GYNECOLOGIC
ONCOLOGY
0,
206-210 (1991)
Human Papillomaviruses and Small Cell Carcinoma of the Uterine Cervix CHIA C. PAO,* CHIEH-YU LIN,* *Department
of Biochemistry,
Chang
YA-LI CHANG,*
CHIH-JEN TSENG,? AND SWEI HSUEH$
Gung Medical College, and Departments of ?Obstetrics and Gynecology Memorial Hospital, Taipei, Taiwan 33332, Republic of China
and $Pathology,
Chang
Gung
Received February 11, 1991
The in vitro DNA ampliOcationtechniqueof polymerasechain reaction was used to evaluate the possiblepresenceof human papillomavirus(HPV) in smallcell carcinomaof the uterine cervix. None of the 12 casesexaminedcontain detectableamounts of either HPV type 16, 18, 31, or 33 DNA. On the other hand, HPV types 16 and 18 DNA were found in 14 (93.3%) and 9 (60.0%) of 25 invasive cervical squamouscarcinomatissues.The resultsseemto suggestthat thesetypes of HPV are not present or are presentin extremely smallquantities in cervical smallcell carcinoma.Such an absenceof HPV DNA makesit unlikely that thesetypes of HPV play any etiologicalrole in the pathogenesis of cervical small cell carcinoma. 0 1991 Academic Press, Inc.
INTRODUCTION Small cell carcinomas of the uterine cervix, which make up approximately 1% of all invasive cervical cancers, are a heterologous group of tumors that are highly aggressive and tend to metastasize early to extrapelvic sites [l-4]. It has been recognized for many years that squamous cell carcinoma of the uterine cervix and its precursor lesions have many features characteristic of sexually transmitted diseases. An increasing number of reports have suggested that several types of human papillomaviruses (HPV) may play certain important and even etiologic roles in the pathogenesis of human genital tract cancer 15-71.
The current investigation aims to apply an extremely sensitive method, the polymerase chain reaction (PCR), to examine the possible presence of HPV in small cell carcinoma of the uterine cervix. MATERIALS
AND METHODS
Experimental protocol. Paraffin blocks of 12 documented cases of small cell carcinoma of the uterine cervix (11 small cell carcinoma and 1 with a mixture of small cell carcinoma and adenosquamous carcinoma) were ob-
tained from the archives of the Department of Pathology of Chang Gung Memorial Hospital (Fig. 1). Four 4-pm tissue sections were prepared from each of the 12 paraffin blocks. Tissue sections were also prepared from paraffin blocks of 15 age-matched squamous carcinoma patients for comparison purposes. Information regarding the 12 patients with small cell carcinoma of the uterine cervix is listed in Table 1. CaSki and HeLa cells, which contain HPV types 16 and 18, respectively, were obtained from American Type Culture Collection (Rockville, MD). PCR amplification. The presence of HPV was determined with the enzyme-based DNA amplification method on tissue sections directly without extracting the DNA first to minimize the chance of contamination during sample processing [8]. The procedures for the amplification and subsequent detection of HPV DNA were those that we have reported earlier [9-lo] with the following modifications to incorporate an additional round of “nested” amplification. For nested PCR, 2 ~1 of the initial amplified mixture was amplified following the same procedure in a freshly prepared loo-p1 reaction mixture containing the same components as those with initial PCR and the new set of nested primers. A genomic region either within or including the E6 gene of HPV was chosen to prepare all the primers and the probes because this region is almost always retained in the HPV DNA integrated in cancer tissues [ll]. The primers and lengths of resulting DNA after amplification of HPV types 16 and 18 are listed in Table 2. HPV type 16 was also analyzed with two additional sets of primers that amplify the E7 gene (297 bp, from 562 to 858 nt) and the Ll gene (587 bp, from 6533 to 7119 nt). Two additional sets of primers were also used to amplify the E6 gene (360 bp, from 91 to 450 nt) and the’E7 gene (87 bp, from 590 to 676 nt) of HPV type 18 DNA. Human Alu repeated DNA sequences were amplified with primers described by others [12]. Establishment of HPVpositivity.
206 0090-8258/91 $1.50 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form resewed.
