Microbiological Research 170 (2015) 168–176

Contents lists available at ScienceDirect

Microbiological Research journal homepage: www.elsevier.com/locate/micres

Identification and characterisation a surface-associated arginine peptidase in Streptococcus suis serotype 2 Kaisong Huang a,b , Zengzhi Yuan a,b , Jingtao Li a,b , Qiang Zhang a,b , Zhongmin Xu a,b , Shuxian Yan a,b , Anding Zhang a,b , Meilin Jin a,b,∗ a b

Unit of Animal Infectious Disease, National State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China College of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China

a r t i c l e

i n f o

Article history: Received 17 May 2014 Received in revised form 27 July 2014 Accepted 9 August 2014 Available online 18 August 2014 Keywords: Streptococcus suis Streptococcus suis serotype 2 Arginine peptidase Pathogenicity Antigen

a b s t r a c t Streptococcus suis is an important zoonotic pathogen worldwide and is responsible for disease in swine and humans. In the present study, we identified and characterised a surface-associated peptidase (abpb, amylase-binding protein B) in Streptococcus suis serotype 2 (S. suis 2) that has high hydrolytic activity towards H-Arg-pNa, with maximum activity at pH 7.0. Stimulation of RAW 264.7 macrophages with purified recombinant abpb protein triggered the release of pro-inflammatory cytokines. An abpb-deficient mutant Abpb was constructed by homologous recombination to determine the role of abpb in S. suis 2. The mutant Abpb showed decreased adherence to Hep-2 cells and attenuated virulence in a mouse model compared to the wild type strains. The results of the infection showed impaired bacterial growth in vivo and poor colonisation of the organs. In a protection assay, the recombinant abpb provided excellent protection against a lethal challenge of S. suis 2. Together, these findings suggest that abpb contributes to the pathogenicity of S. suis 2 and may be another target for S. suis prevention and control. © 2014 Elsevier GmbH. All rights reserved.

1. Introduction Streptococcus suis is frequently found in the tonsils, nasal cavity and genital tract of healthy pigs and is the major swine pathogen worldwide. This pathogen can cause meningitis, septicaemia, arthritis and other diseases in both swine and humans (Staats et al., 1997; Baele et al., 2001; Su et al., 2008). Thus far, 33 serotypes have been identified, and serotype 2 is considered the most prevalent and virulent in diseased pigs and humans, although other serotypes can also cause infections. In recent years, two largescale outbreaks in China caused 38 human deaths, primarily from meningitis or streptococcal toxic shock syndrome (STSS). STSS was originally characterised as Streptococcus pyogenes infection that manifested as high fever, vascular collapse, hypotension, shock and multiple organ failure (Cone et al., 1987; Kohler, 1990; Lersch et al., 1990). Furthermore, the epidemic ST7 strains were considered the causative agents of STSS in Chinese outbreaks (Ye et al., 2006, 2009). Several studies indicate that the excessive inflammatory responses triggered by S. suis are responsible for the high mortality of STSS

∗ Corresponding author at: Unit of Animal Infectious Diseases, National Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, 1 Shizishan Street, Wuhan, Hubei 430070, PR China. Tel.: +86 027 87282608; fax: +86 027 87281795. E-mail address: [email protected] (M. Jin). http://dx.doi.org/10.1016/j.micres.2014.08.001 0944-5013/© 2014 Elsevier GmbH. All rights reserved.

