Analytical Biochemistry 464 (2014) 12–16
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Tag/hybridization-based sensitive detection of polymerase chain reaction products Kousuke Niwa a,⇑, Akinobu Oribe a, Hidemasa Okumura a, Masahiro Shimono a, Kenkichi Nagai a, Toshikazu Hirota a, Hiroshi Yasue b, Mitsuo Kawase a,c a b c
Future Technology Management Center, Corporate R&D, NGK Insulators, Mizuho, Nagoya 467-8530, Japan Tsukuba Gene Technology Laboratories, Tsuchiura, Ibaraki 300-0873, Japan Graduate School of Biomedical Engineering, Tohoku University, Aoba, Sendai 980-8579, Japan
a r t i c l e
i n f o
Article history: Received 29 April 2014 Received in revised form 10 July 2014 Accepted 11 July 2014 Available online 19 July 2014 Keywords: Single-stranded DNA tag Non-nucleic acid spacer DNA microarray Hybridization Fluorescence label
a b s t r a c t The polymerase chain reaction (PCR) is an important technology to amplify a single copy or a few copies of DNA segment in genomic DNAs, visualizing the segment as DNA fragment. Thus, PCR is frequently used in various examinations such as detection of bacteria and fungi in the food industry. Here, we report a simple and sensitive method for detection of PCR products using single-strand tag sequence and hybridization of the tag sequence to the complementary tag sequence immobilized on solid material (STH). The detection sensitivity was found to be at least 50 times higher than electrophoresis/ethidium bromide (EtBr) visualization for approximately a 500-bp fragment and higher than the ordinary hybridization, that is, hybridization of denatured PCR product to probe sequence immobilized on solid material. Ó 2014 Elsevier Inc. All rights reserved.
The polymerase chain reaction (PCR)1 was developed by Mullis and Falloona in 1985 to detect a single copy or a few copies of DNA segment in DNA sequences [1–4]. Since then, PCR has been increasingly used in various fields, for example, the detection of pathogenic agents in medicine [5,6] and the food industry [7]. Simplification of the PCR product detection system and more sensitive system has been demanded with growing commitment of PCR in biological research and industries. Currently, ethidium bromide (EtBr) staining of PCR products after gel electrophoresis [8], hybridization with labeled probe [9], incorporation of label into PCR product [10], and silver staining of PCR products after gel electrophoresis [11] have been used for the detection of PCR products. Of these detection methods, EtBr staining is most frequently used because of its simplicity and low cost. However, the EtBr staining method presents some difficulties such as time-consuming electrophoresis and the fact that EtBr is a carcinogenic agent [12,13]. In the current study, we devised a simple and sensitive method using single-strand tag/hybridization (STH) for the detection of PCR product. ⇑ Corresponding author. Fax: +81 52 872 7537. E-mail address: [email protected] (K. Niwa). Abbreviations used: PCR, polymerase chain reaction; EtBr, ethidium bromide; STH, single-strand tag/hybridization; cTag, complementary tag; NHS, N-hydroxysuccinimide; SSC, saline sodium citrate; SDS, sodium dodecyl sulfate; EDTA, ethylenediaminetetraacetic acid. 1
http://dx.doi.org/10.1016/j.ab.2014.07.010 0003-2697/Ó 2014 Elsevier Inc. All rights reserved.
Materials and methods Primer design The detection method devised in the current study, STH, is schematically described in Fig. 1. The essence of the current method is as follows. One of the primer pairs (designated STH primer) consists of two sequences; the 30 part of the sequence was the primer sequence that was designed to amplify the specific DNA sequence, and the 50 part was the 23-mer tag sequence [14]. The two parts were joined through three-carbon spacer, (CH2)3, using Phosphoramidite C3 spacer (Glen Research, Sterling, VA, USA; http:// www.glenresearch.com/ProductFiles/10-1913.html). The insertion of three-carbon spacer terminates DNA synthesis of Taq DNA polymerase at the insertion site, so that the primer sequence from the site to 30 terminus is left as a single strand in the PCR [15]. The other of the primer pair was designed to amplify the specific DNA sequence together with the primer described above and labeled with Cy3 at its 50 end (Nihon Gene Research Laboratories, Sendai, Japan). In the current study, the primer sequences were designed to amplify a DNA segment encompassing rs6720173 (SNP) using human genomic DNA (Japan Health Sciences Foundation, Tokyo, Japan) (Table 1). As a control of STH primer, a primer was designed to connect the 30 part of the STH primer sequence with a complementary
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
13
Fig.1. Schematic presentation of STH and non-STH PCR detection systems.
Table 1 Primer sequences of STH and non-STH systems for amplification of a DNA segment for human genomic DNA. Sequence (50 to 30 )
Primer Forward Reverse
Common STH/Tag_1 STH/Tag_t (control) Non-STH/ cTag_1 (control) Non-STH/ cTag_t (control)
[Cy3]ACCAAAGAATATGGCTGAATTTAGTAGTGTTTTAAATAATTTTAA gcagattcattggtcagagaacaXACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA ttttttttttttttttttttXACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA tgttctctgaccaatgaatctgcACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA aaaaaaaaaaaaaaaaaaaaaaaACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA
Note. Uppercase letters of primer sequences represent sequences necessary for amplification of human genomic DNA segment, and lowercase letters represent tag sequences. ‘‘X’’ represents ‘‘spacer C3’’.
tag (cTag) sequence without spacer (non-STH primer), which enables PCR to proceed to the 30 end of the primer (Table 1).
