Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Richmond, Calif.). Band shift assay. Nuclear extracts were made from Swiss Webster 3T3 (SW3T3) cells as described by Dynan (10). The binding reaction was carried out in buffer containing 20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; pH 7.9), 5% glycerol, 0.1 M KCI, 0.2 mM EDTA, 2 mM dithiothreitol, and 1 mg of bovine serum albumin per ml. For a typical binding reaction, 4 ,ug of polyd(IC) polyd (IC) (Pharmacia) was added as a nonspecific carrier in addition to 10,000 cpm (0.5 to 1 ng) of end-labeled DNA with 4 to 6 ,ug of extract, which was added last. After incubation for 10 min at room temperature, the binding mixture was electrophoresed through a native 4% polyacrylamide gel (acrylamide/bisacrylamide ratio, 29:1) containing 0.5x TBE (45 mM Tris-borate, 45 mM boric acid, 1 mM EDTA [pH 8.0]). Electrophoresis was carried out at 200 V for 2 h at room temperature. The gel was then dried and autoradiographed with an intensifying screen at -70°C. For competition experiments, the conditions were exactly as described above except that specific and nonspecific competitor DNAs were included in the binding reaction prior to addition of the extract. Methylation interference analysis. As previously described (1), 5'- or 3'-single-end-labeled R/A fragment was partially methylated at the guanine residues. For a typical preparative binding reaction, the usual condition was scaled up fivefold and electrophoresed as described above. After electrophoresis, the gel was wrapped with Saran Wrap and exposed wet for 12 to 16 h at 4°C. The complex and free fragment bands were then excised and electroeluted to recover the DNA. Prior to ethanol precipitation, tRNA was added as a carrier, and the solution was extracted once with phenol-chloroform (1:1). The resulting pellet was rinsed with 70% ethanol, dried, and then redissolved in 70 RI of 10% piperidine. Base cleavage reactions were carried out for 30 min at 90°C, after which piperidine was removed with a Speed-Vac. After two additional rounds of evaporation to remove the trace amount of piperidine from water, the DNA was analyzed by being run through an 8% polyacrylamide gel in the presence of 7 M urea, followed by autoradiography at -70°C with an intensifying screen. CAT expression plasmids. pNeuEcoRVCAT and pNeu StuICAT were constructed as described previously (40). The wt oligonucleotide (with XbaI sticky ends) was subcloned into the XbaI site upstream of the TK promoter of pBLCAT-2, which is a chloramphenicol acetyltransferase (CAT) expression vector (27). Four clones (pRVFM-1, pRVFM-2, pRVFD-1, and pRVFD-2) were obtained, which contain monomer (M) or dimer (D) in either orientation, as confirmed by DNA sequencing (see Fig. 6A). The same procedure was followed to obtain a subcloned mutant oligonucleotide in pBLCAT-2 (pRVFmM-1 and pRVFmM-2; see Fig. 7). To generate pUCRVF as a competitor plasmid, pRVFD-1 was restricted by BamHI and SmaI to remove the TK promoter and CAT sequences, the BamHI sticky end was filled in by reverse transcriptase, and the ends were religated. Transfection and CAT assays. Introduction of CAT expression plasmids into all cells was performed by CaPO4 copre-
MOL. CELL. BIOL.