in humans, and the cell wall components of S. suis are the main stimuli that contribute to the release of large amounts of proinflammatory cytokines by the host cells (Vadeboncoeur et al., 2003; Graveline et al., 2007; Ye et al., 2009). A pathogenic island named 89K contributes to the high virulence and STSS in the epidemic ST7 strains and was recently identified by comparative genomics. This island can be horizontally transferred to non-89K strains through a mechanism that is mediated by its inner GI type IV secretion system (Chen et al., 2007; Li et al., 2011; Zhao et al., 2011). Thus far, many virulence and immunogenicity related genes have been identified by various methods, such as in vivo-induced antigen technology (IVIAT), signature-tagged mutagenesis system (STM), selective capture of transcribed sequences (SCOTS), suppression subtractive hybridisation and comparative proteomics, and S. suis contains nearly 70 confirmed or putative virulence factors (Fittipaldi et al., 2007; Wilson et al., 2007; Zhang and Lu, 2007; Zhang et al., 2008, 2009; Gu et al., 2009; Jiang et al., 2009; Fittipaldi et al., 2012). However, S. suis infection is a complex and multi-step process, and we have not identified the mechanism by which S. suis breaches surface barriers and disseminates in the body to cause meningitis and STSS. Therefore, additional studies are necessary to detect new virulence related factors and identify the mechanism by which S. suis infection occurs. It is known that several cell surface components contribute to the virulence of pathogenic bacteria and the interaction with host

K. Huang et al. / Microbiological Research 170 (2015) 168–176 Table 1 Summary of strains and plasmids. Strains, plasmid Bacteria strains S. suis SC19 Abpb E. coli DH5a E. coli BL21(DE3) Plasmid pSET4s pSET4sAbpb

pET.M.3C-abpb

Description

Source

Serotype 2, clinically isolated virulent strain The abpb-deficient mutant with a background of SC19 Cloning host for recombinant plasmids Host for over-expressed recombinant abpb protein

Collected in our laboratory This study

E. coli–S. suis shuttle vector, thermosensitive suicide A recombinant vector with a background of pSET4s, designed for the construction of the abpb mutant Vector for over-expressing the recombinant abpb protein

This study

169

genome using the SSU05ZY 1387 sequence. The operon information was predicted by online MicrobesOnline Operon Predictions program. The potential transcription factors having a possible regulation to Abpb were searched from the published regulators with the available DNA microarray data in S. suis. 2.3. Cloning, expression and purification of recombinant abpb protein

Promega Invitrogen

The CDS sequence was amplified from the SC19 genome DNA using primers abpb-F-m3c and abpb-R-m3c. The corresponding PCR product was then restriction digested, purified and inserted into the pET.M.3c expression vector with an N-terminal His tag. Subsequently, sequencing confirmed that the vector was transformed into the E. coli BL21 (DE3) strain, and the abpb was expressed at 28 ◦ C for 8 h with 0.2 mM isopropyl-beta-dthiogalactopyranoside. The over-expressed protein was purified using fast protein liquid chromatography (AKTA) with a Ni-NTA column. The protein was concentrated by ultrafiltration (Millipore). 2.4. Enzymatic assays

cells, and some cell wall proteins display high immunogenicity. By contrast, several pathogen proteases have significant roles in pathogen nutrition acquisition, host tissue degradation and neutralisation of the immune defence system (Maeda, 1996). In S. suis, four families of proteases have been identified (Jobin and Grenier, 2003). The inactivation of dipeptidyl peptidase IV attenuates the virulence of S. suis serotype 2 (Jobin et al., 2005; Ge et al., 2009). In this study, we have identified a surface-associated peptidase in S. suis 2 that was once hypothesised to be a candidate virulence factor based on the comparative proteomics between highly virulent and avirulent strains (Zhang and Lu, 2007; Wu et al., 2008). The robust hydrolytic activity of recombinant abpb against H-Arg-pNa was demonstrated. Subsequently, we constructed an abpb-deficient mutant by homologous recombination. The pathogenic difference between the wild type strain and the Abpb mutant was compared by adherence to epithelial cells, virulence evaluation and competition infection in mice. The results demonstrated that Abpb significantly affects S. suis 2 pathogenicity. 2. Materials and methods 2.1. Bacterial strains, plasmids, culture conditions and primers The bacterial strains, plasmids and primers used in this study are listed in Tables 1 and 2. S. suis was grown in tryptic soy broth (TSB) medium or tryptic soy agar plates, both with 5% foetal bovine serum at 37 ◦ C. The Escherichia coli strains were cultured using Luria Broth (LB) medium or plated on LB agar at 37 ◦ C. When necessary, antibiotics were used as follows to screen transformants: spectinomycin, 100 ␮g/ml for S. suis, 50 ␮g/ml for E. coli; erythromycin, 5 ␮g/ml for S. suis, 150 ␮g/ml for E. coli; and ampicillin, 50 ␮g for E. coli. 2.2. Sequence analysis and distribution of abpb in S. suis Based on the sequence of abpb (SSU05ZY 1387) deposited in The National Center for Biotechnology Information, protein functional analysis was performed with the online InterProScan program (http://www.ebi.ac.uk/Tools/pfa/iprscan/). The antibody epitope prediction was performed using Bepipred Linear Epitope prediction on the Immune Epitope Database (http://www.iedb.org/). The peptidase information was searched in the MEROPS database (http://merops.sanger.ac.uk/). The distribution of abpb in S. suis was obtained using the blastp program against the online S. suis