Detection of PCR product The single-strand cTag sequences joined with EC amino linker (Sigma–Aldrich Japan, Hokkaido, Japan) in polyethylene glycol aqueous solution (10%, w/v) were spotted on an N-hydroxysuccinimide (NHS) ester-activated glass slide, GeneSlide (10 fmol/ spot; Toyo Kohan, Tokyo, Japan), with a diameter of approximately 100 lm, and immobilized by amidation of NHS ester on the glass surface. The glass slides were incubated at 80 °C for 60 min and then washed successively with 2 saline sodium citrate (SSC) containing 0.2% sodium dodecyl sulfate (SDS) for 15 min at room temperature, with 2 SSC containing 0.2% SDS for 5 min at 90 °C, and with water for 1 min, followed by drying at room temperature. The DNA array layout on the glass slide and its signal image are shown in Fig. 2. PCR was performed using primer sets and template DNA described above following the procedure described by Nishida and coworkers [14]. The PCR product generated by non-STH primer pair was first subjected to electrophoresis in a 4% NuSieve 3:1 agarose gel and subsequent staining with EtBr to confirm that the PCR product was the expected size. Then, the PCR product generated by STH primer pair was purified with a MinElute PCR Purification Kit (Qiagen, Valencia, CA, USA). The amount of the purified PCR product was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher
Scientific, Waltham, MA, USA). The PCR product obtained in this manner was serially diluted with a buffer consisting of 10 mM Tris–HCl (pH 8.0) and 0.1 mM ethylenediaminetetraacetic acid (EDTA). The diluted PCR products were electrophoresed in a 4% NuSieve 3:1 agarose gel (Fig. 3) to examine their integrity and visibility with EtBr staining. After the examination, the diluted PCR products were subjected to hybridization detection on the glass slide, to which cTag sequence had been fixed as a spot. Prior to the hybridization, non-STH PCR products were denatured at 90 °C for 1 min and chilled quickly to make single-strand DNA. Then, the STH and non-STH PCR products were hybridized with cTag sequence on the slide according to the following procedure. Hybridization was performed at 37 °C for 30 min in 10 ll of hybridization mixture consisting of 0.5 SSC (0.15 M NaCl and 0.015 M sodium citrate), 0.1% SDS, 15% formamide, 1 mM EDTA, and an appropriate amount of PCR product. After the hybridization, the slide was washed once with a solution consisting of 1 SSC and 0.1% SDS for 3 min at 25 °C and then twice with 1 SSC for 1 min at 25 °C. The resulting glass slide was dried by spinning and subjected to measurement of hybridization signal (i.e., Cy3 signal) using a laser fluorescent scanner (GenePix 4000B and GenePix Pro 6.1 software package; Molecular Devices, Sunnyvale, CA, USA).
Results and discussion As described in Materials and methods, primer pairs for STH and non-STH PCRs were used for amplification of DNA segment
14
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
Fig.2. DNA array layout on glass slide (A) and its signal image (B). One glass slide consists of 32 DNA array sets, and one set of DNA array consists of 33 spots, each of which contains one cTag sequence.
Fig.3. Agarose gel electrophoresis and EtBr staining of PCR products. PCR products generated with STH and non-STH primer sets were purified, and the amounts of PCR products were determined by a spectrophotometer. Then, the PCR products were serially diluted with the buffer, consisting of 10 mM Tris–HCl (pH 8.0) and 0.1 mM EDTA, to make samples containing 45, 15, 5, and 1.7 ng. The resulting DNA samples were electrophoresed in a 4% NuSieve 3:1 agarose gel and visualized by EtBr staining. Lanes M: molecular size marker of a 50-bp ladder; lane 1: 45 ng with STH primer set; lane 2: 15 ng with STH primer set; lane 3: 5 ng with STH primer set; lane 4: 1.7 ng with STH primer set; lane 5: 45 ng with non-STH primer set; lane 6: 15 ng with non-STH primer set; lane 7: 5 ng with non-STH primer set; lane 8: 1.7 ng with non-STH primer set.