After the nested am-
HPV AND SMALL
plification, one-tenth of the amplified reaction mixture was separated by electrophoresis in 2% agarose gel containing 0.5 pg/ml ethidium bromide and visually inspected under ultraviolet light for DNA bands of appropriate sizes. Authenticity of the amplified DNA was confirmed by restriction endonuclease pattern and by Southern blot DNA hybridization analyses with internal oligonucleotide probes [10,13]. The sequences of oligonucleotide probes for types 16 and 18 HPV DNA are (5’ to 3’ end) AGCTGCAAACAACTATACATGATATAATATTAGAATGTGT and AACTGAACAC’ITCACTGCAAGACATAGAAATAACCTGTGT, respectively. Precautions against contamination and false-positive results in PCR: Because of the exquisite amplification
power of the PCR procedures, precautionary measures were taken to minimize the possibility of sample-to-sample contaminations and PCR-product carryovers. These measures include wearing and frequent changing of disposable gloves during all procedures involving specimen handling and processing, thorough cleaning of the microtome blades between treatments of different paraffin blocks, aliquoting of all reagents, physical separation of
207
CELL CARCINOMA
TABLE 1 Clinical and Pathological Findings of Patients with Small Cell Carcinoma Case 44 99 03 63 12 43’ 88 41 14 13 80 82
Age 26 51 54 46 41 43 36 36 50 38 38 37
Outcome
Stage” IIB IIIA IIB IB IB IB IB IB IB IIIB IB IB
Pelvic lymph node metastases Left ovary and pelvic lymph node metastases Brain metastases Left pelvic lymph node metastases Vagina and left pelvic lymph node metastases Urinary bladder metastases Ovary and pelvic lymph node metastases Liver metastases
* Stage was determined at time of diagnosis. b Mixture of small cell carcinoma and adenosquamous cell carcinoma.
locations for pre- and post-PCR reactions, and meticulous laboratory techniques. Furthermore, all reagents were irradiated with ultraviolet light to inactivate any contaminating double-stranded DNA that may have been present
FIG. 1. Small cell carcinoma of the uterine cervix (hematoxylin and eosin,
X400).
PA0 ET AL.
208
before sample DNA was added and the PCR started [14]. Fifty nanograms of human DNA or one nanogram of Escherichia coli DNA was used as negative control, which always yielded negative results. Multiple reagent controls were also included in each PCR assay and gave negative results. Repeated DNA amplification assays of same specimens at different times produced the same results.
12345678
RESULTS Figure 2 illustrates the amplification of HPV types 16 and 18 DNA with nested PCR. The HPV type 16 positivity is indicated by the presence of a DNA of 422 bp when DNA prepared from either CaSki cells or a patient with cervical squamous carcinoma was amplified, respectively (Fig. 2, lanes 1 and 2). A DNA band of 477 bp appeared after amplification of HeLa cells or a patient with HPV type 18 infection, suggesting the presence of HPV type 18 DNA (Fig. 2, lanes 5 and 6). The lower limits of detection for both type 16 and type 18 HPV DNA by the nested PCR procedures are calculated to be less than 10 HPV viral genomes equivalent by amplifying either a serial dilutions of purified cloned HPV DNA of known concentrations or DNA prepared from HeLa and CaSki cells (data not shown). The presence of excess amounts of human or bacterial E. coli DNA does not adversely affect the efficiency of HPV amplification (data not shown). The authenticity of the DNA resulting from amplification is confirmed by two independent methods. First, the restriction endonuclease patterns of the amplified DNA are compared with and found to match those derived from the known HPV DNA sequences and location of restriction endonuclease sites. When the amplified 422bp DNA from HPV type 16 (Fig. 2, lane 2) is digested with DraI and the 477-bp DNA from HPV type 18 (Fig. 2, lane 6) is digested with XbaI, the original DNA bands
FIG. 2. Agarose gel electrophoresis of amplified HPV types 16 and 18 DNA. pGEM-3 DNA digested with a mixture of restriction endonucleases Hi&I, RsuI, and Sin1 was used as a size standard in the two outside lanes, and the sizes are (from top to bottom) 2645, 1605, 1198, 676, 517, 460, 396, 350, 222, 179, 126, 75, 65, 51, and 36 bp. Lanes 1 and 2 are the amplification of DNA of CaSki cells and cervical carcinoma tissue from a patient that contain HPV type 16. Lane 3 is amplified HPV type 16 DNA after digestion with endonuclease DmI. Lanes 5 and 6 are the amplification of DNA of HeLa cells and cervical carcinoma tissue from a patient that contain HPV type 18. Lane 7 is amplified HPV type 18 DNA after digestion with endonuclease XbaI. Lanes 4 and 8 are the amplifications of 50 ng of human DNA with HPV types 16 and 18 primers, respectively.
