GENOMICS

13,344-348

(1992)

Identification and Characterization of a Gene at DIOS94 in the MENZA Region HELEN MCDONALD,* DUANE SMAILUS,* HEATHER JENKINS,* KAREN ADAMS,* NANCY E. SIMPsotu,t AND PAUL J. GOODFELLOW* *Department of Medical Genetics, University of British Columbia, Vancouver, British Columbia, Canada V6T 123, and tDepartments of Biology and Paediatrics, Queen’s University, Kingston, Ontario K7L 3N6, Canada Received

November

6, 1991;

January

31, 1992

We have focused our search on the interval between and RBP3 in proximal lOq11.2. We have previously reported the identification of a DNA marker, pCll/AlS-6-c23 (DlOS94), from proximal lOq11.2 that does not recombine with MEN2A (Goodfellow et al., 1990). A cosmid expansion of DlOS94 was undertaken and physical mapping of the region revealed the presence of a dense cluster of CpG islands (BrooksWilson et al., 1992). DlOS94 appears to be a gene-rich region on the basis of these results. We have begun a search for MEN2A at DlOS94. We report here the characterization of a new gene, mcs94-1, referring to MEN candidate at DlOS94, that is closely associated with one of the CpG islands at DlOS94. Mcs94-1 alleles from the wildtype and mutation-bearing chromosomes from an MEN 2A patient were characterized by sequence analysis. No differences in mcs94-1 exon sequences were observed between the MEN 2A and the wildtype homologues.

DlOZl

We have identified a candidate for the gene responsible for multiple endocrine neoplasia type 2A (MEN 2A) at Dl OS94in proximal lOq11.2. An evolutionarily conserved sequence from D10S94 was used as a probe to isolate cDNAs corresponding to a gene that we have termed mcs94-1. The gene spans 11 kb and has an unmethylated CpG island at its 5’ end. The mcs94-1 transcript is approximately 2.4 kb in length and is widely expressed. It encodes a putative 415-amino-acid polypeptide that is similar in sequence to nucleolin, an abundant nucleolar protein. Mcs94- 1 was examined as a candidate for MEN2A through nucleotide sequence analysis of mcs94- 1 exons from an MEN 2A chromosome and its wildtype homologue from an MEN 2A patient. The major portion of the expressed mcs94-1 sequence was examined. No differences in sequence were found between the two alleles. 8 1992 Academic Press, Inc.

INTRODUCTION

MEN2A

has been assigned to the pericentromeric region of chromosome 10 by DNA marker linkage studies (Mathew et al., 1991; Lichter et al., 1992). Several markers that do not recombine with the disease locus have been identified (Goodfellow et al., 1990; Wu et al., 1990; Mathew et al., 1991; Lichter et al., 1991; Mulligan et al., 1991). Efforts to refine the localization of MEN2A by meiotic mapping have been hampered by a scarcity of recombinants in the critical interval to which the disease gene has been assigned. Unlike the situation in a number of other dominantly inherited cancers, the tumors associated with multiple endocrine neoplasia type 2A (MEN 2A) are not characterized by a loss of heterozygosity for the chromosomal region to which the disease gene has been assigned (Mathew et al., 1987; Nelkin et al., 1989; Landsvater et al., 1989). Consequently, tumor deletion mapping of MEN2A has not been possible. The biochemical and/or developmental defect underlying tumor formation in MEN 2A is entirely unknown. Our approach to cloning MEN2A is therefore based on our knowledge of the chromosomal localization of the defective gene. 0888.7543/92 55.00 Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

revised

344

MATERIALS

AND

METHODS

Isolation of mcs94-1 cDNA clones. A human heart cDNA library in Lambda Zap (Stratagene) was screened with the evolutionarily conserved probe ~600 (Fig. 1). Approximately 7.5 x lo5 phage were transferred to Hybond-N membranes (Amersham). Probe ~600 was radiolabeled with [a-32P]dCTP by the random priming method (Feinberg and Vogelstein, 1984). Prehybridization, hybridization, and washing conditions were as recommended by the manufacturer. Positively hybridizing phage were plaque-purified, and pBluescript plasmids (phagemids) were excised using the protocol provided by the supplier (Stratagene). DNA and protein sequence analyses. DNA sequencing reactions were carried out using either fluorescently labeled universal primers or fluorescently labeled dideoxynucleotides from Applied Biosystems Inc. (ABI), according to the supplier’s protocols. The sequencing reaction products were run on an ABI Model 373A DNA sequencer. Data analysis was carried out using the SeqEd analysis program from ABI and the DNA Strider program (Marck, 1988). Protein sequences used for peptide comparisons were obtained from the EMBL and SWISS Protein databases. Amplification of genomic mcs94-I sequences by PCR. DNA from the human/hamster hybrid cell lines in which the MEN 2A mutationbearing and wildtype chromosome 10 homologues from an MEN 2A patient (AC) were separated (Brooks-Wilson et al., 1992) was used for

A GENE

AT

TABLE Oligonucleotide

Note.