from human genomic DNA. The DNA fragments amplified in this manner were confirmed to be the fragments of expected sizes in 4% NuSieve 3:1 agarose gel electrophoresis and then purified as described above to simplify the components for evaluation of the STH detection system. The amounts of purified DNA fragments were determined using the spectrophotometer, revealing no observable difference between STH primer and non-STH primer sets
(data not shown). The PCR products were diluted to make 6-ll samples containing 45, 15, 5, and 1.7 ng of the DNA fragments, and those samples were applied to slots of a 4% NuSieve 3:1 agarose, followed by electrophoresis at 100 V for 90 min and EtBr staining. As shown in Fig. 3, the visibility limit of the DNA band was judged to be 5 ng; this observation is consistent with an earlier report [16]. Then, the STH detection system was examined together with non-STH detection system (control). The DNA fragments obtained with STH/Tag_1 and non-STH/cTag_1 primer sets were diluted to make samples containing 8, 2.7, 0.89, 0.30, and 0.10 ng. In addition, the sample containing no DNA fragment was prepared as a negative control. Furthermore, the DNA fragments obtained with STH/ Tag_t and non-STH/cTag_t primer pairs were also prepared as additional negative controls. These samples were applied to the glass slide for hybridization following the procedure described in Materials and methods. After elimination of nonhybridized DNA fragments by washing, the Cy3 signals on the glass slide were detected using GenePix. The photographic image of hybridization signals is shown in Fig. 4A, with the signals indicated by arrows. Based on the photo, the visibility limits appeared to be 0.3 and 0.89 ng for the STH and non-STH systems, respectively. To quantify the hybridization signals, the signal intensities were measured for three hybridization trials at each amount using GenePix. As shown by the measurement results in Table 2, the hybridization signals were significantly detected in up to the smallest amount of DNA samples examined (0.10 ng). In addition, PCR using the STH primer or non-STH primer pairs and no DNA as template gave no signals (data not shown). These observations, taken together, demonstrated that the STH system provided more than 50 times higher sensitivity than the EtBr staining system. The sensitivity of the STH/non-STH system is based on the number of DNA molecules, whereas that of the EtBr staining system is based on the amount of DNA. These facts show that the sensitivity difference between the STH/non-STH and EtBr staining systems increased with the
15
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
Fig.4. Hybridization of PCR products to cTag sequence immobilized on a glass slide. The PCR products in Fig. 3 were diluted to make DNA samples containing 8.0, 2.7, 0.89, 0.30, and 0.10 ng. DNA samples generated with the non-STH primer set were denatured as described in Materials and Methods prior to hybridization to cTag sequence on the glass slide. The resulting DNA samples were subjected to hybridization to cTag sequence on the glass slide following the procedure described in Materials and methods. The hybridization signals were measured using GenePix. (A) Photo images of the hybridization results. Arrows indicate the positions of hybridization in photos; and the inset is an enlargement of hybridization signal. (B) Bar graphs of signal intensities based on the signal data (Table 2). Open bars indicate STH signals, and shaded bars indicate non-STH signals.
Table 2 Hybridization signal intensities obtained from various amounts of PCR product in STH and non-STH systems. PCR system
STH
Amount (ng) Tag Sample 1 Sample 2 Sample 3 Average Standard error
8.0 Tag_1 36159 39566 41921 39215 1673
Non-STH 2.7
0.89
0.30
0.10
38322 35476 37700 37166 864
18102 12067 16276 15482 1787
6145 6817 4815 5926 588
2478 2162 2182 2274 102
0 – 128 277 – 203 –
decrease of PCR product size. Therefore, if a PCR product is smaller than the current fragment size, the sensitivity difference for the PCR fragment is to be larger than the current one. The signals obtained are shown in a bar graph to distinguish them visually (Fig. 4B). As shown in Table 2 and Fig. 4B, the STH system consistently provided higher hybridization signals than the non-STH system, and the signal difference between the STH and non-STH systems increased as a function of PCR product concentration. These observations led us to infer the following. The single-strand DNAs generated by denaturation in the non-STH system were gradually renatured to make original double-strand DNA in the hybridization to cTag sequence on the glass slide. The completely renatured DNA fragment was eliminated from the
10.0 Tag_t 274 235 234 248 13
8.0 cTag_1 26986 25388 17866 23413 2812
2.7
0.89
0.30
0.10
19392 14351 11835 15193 2222
8358 8045 5943 7449 758
4141 4173 4145 4153 10
2167 1872 1683 1907 141
0 – 128 277 – 203 –
10.0 cTag_t 173 220 275 223 29
hybridization to cTag sequence, which consequently reduced the hybridization signals in the non-STH system. Quantification of PCR product is another important matter. Therefore, we examined the relationship of hybridization signal intensity to the amount of PCR product. To understand the relationship, the hybridization signal data and the amount of DNA fragments shown in Table 2 were re-plotted in a linear scale (Fig. 5). As shown in Fig. 5, the linearity appeared to be maintained from 0 to 2.7 ng. So, we calculated correlation coefficients for the range from 0 to 2.7 ng in the STH and non-STH systems and found them to be 0.98 and 0.89, respectively. The calculation showed that the STH system is more suitable for quantitative analysis than the non-STH system. Currently, the linear correlation between the signal intensity and amount of DNA
16
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
terms of sensitivity for the detection of approximately a 500-bp fragment, the STH system is at least 50 times higher than the ordinary EtBr staining system and at least 25 times higher than silver staining [11], and it appeared to be approximately the same as SYBR Green I staining based on data from a website (http:// www.lifetechnologies.com/jp/ja/home/references/molecularprobes-the-handbook/nucleic-acid-detection-and-genomics-technology/nucleic-acid-detection-and-quantitation-in-electrophoretic-gels-and-capillaries.html#head1). However, when fragment size decreases, the relative sensitivity of the STH system against the above-described staining methods elevates. In addition, the STH system is applicable for quantitative measurement of PCR product. References
Fig.5. Correlation between signal intensity and amount of PCR product. (A) Correlation between signal intensity and amount of PCR product. The ordinate indicates the intensity of hybridization signals, and the abscissa indicates the amount of PCR product used for the hybridization. (B) Range showing linear correlation between signal intensity and amount of PCR product as well as correlation coefficients calculated from the range. The ordinate and abscissa are the same as in panel A.