disappear and are replaced with DNA of 220 and 202 bp for HPV type 16 (Fig. 2, lane 3) and with DNA of 292 and 185 bp for HPV type 18 (Fig. 2, lane 7), respectively. Second, Southern blot hybridization analysis shows that DNA resulting from the amplification of HPV types 16 and 18, both before and after restriction endonuclease digestion, hybridizes with type-specific internal oligonucleotide probes (Fig. 3). None of the uterine cervix tissues from 12 patients with small cell carcinoma of the uterine cervix contained de-
TABLE 2 Nucleotide Sequences of Primers for HPV DNA Amplification by PolymeraseChain Reaction and Lengthsof ResultingDNA after Amplification HPV type 16
HPV type 18
Initial PCR (5’ to 3’) Anti-sense Sense Product length
CGTG’ITCTTGATGATCTGC GAACTGCAATGT’ITCAGGACC 445 bp
CTCGTGACATAGAAGGTCAACCGG CACACCACAATACTATGGCGCGCT 586 bp
Nested PCR (5’ to 3’) Anti-sense Sense Product length
GCAACAAGACATACATCGACCG CAATGTITCAGGACCCACAGG 422 bp
CAATGTTGCC’ITAGGTCCATGC CIACAAGCTACCTGATCTGTGC 477 bp
HPV AND SMALL
12345678
of the Southern blot hybridization test of FIG. 3. Autoradiograph amplified HPV type 16 and type 18 DNA with internal oligonucleotide probes. Arrangements of samples are the same as in Fig. 2. Membrane filters containing lanes 1 to 4 and 5 to 8 were hybridized to an oligonucleotide probe specific for HPV type 16 and type 18, respectively. Probe sequences are indicated under Materials and Methods. The lower band in lane 6 is of unknown origin and appears only in specimens from certain patients. The exposure time was 2 hr at room temperature without an intensifying screen.
tectable amounts of either HPV type 16, 18, 31, or 33 DNA as determined by the nested PCR method. On the other hand, 14 of the 15 (93.3%) uterine cervix tissues from same number of patients with squamous carcinoma contained HPV type 16 DNA and 6 of the same 15 (40.0%) tissues contained HPV type 18 DNA. Whereas 6 of these 15 squamous carcinoma patients had both types 16 and 18 DNA in their cervix tissue, another 8 of them had only type 16 DNA. One squamous carcinoma patient was free of both HPV types 16 and 18 DNA. Amplification of cervical small cell carcinoma and squamous carcinoma tissues with additional sets of primers for HPV types 16 and 18 yielded same results (data not shown). Furthermore, all 12 small cell carcinoma tissues could be amplified with human Ah or @globin gene primers, demonstrating the suitability of the DNA for amplification reaction (data not shown). DISCUSSION Since 1984, a total of 1154 cases of invasive cervical cancer greater than stage I have been staged at Chang Gung Memorial Hospital. After a thorough histopathological evaluation, 12 cases were determined to have met the histologic criteria for small cell carcinoma defined by Reagan and coworkers [l]. The 1.04% incidence rate of small cell carcinoma is comparable with those reported by others [4]. Cervical small cell carcinoma is defined as a tumor containing predominantly uniformly small cells with poorly defined cytoplasmic outlines and high nuclear cy-
CELL CARCINOMA
209
toplasmic ratio [4,15]. There are suggestionsthat cervical small cell carcinomas arise from endocervical argyrophil or multipotential neuroendocrine cells, which sets them apart from conventional neoplasia [16-181. Nuclear morphometry, epithelial markers, and neuropeptides have all been used to define cervical small cell carcinomas [4]. Although there is little doubt that small cell carcinomas represent highly aggressive tumors with ultrastructural, histochemical, and functional properties different from those of other carcinomas of the cervix, cervical small cell carcinoma is a difficult cell type to define and to differentiate from other types of cervical malignancies. During the last decade a large number of clinical, epidemiological, and experimental studies have suggested a role of HPV in the pathogenesis of cervical malignancies. Although some of the clinical and epidemiological studies have been criticized for a variety of reasons [19], by and large they have independently reached the similar conclusion that there is a strong association between