Primers Oligonucleotide

HM7 HM8 HM6 HM5 HM2 HM3 HMl HJ2 HJl HM4

5’.ACCTTGTCTCGGGGCCTC-3’ 5’.ACCAAAGTCCACCCGGCC-3’ 5’-TTCTGATCCCAGAGCCAG-3’ 5’-TTTCCTGCAGCTGAAAAGG-3’ 5’.GTCTTGCTACCTCTCTCGTC-3’ 5’-CCTGCGAGGCAAACTGCAC-3’ 5’.GCCTGTGGACCCCGAAGGC-3’ 5’.ATGGGTCCCCCAGCTTCC-3 5’-ATGGGGCGTATAGCAGCC-3 5’-TGAATTATCTTCAACCACCC-3’

Primer

pairs

used for amplifications:

HM7-HM8,

of mcs94-

HM6-HM5,

RESULTS

of a Gene at DlOS94

A cosmid walk at DlOS94 was initiated in an effort to expand the locus and to identify and isolate candidates for MEN2A. Cosmid l-la was identified through hybridization with probe pCll/AlS-6-c23 (Fig. 1; Brooks-Wilson et al., 1992). It contains a CpG island composed of multiple clustered Sac11 and BssHII sites. A 600-bp EcoRI/HindIII restriction fragment derived from cosmid l-la was found to be evolutionarily conserved by Southern “zoo” blot analysis. The conserved sequence,

1 Exons Location

sequence

the amplification of genomic mcs94-1 sequences. The sequences of the oligonucleotide primers that were designed to amplify mcs94-1 exons are listed in Table 1. The lOO-~1 amplification reactions contained 50-100 ng DNA; 10 mM Tris/Cl, pH 9.0 at 25°C; 50 mM KCI; 1.5 mM MgCI,; 0.01% gelatin, 0.1% Triton X-100; 0.2 mM each dNTP; 0.15 PM each of paired primers; and 2 U Taq DNA polymerase (Promega). Reaction conditions were not optimized for each set of primer pairs. The conditions used for all amplifications were 35 cycles of denaturation at 95°C for 1 min and annealing and extension at 60°C for 1 min. A Perkin-Elmer/Cetus thermal cycler was used. As primer pairs frequently gave rise to hamster-derived synthesis products, it was necessary to gel purify the cognate human products. The DNA fragments either were digested with restriction endonucleases that cut internally or were made blunt-ended with T4 DNA polymerase according to Maniatis et al. (1982) in preparation for cloning into appropriately digested pUC18 plasmid vector.

Identification

1

for Amplification

Primer

345

DIOS94

within

mcs94-1

Intronic, 5’ to exon Intronic, 3’ to exon Intronic, 5’ to exon Intronic, 3’ to exon Intronic, 5’ to exon Exon 4,3’to HMl Exon 4,5’ to HM3 Exon 4,3’to HJl Exon 4,5’ to HJ2 Intronic, 3’ to exon HM2-HM3,

HMl-HJ2,

gene 2 2 3 3 4

4

and HJl-HM4.

~600 (Fig. l), detects a transcript of approximately 2.4 kb in a wide range of rodent tissues and cultured cell lines, including human lymphoblasts derived from an MEN 2A patient (data not shown). It was used to screen a human heart cDNA library in Lambda Zap (Stratagene) to isolate clones corresponding to the 2.4-kb transcript. Five positively hybridizing phage of approximately 7.5 x lo5 phage screened were isolated. The gene detected with probe ~600 was termed mcs94-1. Mcs94-1 cDNA Sequence and Deduced Protein Sequence The isolated cDNAs were initially characterized by restriction mapping and a number of overlaps were identified. The cDNA inserts were excised and cloned into M13mp18 and M13mp19 vectors for the sequencing of both strands. The derived cDNA sequence (Fig. 2) has an ORF that potentially encodes a polypeptide of at least 415 amino acids with a predicted molecular mass of 45.5 kDa. There are two consecutive potential start codons for the putative mcs94-1 peptide, but the second ATG and the sequence surrounding it more closely adhere to the Kozak description of an initiation codon (Kozak, 1984). Sequence analysis of ~600 revealed that it overlaps with the 3’ end of the ORF and contains 3’ untranslated sequence identical to that of cDNA (Fig. 1). None of the cDNAs isolated contained a candidate 3’ end