fragment is up to 2.7 ng. However, if the amount of cTag sequence fixed on glass slide is elevated, the linear correlation would be extended to an amount of DNA fragment larger than 2.7 ng. When the free primers were not removed in the tag/hybridization-based PCR product detection, the signal intensities were reduced due to free primers, which are not involved in the generation of PCR product. However, because the removal of free primers is laborious in performing the detection, we examined the detection system without removal of the free primers in the serial dilution as we did for the purified PCR product, revealing that the detection end-point (800 dilution) was approximately the same between detections with and without removal of the free primers (data not shown). This observation is consistent with the fact that the total molar amounts of STH primer in samples diluted more than 25 times were less than those of tag sequence fixed on the glass slide. In conclusion, the STH system devised in the current study was found to provide simple and sensitive detection of PCR product. In
[1] K.B. Mullis, F.A. Faloona, Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction, Methods Enzymol. 155 (1987) 335–350. [2] K. Mullis, F. Faloona, S. Scharf, R. Saiki, G. Horn, H. Erlich, Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction, Cold Spring Harb. Symp. Quant. Biol. 51 (1986) 263–273. [3] R.K. Saiki, S. Scharf, F. Faloona, K.B. Mullis, G.T. Horn, H.A. Erlich, N. Arnheim, Enzymatic amplification of -globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia, Science 230 (1985) 1350–1354. [4] R.K. Saiki, D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, H.A. Erlich, Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase, Science 239 (1988) 487–491. [5] D. Thierry, A. Brisson-Noël, V. Vincent-Lévy-Frébault, S. Nguyen, J. Guesdon, B. Gicquel, Characterization of a Mycobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis, J. Clin. Microbiol. 28 (1990) 2668– 2673. [6] S. Takewaki, K. Okuzumi, H. Ishiko, K. Nakahara, A. Ohkubo, R. Nagai, Genusspecific polymerase chain reaction for the mycobacterial dnaJ gene and species-specific oligonucleotide probes, J. Clin. Microbiol. 31 (1993) 446–450. [7] R. Saez, Y. Sanz, F. Toldrá, PCR-based fingerprinting techniques for rapid detection of animal species in meat products, Meat Sci. 66 (2004) 659–665. [8] P.A. Sharp, B. Sugden, J. Sambrook, Detection of two restriction endonuclease activities in Haemophilus parainfluenzae using analytical agarose–ethidium bromide electrophoresis, Biochemistry 12 (1973) 3055–3063. [9] H. Inoko, A. Ando, M. Ito, K. Tsuji, Southern hybridization analysis of DNA polymorphism in the HLA-D region, Hum. Immunol. 16 (1986) 304–313. [10] G. Gilliland, S. Perrin, K. Blanchard, H.F. Bunn, Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 2725–2729. [11] M. Gottlieb, M. Chavko, Silver staining of native and denatured eukaryotic DNA in agarose gels, Anal. Biochem. 165 (1987) 33–37. [12] J. McCann, E. Choi, E. Yamasaki, B.N. Ames, Detection of carcinogens as mutagens in the Salmonella/microsome test: assay of 300 chemicals, Proc. Natl. Acad. Sci. U.S.A. 72 (1975) 5135–5139. [13] V.L. Singer, T.E. Lawlor, S. Yue, Comparison of SYBR Green I nucleic acid gel stain mutagenicity and ethidium bromide mutagenicity in the Salmonella/ mammalian microsome reverse mutation assay (Ames test), Mutat. Res. 439 (1999) 37–47. [14] N. Nishida, T. Tanabe, M. Takasu, A. Suyama, K. Tokunaga, Further development of multiplex single nucleotide polymorphism typing method, the DigiTag2 assay, Anal. Biochem. 364 (2007) 78–85. [15] C.R. Newton, D. Holland, L.E. Heptinstall, I. Hodgson, M.D. Edge, A.F. Markham, M.J. McLean, The production of PCR products with 50 single-stranded tails using primers that incorporate novel phosphoramidite intermediates, Nucleic Acids Res. 21 (1993) 1155–1162. [16] Q. Huang, W. Fu, Comparative analysis of the DNA staining efficiencies of fluorescent dyes in preparative agarose gel electrophoresis, Clin. Chem. Lab. Med. 43 (2005) 841–842.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Tag/hybridization-based sensitive detection of polymerase chain reaction products Kousuke Niwa a,⇑, Akinobu Oribe a, Hidemasa Okumura a, Masahiro Shimono a, Kenkichi Nagai a, Toshikazu Hirota a, Hiroshi Yasue b, Mitsuo Kawase a,c a b c
Future Technology Management Center, Corporate R&D, NGK Insulators, Mizuho, Nagoya 467-8530, Japan Tsukuba Gene Technology Laboratories, Tsuchiura, Ibaraki 300-0873, Japan Graduate School of Biomedical Engineering, Tohoku University, Aoba, Sendai 980-8579, Japan
a r t i c l e
i n f o
Article history: Received 29 April 2014 Received in revised form 10 July 2014 Accepted 11 July 2014 Available online 19 July 2014 Keywords: Single-stranded DNA tag Non-nucleic acid spacer DNA microarray Hybridization Fluorescence label