the presence of specific types of HPV and the development of cervical malignancies. DNA-based technologies have been the methods of choice for the direct detection of HPV. The nested PCR method that we used in this study took the advantage of an additional set of primers that locate inside the initial primers and amplify the products resulting from the initial amplification. The nested PCR both increases the overall sensitivity and enhances the specificity of PCR by minimizing false-positive results [20,21]. Our data show that cervical small cell carcinoma probably has an additional fundamental difference from other types of cervical squamous carcinomas in that cervical small cell carcinoma does not seem to contain certain types of HPV that are found frequently in other cervical squamous carcinoma. If this finding can be substantiated by a larger number of cases, it could be construed to suggest that certain types of HPV, while associated in some yet unclear ways with the pathogenesis of cervical carcinoma, probably are not involved in the development of cervical small cell carcinoma. Since a high proportion of cervical carcinomas contain HPV of one type or another, the absence of these types of HPV can conceivably be used as an adjunct marker for differential diagnosis of cervical small cell carcinoma. With the ability to detect less than 10 HPV, the nested PCR is probably the most sensitive method currently available in HPV detection. In a recent report by Stoler et al. [22], HPV type 18 was detected in the majority of neuroendocrine-positive small cell carcinomas by the DNA in situ hybridization method. The difference between this and our finding may reflect a geographic difference in the associations between different types of HPV and specific histological types of cervical cancer. In summary, data from the current investigation seem
PA0 ET AL.
to indicate that certain types of HPV that are frequently found in cervical squamous carcinoma are probably either present in extremely small quantity (less than 1 copy per 15,000 cells) or, more likely, are not present in cervical small cell carcinoma cells at all. We believe that these results, when taken together with morphological and functional studies carried out by others, make it unlikely that HPV types 16, 18, 31, and 33 play any etiological role in the pathogenesis or development of small cell carcinoma of the uterine cervix.
lo,
11.
12.
ACKNOWLEDGMENTS This study was supported by Medical Research Grants CMRP-235 and CMRP-286 from Chang Gung Medical College, Taipei, Taiwan, Republic of China, awarded to C.C.P. The authors gratefully acknowledge the encouragements and support of Dr. Delon Wu and Dr. ChauHsiung Chang.
REFERENCES 1. Reagan, J. W., Hamonic, M. J., and Wentz, W. B. Analytical study of the cells in cervical squamous cell cancer, Lab. Invest. 6, 241250 (1957). 2. Ng, A. B., and Atkin N. B. Histological cell type and DNA value in the prognosis of squamous cell cancer of uterine cervix, Br. J. Cancer 28, 322-331 (1973). 3. Swan, D. S., and Roddick, J. W. A clinical-pathological correlation of cell type classification of cervical cancer. Am. J. Obstet. Gynecol.
13. I4 15.
16.
17.
18.
116,666-670(1973). 4. van Nagell, J. R., Powell, D. E., Gallion, H. H., Elliott, D. G., Donaldson, E. S., Carpenter, A. E., Higgins, R. V., Kryscio, R., and Pavlik, E. J. Small cell carcinoma of the uterine cervix, Cancer 62, 1586-1593 (1988). 5. Galloway, D. A., and McDougall, J. K. Human papillomaviruses and carcinomas, Adv. Virus Res. 37, 125-171 (1989). 6. Wright, T. C., and Richart, R. M. Role of human papillomavirus in the pathogenesis of genital tract warts and cancer, Gynecol. Oncol. 37, 151-164 (1990). 7. zur Hausen, H., and Schneider, A. The role of papillomaviruses in anogenital cancer, in Thepupovaviridae (N. P. Salzman and P. M. Howley, Eds.), Plenum, New York, pp. 245-263 (1987). 8. Shibata, D. K., Amheim, N., and Martin, J. Detection of human papilloma virus in paraffin-embedded tissue using the polymerase chain reaction, J. Exp. Med. 167,225-230(1988). 9. Pao, C. C., Lin, C. Y., Maa, J. S., Lai, C. H., Wu, S. Y., and
19.
20.
21.
22.