= 1 Kb

I 1 Kb

CpG

Island

~600

FIG. 1. Map of cosmid l-la and the genomic organization of mcs94-1. The exons indicated (l-4) correspond sequence. (A) EcoRI restriction map of cosmid l-la. (B) Mcs94-1 region enlarged. The positions of DNA probes indicated. IY DNA probes; mcs94-1 exons; R, EcoRI; S, SacII; B, BssHII; *, position not precisely determined.

to the derived pCll/AlS-6-1~23

mcs94-1 cDNA and ~600 are

346

MCDONALD

ET

AL.

CCGCCGCGTCTTCCTCAAGGTTGAGAACAAAAACATGCACCTGGAGTTTCCCCGGAGCCCTCTGCGTGGTTG AGCTTCGGTGGAATTTCGGGGCTCTTGG~TGCCAGCCGCGCTTGCCTGGTAGCAACAGAAACCAGTCCTGCT CGCCTCCGTGGACATTTCATTACCATCCAGAAGTGTCTCCGCCA Met Leu Gly Pro Glu CAAAAAAGCCACACCCAAGATCACCTGACACCCACCCTGACAAGTGTCCATG ATG CTG GGC CCT GAG Gly Gly Glu Gly Phe Val Val Lys Leu Arg Gly Leu Pro Trp Ser Cys Ser Val GGA GGT GAA GGC TTT GTG GTC AAG CTC CGT GGC CTG CCC TGG TCC TGC TCT GTT Glu Asp Val Gin Am Phe Leu Ser Asp Cys Thr Ile His Asp Gly Ala Ala Gly GAG GAC GTG CAG AAC TTC CTC TCT GAC TGC ACG ATT CAT GAT GGG GCC GCA GGT Val His Phe Ile Tyr Thr Arg Glu Gly Arg Gin Ser Gly Glu Ala Phe val Glu GTC CAT TTC ATC TAC ACT AGA GAG GGC AGG CAG AGT GGT GAG GCT TTT GTT GAA Leu Gly Ser Glu Asp Asp Val Lys Met Ala Leu Lys Lys Asp Arg Glu Ser Met CTT GGA TCA GAA GAT GAT GTA AAA ATG GCC CTG AAA AAA GAC AGG GAA AGC ATG Gly His Arg Tyr Ile Glu Val Phe Lys Ser His Arg Thr Glu Met Asp Trp Val GGA CAC CGG TAC ATT GAG GTG TTC AAG TCC CAC AGA ACC GAG ATG GAT TGG GTG Leu Lys His Ser Gly Pro Asn Ser Ala Asp Set Ala Asn Asp Gly Phe Val Arg TTG AAG CAC AGT GGT CCC ARC AGT GCC GAC AGC GCC AAC GAT GGC TTC GTG CGG Leu Arg Gly Leu Pro Phe Gly Cys Thr Lys Glu Glu Ile Val Gin Phe Phe Ser CTT CGA GGA CTC CCA TTT GGA TGC ACA AAG GAA GAA ATT GTT CAG TTC TTC TCA Gly Leu Glu Ile Val Pro Asn Gly Ile Thr Leu Pro Val Asp Pro Glu Gly Lys GGG TTG GAA ATT GTG CCA AAC GGG ATC ACA TTG CCT GTG GAC CCC GAA GGC AAG Ile Thr Gly Glu Ala Phe Val Gln Phe Ala Ser Gln Glu Leu Ala Glu Lys Ala ATT ACA GGG GAA GCG TTC GTG CAG TTT GCC TCG CAG GAG TTA GCT GAG AAG GCT Leu Gly Lys His Lys Glu Arg Ile Gly His Arg Tyr Ile Glu Val Phe Lys Ser CTA GGG AAA CAC AAG GAG AGG ATA GGG CAC AGG TAC ATT GAG GTG TTT AAG AGC Ser Gln Glu Glu Val Arg Ser Tyr Ser Asp Pro Pro Leu Lys Phe Met Ser Val AGC CAG GAG GAA GTT AGG TCA TAC TCA GAT CCC CCT CTG AAG TTC ATG TCC GTG Gin Arg Pro Gly Pro Tyr Asp Arg Pro Gly Thr Ala Arg Arg Tyr Ile Gly Ile CAG CGG CCA GGG CCC TAT GAC CGG CCC GGG ACT GCC AGG AGG TAC ATT GGC ATC Val Lys Gin Ala Gly Leu Glu Arg Met Arg Pro Gly Ala Tyr