a b s t r a c t The polymerase chain reaction (PCR) is an important technology to amplify a single copy or a few copies of DNA segment in genomic DNAs, visualizing the segment as DNA fragment. Thus, PCR is frequently used in various examinations such as detection of bacteria and fungi in the food industry. Here, we report a simple and sensitive method for detection of PCR products using single-strand tag sequence and hybridization of the tag sequence to the complementary tag sequence immobilized on solid material (STH). The detection sensitivity was found to be at least 50 times higher than electrophoresis/ethidium bromide (EtBr) visualization for approximately a 500-bp fragment and higher than the ordinary hybridization, that is, hybridization of denatured PCR product to probe sequence immobilized on solid material. Ó 2014 Elsevier Inc. All rights reserved.
The polymerase chain reaction (PCR)1 was developed by Mullis and Falloona in 1985 to detect a single copy or a few copies of DNA segment in DNA sequences [1–4]. Since then, PCR has been increasingly used in various fields, for example, the detection of pathogenic agents in medicine [5,6] and the food industry [7]. Simplification of the PCR product detection system and more sensitive system has been demanded with growing commitment of PCR in biological research and industries. Currently, ethidium bromide (EtBr) staining of PCR products after gel electrophoresis [8], hybridization with labeled probe [9], incorporation of label into PCR product [10], and silver staining of PCR products after gel electrophoresis [11] have been used for the detection of PCR products. Of these detection methods, EtBr staining is most frequently used because of its simplicity and low cost. However, the EtBr staining method presents some difficulties such as time-consuming electrophoresis and the fact that EtBr is a carcinogenic agent [12,13]. In the current study, we devised a simple and sensitive method using single-strand tag/hybridization (STH) for the detection of PCR product. ⇑ Corresponding author. Fax: +81 52 872 7537. E-mail address: [email protected] (K. Niwa). Abbreviations used: PCR, polymerase chain reaction; EtBr, ethidium bromide; STH, single-strand tag/hybridization; cTag, complementary tag; NHS, N-hydroxysuccinimide; SSC, saline sodium citrate; SDS, sodium dodecyl sulfate; EDTA, ethylenediaminetetraacetic acid. 1
http://dx.doi.org/10.1016/j.ab.2014.07.010 0003-2697/Ó 2014 Elsevier Inc. All rights reserved.
Materials and methods Primer design The detection method devised in the current study, STH, is schematically described in Fig. 1. The essence of the current method is as follows. One of the primer pairs (designated STH primer) consists of two sequences; the 30 part of the sequence was the primer sequence that was designed to amplify the specific DNA sequence, and the 50 part was the 23-mer tag sequence [14]. The two parts were joined through three-carbon spacer, (CH2)3, using Phosphoramidite C3 spacer (Glen Research, Sterling, VA, USA; http:// www.glenresearch.com/ProductFiles/10-1913.html). The insertion of three-carbon spacer terminates DNA synthesis of Taq DNA polymerase at the insertion site, so that the primer sequence from the site to 30 terminus is left as a single strand in the PCR [15]. The other of the primer pair was designed to amplify the specific DNA sequence together with the primer described above and labeled with Cy3 at its 50 end (Nihon Gene Research Laboratories, Sendai, Japan). In the current study, the primer sequences were designed to amplify a DNA segment encompassing rs6720173 (SNP) using human genomic DNA (Japan Health Sciences Foundation, Tokyo, Japan) (Table 1). As a control of STH primer, a primer was designed to connect the 30 part of the STH primer sequence with a complementary
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
13
Fig.1. Schematic presentation of STH and non-STH PCR detection systems.
Table 1 Primer sequences of STH and non-STH systems for amplification of a DNA segment for human genomic DNA. Sequence (50 to 30 )
Primer Forward Reverse
Common STH/Tag_1 STH/Tag_t (control) Non-STH/ cTag_1 (control) Non-STH/ cTag_t (control)
[Cy3]ACCAAAGAATATGGCTGAATTTAGTAGTGTTTTAAATAATTTTAA gcagattcattggtcagagaacaXACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA ttttttttttttttttttttXACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA tgttctctgaccaatgaatctgcACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA aaaaaaaaaaaaaaaaaaaaaaaACCTGCTAATGAGATGATCCCTTATTTTGAAAACAACTATTCCTA
Note. Uppercase letters of primer sequences represent sequences necessary for amplification of human genomic DNA segment, and lowercase letters represent tag sequences. ‘‘X’’ represents ‘‘spacer C3’’.
tag (cTag) sequence without spacer (non-STH primer), which enables PCR to proceed to the 30 end of the primer (Table 1).