cipitation (6), using 10 to 20 pug of a CAT construct and 5 ,ug of a Rous sarcoma virus long terminal repeat-lacZ construct. Cells were harvested 48 to 72 h after transfection. To normalize transfection efficiency, P-galactosidase assays (12, 25) were first performed with 20% of the cell extract to provide relative values. The resulting values were used to standardize the amount of extract added to the subsequent CAT assays. CAT activity was determined by measuring the amount of [14C]chloramphenicol (Amersham) converted to its acetylated forms during incubation at 37°C in the presence of 30 p.l of 4 mM acetyl coenzyme A in a 150-,ul reaction. The products were separated by thin-layer chromatography, and spots were analyzed by a Betascope 603 blot analyzer (Betagen, Waltham, Mass.). Southwestern analysis. Southwestern blotting was performed as described previously (28), with minor modifications. Briefly, 100 pug of SW3T3 nuclear extract was electrophoresed through an 8% sodium dodecyl sulfate (SDS) polyacrylamide gel (23) at room temperature. Prior to protein transfer, the gel, nitrocellulose membrane, and 3MM filter papers were soaked in the transfer buffer (48 mM Tris, 39 mM glycine, 1.3 mM SDS, 20% methanol) for at least 15 min. The proteins were transferred to the nitrocellulose membrane electrophoretically by using a semidry electroblotter (Sartoblot II S; Sartorius Co., Long Island, N.Y.). After transfer, the nitrocellulose membrane was covered with 5% (wt/vol) nonfat dry milk (Carnation) in 10 mM HEPES (pH 7.9), incubated for 1 h at room temperature, and then incubated for 1 h at room temperature in binding buffer (10 mM HEPES [pH 7.9], 50 mM NaCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol, 0.25% nonfat dry milk) containing 10,000 cpm of 32P-labeled oligonucleotide per ml. The nitrocellulose membrane was washed in two changes of binding buffer containing 0.3 M NaCl over a period of 1 to 2 h, air dried, and autoradiographed. RESULTS Identification of a novel trans-acting factor-binding site in the neu promoter. We have previously isolated a 33-kb genomic clone containing about 2 kb of the 5' untranslated region of the rat neu oncogene. Functional analysis by CAT assay revealed the presence of both positive and negative regulatory elements. Among a series of neu-CAT promoter deletion constructs, pNeuEcoRVCAT (Fig. IA) gave the highest CAT activity in Rat-i cells (40) and in a mouse fibroblast cell line, SW3T3 (data not shown). A further deletion, pNeuStuICAT (Fig. 1A), resulted in an approximately 40% reduction in CAT activity, suggesting that the region between EcoRV and StuI may contain a positive cis-acting element (40; Fig. 1A) and that positive trans-acting factors may interact with the EcoRV-StuI fragment to stimulate neu transcription. To investigate this possibility, we used the band shift assay by incubating either the endlabeled R/A fragment (see Fig. 1A) or the end-labeled EcoRV-StuI fragment with SW3T3 nuclear extract. Since the band shift patterns obtained by using the EcoRV-StuI and R/A probes were identical (data not shown), only the results with the shorter fragment (R/A) are shown. Multiple shifted bands were observed in the presence of nonspecific competitor DNA, polyd(IC) polyd(IC) (Fig. 1B, lane 0), suggesting that the R/A fragment may interact with multiple DNA-binding proteins. To identify specific binding factors for the R/A fragment in the neu promoter, the following cold competitor DNAs were coincubated in the binding reactions: R/A fragment, EGF receptor promoter (19), and simian virus
VOL.
11, 1991
NOVEL ENHANCER FOR THE RAT neu PROMOTER
Average CAT
A.
activity
EcoRV
Alul Stul
504
-346 -31 2
-
1877
ICAT
pNeuEcoRVCAT
1 00
Stu
HCAT
B. Fo
am
a
0
1
0.