Ser Thr Gly Tyr GTG AAG CAG GCA GGC CTG GAA AGG ATG AGG CCT GGT GCC TAC AGC RCA GGC TAC Gly Gly Tyr Glu Glu Tyr Ser Gly Leu Ser Asp Gly Tyr Gly Phe Thr Thr Asp GGG GGC TAC GAG GAG TAC AGT GGC CTC AGT GAT GGC TAC GGC TTC ACC ACC GAC Leu Phe Gly Arg Asp Leu Ser Tyr Cys Leu Ser Gly Met Tyr Asp His Arg Tyr CTG TTC GGG AGA GAC CTC AGC TAC TGT CTC TCC GGA ATG TAT GAC CAC AGA TAC Gly Asp Ser Glu Phe Thr Val Gln Ser Thr Thr Gly His Cys Val His Met Arg GGC GAC AGT GAG TTC ACA GTG CAG AGC ACC ACA GGC CAC TGT GTC CAC ATG AGG Gly Leu Pro Tyr Lys Ala Thr Glu Asn Asp Ile Tyr Am Phe Phe Ser Pro Leu GGC CTG CCG TAC AAA GCG ACC GAG AAC GAC ATT TAC AAC TTC TTC TCT CCT CTC Am Pro Val Arg Val His Ile Glu Ile Gly Pro Asp Gly Arg Val Thr Gly Glu AAC CCT GTG AGA GTC CAT ATT GAG ATT GGC CCA GAT GGA AGA GTG ACG GGT GAA Ala Asp Val Glu Phe Ala Thr His Glu Glu Ala Val Ala Ala Met Ser Lys Asp GCA GAT GTT GAG TTT GCT ACT CAT GAA GAA GCT GTG GCA GCT ATG TCC AAA GAC Arg Ala Am Met Gln His Arg Tyr Ile Glu Leu Phe Leu Am Ser Thr Thr Gly AGG GCC AAT ATG CAG CAC AGA TAT ATA GAA CTC TTC TTG AAT TCA ACA ACA GGG Ala Ser Asn Gly Ala Tyr Ser Ser Gln Val Met Gln Gly Met Gly Val Ser Ala GCC AGC AAT GGG GCG TAT AGC AGC CAG GTG ATG CAA GGC ATG GGG GTG TCT GCT Ala Gln Ala Thr Tyr Ser Gly Leu Glu Ser Gln Ser Val Ser Gly Cys Tyr Gly GCC CAG GCC ACT TAC AGT GGC CTG GAG AGC CAG TCA GTG AGT GGC TGT TAC GGG Ala Gly Tyr Ser Gly Gln Asn Ser Met Gly Gly Tyr Asp GCC GGC TAC AGT GGG CAG AAC AGC ATG GGT GGC TAT GAC TAGTTTTGTTAGGAACATTT GAGTTACTTCAATCATTTTCACAGGCAGCCAACAAGCAATGCTGGGGGA CCCATTTTGCACCATGAGTTTGTGAAAAAtctggattaaaaaaattdCCtCttCagtgttttCtCdtgC~~~d ttttcttctagcatgtgataatgagtaaactaaaactattttcagcttttctcaattaacattttggtagta tacttcagagtgatgttatctaagtttaagtagtttaagtatgttaaatgtggatcttttacaccacatcac agtgaacacdctggggagatgtgcttttttggaaaactcaaaggtgctagctccctgattcaaagaaatatt tctcatgtttgttcattctagtttatattttcatttaaaatcctttaggttaagtttaagcttttta~aagt tagttttgagaattgagacacaatactaatactgtaggaattggtgaggccttgacttaaaactttctttgt actgtgatttccttttgggtgtattttgctaagtgaaacttgttaaattttttgttaactaaatttttttct taaaataaa

72 144 216 283 337 391 445 499 553 607 661 715 769 823 877 931 985 1039 1093 1147 1201 1255 1309 1363 1417 1471 1530 1602 1674 1746 1818 1890 1962 2034 2106 2115

FIG. 2. Nucleotide sequence of mcs94-1 cDNA and the deduced protein sequence. The cDNA sequence derived from clones (uppercase) and the 3’ sequence adjacent to it in the genomic DNA (lowercase) are shown. A putative polyadenylation is indicated by a double underline.