Detection of PCR product The single-strand cTag sequences joined with EC amino linker (Sigma–Aldrich Japan, Hokkaido, Japan) in polyethylene glycol aqueous solution (10%, w/v) were spotted on an N-hydroxysuccinimide (NHS) ester-activated glass slide, GeneSlide (10 fmol/ spot; Toyo Kohan, Tokyo, Japan), with a diameter of approximately 100 lm, and immobilized by amidation of NHS ester on the glass surface. The glass slides were incubated at 80 °C for 60 min and then washed successively with 2 saline sodium citrate (SSC) containing 0.2% sodium dodecyl sulfate (SDS) for 15 min at room temperature, with 2 SSC containing 0.2% SDS for 5 min at 90 °C, and with water for 1 min, followed by drying at room temperature. The DNA array layout on the glass slide and its signal image are shown in Fig. 2. PCR was performed using primer sets and template DNA described above following the procedure described by Nishida and coworkers [14]. The PCR product generated by non-STH primer pair was first subjected to electrophoresis in a 4% NuSieve 3:1 agarose gel and subsequent staining with EtBr to confirm that the PCR product was the expected size. Then, the PCR product generated by STH primer pair was purified with a MinElute PCR Purification Kit (Qiagen, Valencia, CA, USA). The amount of the purified PCR product was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher
Scientific, Waltham, MA, USA). The PCR product obtained in this manner was serially diluted with a buffer consisting of 10 mM Tris–HCl (pH 8.0) and 0.1 mM ethylenediaminetetraacetic acid (EDTA). The diluted PCR products were electrophoresed in a 4% NuSieve 3:1 agarose gel (Fig. 3) to examine their integrity and visibility with EtBr staining. After the examination, the diluted PCR products were subjected to hybridization detection on the glass slide, to which cTag sequence had been fixed as a spot. Prior to the hybridization, non-STH PCR products were denatured at 90 °C for 1 min and chilled quickly to make single-strand DNA. Then, the STH and non-STH PCR products were hybridized with cTag sequence on the slide according to the following procedure. Hybridization was performed at 37 °C for 30 min in 10 ll of hybridization mixture consisting of 0.5 SSC (0.15 M NaCl and 0.015 M sodium citrate), 0.1% SDS, 15% formamide, 1 mM EDTA, and an appropriate amount of PCR product. After the hybridization, the slide was washed once with a solution consisting of 1 SSC and 0.1% SDS for 3 min at 25 °C and then twice with 1 SSC for 1 min at 25 °C. The resulting glass slide was dried by spinning and subjected to measurement of hybridization signal (i.e., Cy3 signal) using a laser fluorescent scanner (GenePix 4000B and GenePix Pro 6.1 software package; Molecular Devices, Sunnyvale, CA, USA).
Results and discussion As described in Materials and methods, primer pairs for STH and non-STH PCRs were used for amplification of DNA segment
14
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
Fig.2. DNA array layout on glass slide (A) and its signal image (B). One glass slide consists of 32 DNA array sets, and one set of DNA array consists of 33 spots, each of which contains one cTag sequence.
Fig.3. Agarose gel electrophoresis and EtBr staining of PCR products. PCR products generated with STH and non-STH primer sets were purified, and the amounts of PCR products were determined by a spectrophotometer. Then, the PCR products were serially diluted with the buffer, consisting of 10 mM Tris–HCl (pH 8.0) and 0.1 mM EDTA, to make samples containing 45, 15, 5, and 1.7 ng. The resulting DNA samples were electrophoresed in a 4% NuSieve 3:1 agarose gel and visualized by EtBr staining. Lanes M: molecular size marker of a 50-bp ladder; lane 1: 45 ng with STH primer set; lane 2: 15 ng with STH primer set; lane 3: 5 ng with STH primer set; lane 4: 1.7 ng with STH primer set; lane 5: 45 ng with non-STH primer set; lane 6: 15 ng with non-STH primer set; lane 7: 5 ng with non-STH primer set; lane 8: 1.7 ng with non-STH primer set.