Soong, Y. K. Detection of human papillomavirus in cervicovaginal cells using polymerase chain reaction, J. Infect. Dis. 161,113-115 (1990). Pao, C. C., Lin, S. S., Lin, C. Y., Maa, J. S., Lai, C. H., and Hsieh, T. T. Identification of human papillomavirus in peripheral blood mononuclear cells by DNA amplification method, Am. J. Clin. Pathol, 95, 540-546 (1991). Lehn, H., Krieg, P., and Sauer, G. Papillomavirus genomes in human cervical tumors: Analysis of their transcriptional activity, Proc. Natl. Acad. Sci. USA 82, 5540-5544 (1985). Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Solis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources, Proc. Natl. Acad. Sci. USA 86, 6686-6690 (1989). Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 382-389 (1982). Sarkar, G., and Sommer, S. S. Shedding light on PCR contamination, Nuture 343, 27 (1990). Groben, P., Reddick, R., and Askin, F. The pathologic spectrum of small cell carcinoma of the cervix, Znt. J. Gynecof. Pathol. 4, 42-57 (1985). Albores-Saaverdra, J., Larraza, O., and Pourcell, S. Carcinoid of the uterine cervix: Additional observations on a new tumor entity, Cancer 38, 2328-2342 (1976). Pazdur, R., Bonomi, P., and Slayton, R. Neuroendocrine carcinoma of the cervix: Implications for staging and therapy, Gynecol. Oncol. 12, 120-128 (1981). Yamasaki, M., Tateishi, R., Hongo, J., Ozaki, Y., Inoue, M., and Ueda, G. Argyrophil small cell carcinomas of the uterine cervix, Znt. J. Gynecol. Pathol. 3, 146-152 (1984). Munoz, N., Bosch, X., and Kaldor, J. M. Does human papilIomavirus cause cervical cancer? The state of the epidemiological evidence, Br. J. Cancer 57, l-5 (1988). Albert, J., and Fenyo, E. M. Simple, sensitive and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers, J. C/in. Microbial. 28, 1560-1564 (1990). Garson, J. A., Tedder, R. S., Briggs, M., Tuke, P., Glazebrook, J. A., Turte, A., Parker, D., Barbara, J. A. J., Contreras, M., and Aloysius, S. Detection of hepatitis C viral sequences in blood donations by “nested” polymerase chain reaction and prediction of infectivity, Lancet 335, 1419-1422 (1990). Stoler, M. H., Mills, S. E., Gersell, D. J., and Walker, A. N. Small-cell neuroendocrine carcinoma of the cervix: A human papillomavirus type 18-associated cancer, Am. J. Surg. Puthof. 15, 2832 (1991).
ONCOLOGY
0,
206-210 (1991)
Human Papillomaviruses and Small Cell Carcinoma of the Uterine Cervix CHIA C. PAO,* CHIEH-YU LIN,* *Department
of Biochemistry,
Chang
YA-LI CHANG,*
CHIH-JEN TSENG,? AND SWEI HSUEH$
Gung Medical College, and Departments of ?Obstetrics and Gynecology Memorial Hospital, Taipei, Taiwan 33332, Republic of China
and $Pathology,
Chang
Gung
Received February 11, 1991
The in vitro DNA ampliOcationtechniqueof polymerasechain reaction was used to evaluate the possiblepresenceof human papillomavirus(HPV) in smallcell carcinomaof the uterine cervix. None of the 12 casesexaminedcontain detectableamounts of either HPV type 16, 18, 31, or 33 DNA. On the other hand, HPV types 16 and 18 DNA were found in 14 (93.3%) and 9 (60.0%) of 25 invasive cervical squamouscarcinomatissues.The resultsseemto suggestthat thesetypes of HPV are not present or are presentin extremely smallquantities in cervical smallcell carcinoma.Such an absenceof HPV DNA makesit unlikely that thesetypes of HPV play any etiologicalrole in the pathogenesis of cervical small cell carcinoma. 0 1991 Academic Press, Inc.
INTRODUCTION Small cell carcinomas of the uterine cervix, which make up approximately 1% of all invasive cervical cancers, are a heterologous group of tumors that are highly aggressive and tend to metastasize early to extrapelvic sites [l-4]. It has been recognized for many years that squamous cell carcinoma of the uterine cervix and its precursor lesions have many features characteristic of sexually transmitted diseases. An increasing number of reports have suggested that several types of human papillomaviruses (HPV) may play certain important and even etiologic roles in the pathogenesis of human genital tract cancer 15-71.