(poly(A) tract). A potential polyadenylation signal (AATAAA; Fig. 2) was identified in cosmid l-la genomic sequence immediately 3’ to the ~600 probe. The total length of sequence determined for the mcs94-1 cDNA, along with the potential 3’ end sequence derived from the genomic DNA sequence, is 2115 nucleotides. Rescreening of the cDNA library with a probe derived from the 5 end of the cDNA did not yield any recombinants containing more 5’ mcs94-1 sequences. A “DAP” protein database search for peptide sequences with similarities to the putative mcs94-1 peptide identified several of the sequences reported for nu-

overlapping cDNA signal (AATAAA)

cleolin, a conserved nucleolar protein (Lapeyre et al., 1987). A protein matrix comparison between mouse nucleolin and the mcs94-1 protein revealed that the highest degree of similarity occurs in a 219-amino-acid overlap in which there is 23% identity (Fig. 3). There is an additional similarity of 42% conservative changes between the amino acids. Two potential RNA-binding domains are present in the nucleolin sequence within the region of the 219-amino-acid overlap. Inspection of the mcs941 amino acid sequences corresponding to the RNA-binding motifs reveals the presence of identical pentapeptide sequences (GEAFV; Fig. 3). No other motifs that may be

A GENE 420 430 vFzzmmmv-smLY--YT . ..: . . . . . . . . . . .:

440 :..:.

::

450 :

I-

40

50

60

470 480 ~STwSGEsxTLvLsNLsYsATxE .:.. . . . . .:. :... m-SAD-100 110 520

530

PEGB?KGYAFIESASF

: .x: .: :: pEGwmx!m150

::: 160

AT

460

: .:. . . . . : . . . . -mDREsMaxY-HR 70 SO

. 90

490

500 510 -TF----I . :..:... :::.. . :. .. :..: lVQFFSGLFJVPNGITLPVD 140 120 130

.

550 560 570 SCNKHEIEC;RrIR-LEI&GSNSRSQPSKTL-F .: :.:: .. . . :: . . .: : : :... 'X.. -SKERIGERYIEVFKSSQEEiVFCiYSDPPLKF 170 180 190 200

FIG. 3. A protein matrix comparison of the putative mcs94-1 peptide and mouse nucleolin. Mouse nucleolin (A) is 706 amino acids and mcs94-1 (B) is predicted to be 415 amino acids. The amino acid positions are indicated. There is 23% identity in a 219-amino-acid overlap. The mcs94-1 peptide sequences corresponding to potential RNAbinding domains of nucleolin are underlined. A : indicates amino acid identity and a . indicates conservative changes between amino acids.

were identified

Genomic Organization

of the mcs94-1

in the mcs94-1

pro-

Gene

The genomic organization of the mcs94-1 gene was determined by detailed restriction mapping and sequence analysis of cosmid l-la, which appears to contain the entire mcs94-1 gene (Fig. 1). The mcs94-1 gene spans 11 kb of genomic DNA and has a minimum of four exons, three of which were mapped and sequenced. The precise location of the most 5’ exon has not been determined. It is believed to be in the proximity of the CpG island on the basis of the observation that an oligonucleotide corresponding to cDNA nucleotides 1-17 (putative exon 1) hybridizes to a restriction fragment that contains the multiple Sac11 and BssHII sites of the CpG island. Intronic sequences 5’ to the second exon are G+C-rich and include three sequences corresponding to the core binding sites for Spl transcription factor. The ORF of the mcs94-1 cDNA is present as a continuous sequence within the fourth and largest exon of the genomic DNA (Fig. 1). Mcs94-1

A number of sequence differences that we interpret as representing misincorporation of nucleotides by Tag DNA polymerase were identified in the cloned material. The consensus sequence for each of the PCR products, however, was readily obtained through the analysis of several independent clones. The sequences of three of the four exons (2,3, and 4) and their flanking DNA were determined for each of the two mcs94-1 alleles. No differences in mcs94-1 sequence were found between the MEN 2A and the wildtype chromosome 10 homologues.