from human genomic DNA. The DNA fragments amplified in this manner were confirmed to be the fragments of expected sizes in 4% NuSieve 3:1 agarose gel electrophoresis and then purified as described above to simplify the components for evaluation of the STH detection system. The amounts of purified DNA fragments were determined using the spectrophotometer, revealing no observable difference between STH primer and non-STH primer sets
(data not shown). The PCR products were diluted to make 6-ll samples containing 45, 15, 5, and 1.7 ng of the DNA fragments, and those samples were applied to slots of a 4% NuSieve 3:1 agarose, followed by electrophoresis at 100 V for 90 min and EtBr staining. As shown in Fig. 3, the visibility limit of the DNA band was judged to be 5 ng; this observation is consistent with an earlier report [16]. Then, the STH detection system was examined together with non-STH detection system (control). The DNA fragments obtained with STH/Tag_1 and non-STH/cTag_1 primer sets were diluted to make samples containing 8, 2.7, 0.89, 0.30, and 0.10 ng. In addition, the sample containing no DNA fragment was prepared as a negative control. Furthermore, the DNA fragments obtained with STH/ Tag_t and non-STH/cTag_t primer pairs were also prepared as additional negative controls. These samples were applied to the glass slide for hybridization following the procedure described in Materials and methods. After elimination of nonhybridized DNA fragments by washing, the Cy3 signals on the glass slide were detected using GenePix. The photographic image of hybridization signals is shown in Fig. 4A, with the signals indicated by arrows. Based on the photo, the visibility limits appeared to be 0.3 and 0.89 ng for the STH and non-STH systems, respectively. To quantify the hybridization signals, the signal intensities were measured for three hybridization trials at each amount using GenePix. As shown by the measurement results in Table 2, the hybridization signals were significantly detected in up to the smallest amount of DNA samples examined (0.10 ng). In addition, PCR using the STH primer or non-STH primer pairs and no DNA as template gave no signals (data not shown). These observations, taken together, demonstrated that the STH system provided more than 50 times higher sensitivity than the EtBr staining system. The sensitivity of the STH/non-STH system is based on the number of DNA molecules, whereas that of the EtBr staining system is based on the amount of DNA. These facts show that the sensitivity difference between the STH/non-STH and EtBr staining systems increased with the
15
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
Fig.4. Hybridization of PCR products to cTag sequence immobilized on a glass slide. The PCR products in Fig. 3 were diluted to make DNA samples containing 8.0, 2.7, 0.89, 0.30, and 0.10 ng. DNA samples generated with the non-STH primer set were denatured as described in Materials and Methods prior to hybridization to cTag sequence on the glass slide. The resulting DNA samples were subjected to hybridization to cTag sequence on the glass slide following the procedure described in Materials and methods. The hybridization signals were measured using GenePix. (A) Photo images of the hybridization results. Arrows indicate the positions of hybridization in photos; and the inset is an enlargement of hybridization signal. (B) Bar graphs of signal intensities based on the signal data (Table 2). Open bars indicate STH signals, and shaded bars indicate non-STH signals.
Table 2 Hybridization signal intensities obtained from various amounts of PCR product in STH and non-STH systems. PCR system
STH
Amount (ng) Tag Sample 1 Sample 2 Sample 3 Average Standard error
8.0 Tag_1 36159 39566 41921 39215 1673
Non-STH 2.7
0.89
0.30
0.10
38322 35476 37700 37166 864
18102 12067 16276 15482 1787
6145 6817 4815 5926 588
2478 2162 2182 2274 102
0 – 128 277 – 203 –
decrease of PCR product size. Therefore, if a PCR product is smaller than the current fragment size, the sensitivity difference for the PCR fragment is to be larger than the current one. The signals obtained are shown in a bar graph to distinguish them visually (Fig. 4B). As shown in Table 2 and Fig. 4B, the STH system consistently provided higher hybridization signals than the non-STH system, and the signal difference between the STH and non-STH systems increased as a function of PCR product concentration. These observations led us to infer the following. The single-strand DNAs generated by denaturation in the non-STH system were gradually renatured to make original double-strand DNA in the hybridization to cTag sequence on the glass slide. The completely renatured DNA fragment was eliminated from the
10.0 Tag_t 274 235 234 248 13
8.0 cTag_1 26986 25388 17866 23413 2812
2.7
0.89
0.30
0.10
19392 14351 11835 15193 2222
8358 8045 5943 7449 758
4141 4173 4145 4153 10
2167 1872 1683 1907 141
0 – 128 277 – 203 –
10.0 cTag_t 173 220 275 223 29
hybridization to cTag sequence, which consequently reduced the hybridization signals in the non-STH system. Quantification of PCR product is another important matter. Therefore, we examined the relationship of hybridization signal intensity to the amount of PCR product. To understand the relationship, the hybridization signal data and the amount of DNA fragments shown in Table 2 were re-plotted in a linear scale (Fig. 5). As shown in Fig. 5, the linearity appeared to be maintained from 0 to 2.7 ng. So, we calculated correlation coefficients for the range from 0 to 2.7 ng in the STH and non-STH systems and found them to be 0.98 and 0.89, respectively. The calculation showed that the STH system is more suitable for quantitative analysis than the non-STH system. Currently, the linear correlation between the signal intensity and amount of DNA
16
Tag/hybridization-based detection of PCR products / K. Niwa et al. / Anal. Biochem. 464 (2014) 12–16
terms of sensitivity for the detection of approximately a 500-bp fragment, the STH system is at least 50 times higher than the ordinary EtBr staining system and at least 25 times higher than silver staining [11], and it appeared to be approximately the same as SYBR Green I staining based on data from a website (http:// www.lifetechnologies.com/jp/ja/home/references/molecularprobes-the-handbook/nucleic-acid-detection-and-genomics-technology/nucleic-acid-detection-and-quantitation-in-electrophoretic-gels-and-capillaries.html#head1). However, when fragment size decreases, the relative sensitivity of the STH system against the above-described staining methods elevates. In addition, the STH system is applicable for quantitative measurement of PCR product. References
Fig.5. Correlation between signal intensity and amount of PCR product. (A) Correlation between signal intensity and amount of PCR product. The ordinate indicates the intensity of hybridization signals, and the abscissa indicates the amount of PCR product used for the hybridization. (B) Range showing linear correlation between signal intensity and amount of PCR product as well as correlation coefficients calculated from the range. The ordinate and abscissa are the same as in panel A.