The purified recombinant abpb was tested for activity against H-Gly-Pro-p-nitro-aniline and H-Arg-p-nitro-aniline (Enzo life Science) according to a previously described method (Goldstein et al., 2002). Briefly, the recombinant abpb was incubated with the synthetic chromogenic peptide at a final concentration of 1 mM in 100 ␮l buffer containing 50 mM Tris, pH 7.0, and 1 mM CaCl2 for 1 h at 37 ◦ C. The release of p-nitro-aniline was measured at 405 nm. The kinetic values were measured using different concentrations of H-Arg-p-nitro-aniline (0.25 mM to 8 mM) combined with three abpb enzyme concentrations under the above conditions. The Vmax and Km values were determined and calculated using hyperbolic regression analysis. 2.5. Construction of the Abpb-deficient mutant Abpb by homologous recombination To construct the abpb mutant (Abpb) from the wild type SC19 strain, the complete abpb sequence was amplified by the primer pair abpb4s-F/abpb4s-R. The purified PCR product was digested with EcoRI and HindIII and then cloned into pSET4s. An erm resistance gene cassette was introduced into the abpb coding region of the enzymatic domain using its inner ClaI restriction site. The resultant plasmid pSET4sAbpb, confirmed by DNA sequence, was electro-transformed into strain SC19. The transformant was then used to screen the double cross-over recombination mutant according to a previously described procedure (Takamatsu et al., 2001). The inactive mutant was verified by PCR, DNA sequencing and Western blot. 2.6. Cytokine secretion triggered by abpb in macrophages The purified recombinant abpb was obtained as described above. Triton X-114 was used to remove the endotoxin, which was subsequently quantified with the Chromogenic End-point Tachypleus Amebocyte Lysate kit, and the endotoxin in the resultant abpb was less than 5 ng/ml. Raw 264.7 cells were cultivated overnight in 12-well tissue culture plates in 1640 medium with 10% foetal bovine serum (Gibco). After adding the recombinant abpb to the cells for 6 h, the cells were lysed in TRIzol and the extracted total RNA after treatment with DNaseI was then used to synthesise the cDNA. The transcripts were assessed using RT-PCR with SYBR Green detection in the ABI ViiA7 system. The GAPDH (glyceraldehyde3-phosphate dehydrogenase) housekeeping gene was used as the

170

K. Huang et al. / Microbiological Research 170 (2015) 168–176

Table 2 Primers used in this study. Primers

Sequence (5 to 3 )

Description

abpb-F-m3c abpb-R-m3c IFN␤-F IFN␤-R TNF␣-F TNF␣-R IL1␤-F IL1␤-R KC-F KC-R MCP-1-F MCP-1-R GAPDH-F GAPDH-R abpb4s-F abpb4s-R Erm-F Erm-R