540

590 600 610 580 VIUZSEDTTEi-ETLKESFEG SVRARIVTDRETGS-SKGF-C;FMFNSEEDA . . . . . . . . . . . . . . . . .:. .. . . . . . ..::.. Msvl;lRPC;DY!X@GTARRYIG~GAYSTGYGGYEEYSGLSDG 220 230 240 250 210

related to function tein sequence.

347

DlOS9~

as a Candidate

for MEN2A

Primer sequences for the amplification of mcs94-1 exons and flanking DNA were designed from genomic and cDNA sequences (Table 1). Mcs94-1 alleles derived from the wildtype and MEN 2A chromosomes of a patient, AC, which have been segregated in somatic cell hybrids (Brooks-Wilson et al., 1992), were amplified using PCR and appropriate primer pairs. The PCR products were cloned into the vector pUC18 and sequenced.

DISCUSSION Although several anonymous DNA probes and genes have been assigned to the MEN2A region of chromosome 10 (Simpson and Cann, 1991), little is known about the organization or actual number of genes within this region. The RET proto-oncogene has been mapped to lOq11.2 and is a candidate for MEN2A (Mulligan et al., 1991). We report here the characterization of a new gene, called mcs94-1, from lOq11.2 in the MEN2A region. Mcs94-1 was identified during a genomic cosmid walk initiated from D10S94, a locus for which no recombinants with MEN2A, or MEN2B, (a gene responsible for a related dominantly inherited cancer syndrome) have been observed (Goodfellow et al., 1990; our unpublished results). It has been suggested that three genetically distinct diseases with clinical similarities involving medullary carcinoma of the thyroid (MEN 2A, MEN 2B, and MTCl) may be the result of mutations within genes that are closely linked (Jackson et al., 1989). The potential gene cluster identified at DlOS94 (Brooks-Wilson et al., 1992) could be considered a candidate region for a contiguous series of genes. A partial cDNA sequence for mcs94-1 has been constructed and the genomic organization of the mcs94-1 gene determined. The most 5’ portion of the mcs94-1 gene has not yet been characterized. We are currently examining genomic DNA sequences 5’ to mcs94-1 for the presence of promoter sequences. A search of protein databases revealed that the putative mcs94-1 peptide is similar to nucleolin, a conserved nucleolar protein implicated in rDNA transcription and ribosome assembly in actively growing cells (reviewed by Lapeyre et al., 1987). Two potential RNA-binding domains of nucleolin were identified in a region of the protein having the greatest degree of similarity to the mcs94-1 peptide. The two sequences of the mcs94-1 peptide that are similar to the potential RNA-binding domains of nucleolin are highly similar. The role of the mcs94-1 peptide and its functional similarity to nucleolin, if any, remain to be determined. The nucleotide sequence analysis of the mcs94-1 alleles from an MEN 2A patient revealed that for most of the mcs94-1 coding region there were no sequence differences. Since the entire ORF was included in the analysis, the protein products that may be derived from the two alleles are presumed to be identical. Northern blot

348

MCDONALD

analysis of MEN 2A patient lymphoblast RNA did not suggest any alteration in the size of mcs94-1 transcripts, as a single transcript was detected (not shown). It is possible that a point mutation or very small deletion exists in the regulatory region of the mcs94-1 gene and this is currently under investigation. Two additional dominantly inherited disorders involving medullary carcinoma of the thyroid, MEN 2B and MTCl, map to the same region of chromosome 10 as does MEN2A. At present we are examining DNA from MEN 2B and MTCl patients for sequence variants within mcs94-1 that might be causally associated with these diseases. ACKNOWLEDGMENTS This work was primarily supported by Medical Research Council of Canada Grant 10563 and the Genetic Diseases Centres of Excellence Program. Support to N.E.S. was provided by Medical Research Council of Canada Grant MT5783. P.J.G. is an MRC Scholar. DNA sequence analysis on the ABI 373A apparatus was made possible through the assistance of a British Columbia Health Care Foundation Equipment grant. REFERENCES Brooks-Wilson, A. R., Smailus, D. E., and Goodfellow, P. J. (1992). A cluster of CpG islands at DlOS94, near the locus responsible for multiple endocrine neoplasia type 2A (MEN2A). Genomics 13: 339343. Feinberg, A. P., and Vogelstein, B. (1984). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity: Addendum. Anal. Biochem. 137: 266-267. Goodfellow, P. J., Myers, S., Anderson, L. L., Brooks-Wilson, A. R., and Simpson, N. E. (1990). A new DNA marker (DlOS94) very tightly linked to the multiple endocrine neoplasia type 2A (MEN2A) locus. Am. J. Hum. Genet. 47: 952-956. Jackson, C. E., Van Dyke, D. L., Talpos, G. B., Norum, R. A., and Tashjian, A. H., Jr. (1989). MEN-2 tumor associations suggest a linear order of specific endocrine tumor genes. Horm. Metab. Res. Suppl. 21: 9-12. Kozak, M. (1984). Compilation from the translational start Acids Res. 12: 857-812.