LLC wi
4-
40 promoter (37). The cold R/A fragment could efficiently abolish the slowest-migrating protein-DNA complex (arrow in Fig. 1B) as well as several fast-migrating complexes. In contrast, the protein-DNA complexes could not be abolished to the same extent by other promoter elements, such as the EGF receptor and simian virus 40 promoters. These data suggest that the slowest-migrating complex and several fast-migrating complexes contain DNA-binding proteins that interact specifically with the R/A fragment. Of these specific protein-DNA complexes, we focused on the slowest-migrating complex because it was the dominant one among the R/A-specific bands and could be easily separated from the other nonspecific bands. To study the protein-DNA interaction within this slowest-migrating complex, we performed methylation interference analyses. The top strand of the R/A fragment was 5' end labeled, and the bottom strand was 3' end labeled. The single-end-labeled R/A elements were then partially methylated and used as probes in binding reactions with SW3T3 nuclear extract. Piperidine cleavage of DNA in the slowest-migrating complex indicated clear binding interference as a result of methylation of the indicated G residues on the top and bottom strands (Fig. 2). On the top strand, three moderately interfering G residues at positions -464, -455, and -454 were identified. These G residues overlapped with three G residues on the bottom strand (nucleotides -467, -457, and -456; solid arrowheads in Fig. 2) which strongly interfered with protein binding. The proteinbinding site covers 14 bp (CAAGATAAAACCGG) and resides between -474 and -445 bp upstream of the initiator codon ATG. This region was also protected by the copper orthophenanthroline footprinting method (22) in the slowestmigrating complex (data not shown). Therefore, this 14-bp sequence represents a potential trans-acting factor-binding sequence on the neu promoter. This observation was confirmed by further band shift competition assays (Fig. 3A), which revealed that when a labeled R/A fragment was used, only the wt oligonucleotide
j
62 pNeuStuICAT FIG. 1. (A) Expression of rat neu promoter-CAT constructs with or without an EcoRV-StuI fragment in SW3T3 cells. Activities of the vectors were tested in transient CAT assays. The CAT expression level of pNeuEcoRVCAT was arbitrarily designated as 100. The positions of various restriction sites were numbered in relation to the initiator codon ATG. (B) Interaction between specific DNAbinding factors and the R/A fragment. A band shift assay was performed by incubating single-end-labeled R/A fragment (10,000 cpm) with or without 5 p.g of SW3T3 nuclear extract, 4 ,ug of polyd(IC) polyd(IC), and various competitor DNAs: 0, without competitor DNA; R/A, cold R/A fragment; EGFRp, EGF receptor promoter derived from pERCAT-9 (19); and SV40p, simian virus 40 promoter isolated from pSV2-neo (37). F, R/A probe alone; the minor band is due to partial denaturation of the probe during ethanol precipitation (42). All competitions were done in the presence of a 50-fold molar excess of the competitor DNAs. The arrow indicates the slowest-migrating protein-DNA complex.
(a 30-mer) containing the intact trans-acting factor-binding site could efficiently and exclusively abolish the slowestmigrating complex, but not the fast-migrating complexes, in the presence of SW3T3 nuclear extract. The mut oligonucleotide (a 30-mer with three bottom-strand interfering G residues substituted with other nucleotides) and a nonspecific (ns) oligonucleotide (a 16-mer with a totally unrelated sequence) failed to efficiently abolish the slowest-migrating complex bound to the R/A fragment (Fig. 3A). The slowestmigrating complex was also observed when human HeLa cell nuclear extract was used in the binding reactions. This complex was most sensitive to wt oligonucleotide competition but much less so to mut or ns oligonucleotide competition (Fig. 3B). These results suggest that a sequence-specific trans-acting factor(s) interacting with the 14-bp element is present in both mouse and human cells. Band shift assays with the labeled wt oligonucleotide as a probe yielded similar results (Fig. 3C and D). Again, the slowest-migrating complex could be efficiently abolished by the cold wt oligonucleotide but not by the mut or ns oligonucleotide (Fig. 3C and D). However, there were several fast-migrating complexes (bracket in Fig. 3D) that could be abolished not only by the wt but also by the mut oligonucleotide. This result indicates the presence of multiple wt oligonucleotide-binding factors, whose binding activity was not affected by the base substitutions within the 14-bp region. To further confirm this observation, the labeled mut oligonucleotide was used as a probe in a band shift assay in the presence of SW3T3 nuclear extract. The mut oligonucleotide failed to form the slowest-migrating complex, but the fast-migrating complexes (bracket in Fig. 3D) were still retained (data not shown). Therefore, we conclude that the slowest-migrating complex includes a potential trans-acting factor that specifically interacts with the 14-bp proteinbinding sequence. We have named this putative factor RVF (for EcoRV factor on the neu promoter). It has been reported recently that estrogen receptor selectively binds to the single-stranded coding strand of an estrogen-responsive element with a much higher affinity than to the double-stranded estrogen-responsive element' (24).
1878
MOL. CELL. BIOL.
YAN AND HUNG
BOTTOM
TOP
F
F B
_SW3T3
B
F
1C
3C
10
o
wt
ns
mut
wt
30
1C
30
1C
2
_Hela mut 10
30
ns
30
0
30
(X)
.9l
is a
is Al _