CCGGAATTCATGTGTTCAGGCTTTATTATTGGGA CGCGTCGACTTATTCTTTACTGGATTTTTTTCGA CTGCGTTCCTGCTGTGCTT CGCCCTGTAGGTGAGGTTGA CGATGAGGTCAATCTGCCCA CCAGGTCACTGTCCCAGCATC CACCTGGTACATCAGCACCTCAC CATCAGAAACAGTCCAGCCCATAC GCCTATCGCCAATGAGC TTCTGAACCAAGGGAGC GCATCCACGTGTTGGCTCA CTCCAGCCTACTCATTGGGATC CGTCGGTGCTGAGTATGTCGT CAGTCTTCTGGGTGGCAGTGAT CCGGAATTCATGTGTTCAGGCTTTATTATTGG CCCAAGCTTTTATTCTTTACTGGATTTTTTTC CCCATCGATGAGTGTGTTGATAGTGCAGT CCCATCGATCTTGGAAGCTGTCAGTAGTA

For over-expressing abpb

internal control, and the transcripts of the cytokines IL1-␤, TNF-a, MCP-1, IFN␤ and KC were analysed using the 2−Ct method. 2.7. Adherence to epithelial cells The adhesion assay was performed as previously described (Vanier et al., 2008) with some modifications. The human laryngeal HEp-2 cell line was grown as a monolayer in 24-well tissue culture plates. The SC19 wild type strain and Abpb strain were grown to logarithmic phase in TSB with 5% foetal bovine serum. The strains were pelleted, washed three times with PBS, and resuspended at 106 ml−1 in RPMI 1640 medium. The monolayer cells were infected with 1-ml aliquots of bacterial suspension and incubated for 2 h at 37 ◦ C with 5% CO2 after concentration at 800 g for 3 min. Two hours later, the cells were washed five times with PBS, and then 1 ml PBS containing 1% Triton X-100 was added to the detached and lysed cells with vigorous pipetting. The mixtures were serially diluted and plated on TSA to enumerate the viable bacteria. All experiments were repeated at least three times. 2.8. Mouse immunisation, antibody determination and challenge studies Four-week-old female BALB/c mice were randomly assigned to two groups of 10 each and immunised intraperitoneally with 100 ␮g purified abpb protein or PBS emulsified with Freund’s complete adjuvant. A booster injection was administered two weeks later using the same amount of antigen emulsified with Freund’s incomplete adjuvant. Pre-immune mouse serum was collected prior to the first injection. The antibody titre was determined by indirect enzyme-linked immunosorbent assay. Ten days after the booster immunisation, the mice were inoculated intraperitoneally with 8 × 108 CFU of the SC19 strains. The survival rates were observed for one week. 2.9. Flow cytometry analysis The flow cytometry assay was performed as previously described (Feng et al., 2009). Briefly, an overnight culture of the SC19 strain was pelleted, washed with PBS and adjusted to 108 CFU/ml. The bacteria were then incubated with anti-abpb serum or pre-immune serum for 1 h. Following three washes, the cells were incubated with FITC-conjugated goat anti-mouse antibody for 1 h and then fixed with 4% paraformaldehyde for 30 min. After washing with PBS, the cells were analysed by flow cytometry.

For transcription analysis For transcription analysis For transcription analysis For transcription analysis For transcription analysis For transcription analysis For abpb-defective mutant Ermr gene cassette

2.10. Experimental infection of mice Twenty female four-week-old BALB/c mice were randomly assigned to two groups. The wild type SC19 and Abpb strains cultivated to the log phase were pelleted and plated on TSA to precisely determine the CFU per millilitre after two washes with sterile PBS. All mice were then injected intraperitoneally with 3 × 108 CFU wild type SC19 or Abpb in 1 ml PBS. The mortality and clinical signs of the infected mice were continuously recorded for seven days. 2.11. Comparison of viable wild type SC19 and Abpb in organs by mixed infection Briefly, 15 female four-week-old BALB/c mice were each infected intraperitoneally with a mixture of 1.4 × 108 CFU wild type SC19 and 1.4 × 108 CFU Abpb in 1 ml PBS. At each designated post-infection time, three random mice were sacrificed by cervical dislocation, and the viable wild type SC19 and Abpb in the blood and homogenised organs (adjusted to 0.05 g each) were determined by plating on TSB agar plates, of which half contained erythromycin. 2.12. Statistical analysis Unless otherwise stated, all data are presented as the mean square deviation and were analysed with Student’s t-test. A difference was considered statistically significant when the P-value