fragment is up to 2.7 ng. However, if the amount of cTag sequence fixed on glass slide is elevated, the linear correlation would be extended to an amount of DNA fragment larger than 2.7 ng. When the free primers were not removed in the tag/hybridization-based PCR product detection, the signal intensities were reduced due to free primers, which are not involved in the generation of PCR product. However, because the removal of free primers is laborious in performing the detection, we examined the detection system without removal of the free primers in the serial dilution as we did for the purified PCR product, revealing that the detection end-point (800 dilution) was approximately the same between detections with and without removal of the free primers (data not shown). This observation is consistent with the fact that the total molar amounts of STH primer in samples diluted more than 25 times were less than those of tag sequence fixed on the glass slide. In conclusion, the STH system devised in the current study was found to provide simple and sensitive detection of PCR product. In
[1] K.B. Mullis, F.A. Faloona, Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction, Methods Enzymol. 155 (1987) 335–350. [2] K. Mullis, F. Faloona, S. Scharf, R. Saiki, G. Horn, H. Erlich, Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction, Cold Spring Harb. Symp. Quant. Biol. 51 (1986) 263–273. [3] R.K. Saiki, S. Scharf, F. Faloona, K.B. Mullis, G.T. Horn, H.A. Erlich, N. Arnheim, Enzymatic amplification of -globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia, Science 230 (1985) 1350–1354. [4] R.K. Saiki, D.H. Gelfand, S. Stoffel, S.J. Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, H.A. Erlich, Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase, Science 239 (1988) 487–491. [5] D. Thierry, A. Brisson-Noël, V. Vincent-Lévy-Frébault, S. Nguyen, J. Guesdon, B. Gicquel, Characterization of a Mycobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis, J. Clin. Microbiol. 28 (1990) 2668– 2673. [6] S. Takewaki, K. Okuzumi, H. Ishiko, K. Nakahara, A. Ohkubo, R. Nagai, Genusspecific polymerase chain reaction for the mycobacterial dnaJ gene and species-specific oligonucleotide probes, J. Clin. Microbiol. 31 (1993) 446–450. [7] R. Saez, Y. Sanz, F. Toldrá, PCR-based fingerprinting techniques for rapid detection of animal species in meat products, Meat Sci. 66 (2004) 659–665. [8] P.A. Sharp, B. Sugden, J. Sambrook, Detection of two restriction endonuclease activities in Haemophilus parainfluenzae using analytical agarose–ethidium bromide electrophoresis, Biochemistry 12 (1973) 3055–3063. [9] H. Inoko, A. Ando, M. Ito, K. Tsuji, Southern hybridization analysis of DNA polymorphism in the HLA-D region, Hum. Immunol. 16 (1986) 304–313. [10] G. Gilliland, S. Perrin, K. Blanchard, H.F. Bunn, Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 2725–2729. [11] M. Gottlieb, M. Chavko, Silver staining of native and denatured eukaryotic DNA in agarose gels, Anal. Biochem. 165 (1987) 33–37. [12] J. McCann, E. Choi, E. Yamasaki, B.N. Ames, Detection of carcinogens as mutagens in the Salmonella/microsome test: assay of 300 chemicals, Proc. Natl. Acad. Sci. U.S.A. 72 (1975) 5135–5139. [13] V.L. Singer, T.E. Lawlor, S. Yue, Comparison of SYBR Green I nucleic acid gel stain mutagenicity and ethidium bromide mutagenicity in the Salmonella/ mammalian microsome reverse mutation assay (Ames test), Mutat. Res. 439 (1999) 37–47. [14] N. Nishida, T. Tanabe, M. Takasu, A. Suyama, K. Tokunaga, Further development of multiplex single nucleotide polymorphism typing method, the DigiTag2 assay, Anal. Biochem. 364 (2007) 78–85. [15] C.R. Newton, D. Holland, L.E. Heptinstall, I. Hodgson, M.D. Edge, A.F. Markham, M.J. McLean, The production of PCR products with 50 single-stranded tails using primers that incorporate novel phosphoramidite intermediates, Nucleic Acids Res. 21 (1993) 1155–1162. [16] Q. Huang, W. Fu, Comparative analysis of the DNA staining efficiencies of fluorescent dyes in preparative agarose gel electrophoresis, Clin. Chem. Lab. Med. 43 (2005) 841–842.