and analysis of sequences site in eukaryotic mRNAs.

upstream Nucleic

ET

AL.

Landsvater, Meerman, Ponder, multiple deletions

R. M., Mathew, C. G. J., Lips, C. J. B. A. J., and Buys, endocrine neoplasia of chromosome 10.

G. P., Smith, B. A., Marcus, E. M., Te M., Geerdink, R. A., Nakamura, Y., C. H. C. M. (1989). Development of type 2A does not involve substantial Genomics 4: 246-250.

Lapeyre, B., Bourbon, H., and Amalric, F. (1987). Nucleolin, the major nucleolar protein of growing eukaryotic cells: An unusual protein structure revealed by the nucleotide sequence. Proc. Natl. Acad. Sci. USA 84: 147221476. Lichter, J. B., Wu, J.. Brewster, S., Brooks-Wilson, P. J., and Kidd, K. K. (1991). A new polymorphic tightly linked to MENPA. Am. J. Hum. Genet. Lichter, J. B., Wu, J., Difilipantonio, M., P. J., and Kidd, K. K. (1992). Localization Henry Ford Hosp. Med. J.. in press. Maniatis, T., Fritsch, Cloning: A Laboratory Cold Spring Harbor,

E. F., and Manual,” NY.

A. R., Goodfellow, marker (DlOS97) 49: 349.

Miller, D. L., Goodfellow, of the gene for MEN 2A.

Sambrook, J. (1982). Cold Spring Harbor

“Molecular Laboratory,

Marck, C. (1988). “DNA Strider”: a “C” program for the fast analysis of DNA and protein sequences on the Apple Macintosh family computers. Nucleic Acids Res. 16: 1829-1836. Mathew, C. G. P., Smith, B. A., Thorpe, K., Wong, Z., Royle, N. J., Jeffreys, A. J., and Ponder, B. A. J. (1987). Deletion of genes on chromosome 1 in endocrine neoplasia. Nature (London) 328: 524526 Mathew, C. G. P., Easton, D. F., Nakamura, the MEN 2A International Collaborative matic screening for multiple endocrine linked DNA markers. Lancet 337: 7-11. Mulligan, L. M., Gardner, Telenius, H., and Ponder, candidate for the MEN2

Y., Ponder, B. A. J., and Group (1991). Presymptoneoplasia type 2A with

E., Mole, S. E., Nakamura, Y., Papi, B. A. J. (1991). Is the ret protooncogene gene? Am. J. Hum. Genet. 49: 414.

L., a

Nelkin, B. D., Nakamura, Y., White, R. W., de Bustros, A. C.. Herman, J., Wells, S. A., Jr., and Baylin, S. B. (1989). Low incidence of loss of chromosome 10 in sporadic and hereditary human medullary thyroid carcinoma. Cancer Res. 49: 4114-4119. Simpson, N. E., and Cann, H. (1991). genetic constitution of chromosome Genet. 58: 428-458.

Report of the committee on the 10: HGMll. Cytogenet. Cell

Wu, J., Carson, N. L., Myers, S., Pakstis, A. J., Kidd, J. R., Castiglione, C. M., Anderson, L., Hoyle, L. S., Genel, M., Verdy, M., Jackson, C. E., Simpson, N. E., and Kidd, K. K. (1990). The genetic defect in multiple endocrine neoplasia type 2A maps next to the centromere of chromosome 10. Am. J. Hum. Genet. 46: 624-630.