The current investigation aims to apply an extremely sensitive method, the polymerase chain reaction (PCR), to examine the possible presence of HPV in small cell carcinoma of the uterine cervix. MATERIALS
AND METHODS
Experimental protocol. Paraffin blocks of 12 documented cases of small cell carcinoma of the uterine cervix (11 small cell carcinoma and 1 with a mixture of small cell carcinoma and adenosquamous carcinoma) were ob-
tained from the archives of the Department of Pathology of Chang Gung Memorial Hospital (Fig. 1). Four 4-pm tissue sections were prepared from each of the 12 paraffin blocks. Tissue sections were also prepared from paraffin blocks of 15 age-matched squamous carcinoma patients for comparison purposes. Information regarding the 12 patients with small cell carcinoma of the uterine cervix is listed in Table 1. CaSki and HeLa cells, which contain HPV types 16 and 18, respectively, were obtained from American Type Culture Collection (Rockville, MD). PCR amplification. The presence of HPV was determined with the enzyme-based DNA amplification method on tissue sections directly without extracting the DNA first to minimize the chance of contamination during sample processing [8]. The procedures for the amplification and subsequent detection of HPV DNA were those that we have reported earlier [9-lo] with the following modifications to incorporate an additional round of “nested” amplification. For nested PCR, 2 ~1 of the initial amplified mixture was amplified following the same procedure in a freshly prepared loo-p1 reaction mixture containing the same components as those with initial PCR and the new set of nested primers. A genomic region either within or including the E6 gene of HPV was chosen to prepare all the primers and the probes because this region is almost always retained in the HPV DNA integrated in cancer tissues [ll]. The primers and lengths of resulting DNA after amplification of HPV types 16 and 18 are listed in Table 2. HPV type 16 was also analyzed with two additional sets of primers that amplify the E7 gene (297 bp, from 562 to 858 nt) and the Ll gene (587 bp, from 6533 to 7119 nt). Two additional sets of primers were also used to amplify the E6 gene (360 bp, from 91 to 450 nt) and the’E7 gene (87 bp, from 590 to 676 nt) of HPV type 18 DNA. Human Alu repeated DNA sequences were amplified with primers described by others [12]. Establishment of HPVpositivity.
206 0090-8258/91 $1.50 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form resewed.
After the nested am-
HPV AND SMALL
plification, one-tenth of the amplified reaction mixture was separated by electrophoresis in 2% agarose gel containing 0.5 pg/ml ethidium bromide and visually inspected under ultraviolet light for DNA bands of appropriate sizes. Authenticity of the amplified DNA was confirmed by restriction endonuclease pattern and by Southern blot DNA hybridization analyses with internal oligonucleotide probes [10,13]. The sequences of oligonucleotide probes for types 16 and 18 HPV DNA are (5’ to 3’ end) AGCTGCAAACAACTATACATGATATAATATTAGAATGTGT and AACTGAACAC’ITCACTGCAAGACATAGAAATAACCTGTGT, respectively. Precautions against contamination and false-positive results in PCR: Because of the exquisite amplification
power of the PCR procedures, precautionary measures were taken to minimize the possibility of sample-to-sample contaminations and PCR-product carryovers. These measures include wearing and frequent changing of disposable gloves during all procedures involving specimen handling and processing, thorough cleaning of the microtome blades between treatments of different paraffin blocks, aliquoting of all reagents, physical separation of
207
CELL CARCINOMA
TABLE 1 Clinical and Pathological Findings of Patients with Small Cell Carcinoma Case 44 99 03 63 12 43’ 88 41 14 13 80 82
Age 26 51 54 46 41 43 36 36 50 38 38 37
Outcome
Stage” IIB IIIA IIB IB IB IB IB IB IB IIIB IB IB
Pelvic lymph node metastases Left ovary and pelvic lymph node metastases Brain metastases Left pelvic lymph node metastases Vagina and left pelvic lymph node metastases Urinary bladder metastases Ovary and pelvic lymph node metastases Liver metastases
* Stage was determined at time of diagnosis. b Mixture of small cell carcinoma and adenosquamous cell carcinoma.
locations for pre- and post-PCR reactions, and meticulous laboratory techniques. Furthermore, all reagents were irradiated with ultraviolet light to inactivate any contaminating double-stranded DNA that may have been present
FIG. 1. Small cell carcinoma of the uterine cervix (hematoxylin and eosin,
X400).
PA0 ET AL.
208
before sample DNA was added and the PCR started [14]. Fifty nanograms of human DNA or one nanogram of Escherichia coli DNA was used as negative control, which always yielded negative results. Multiple reagent controls were also included in each PCR assay and gave negative results. Repeated DNA amplification assays of same specimens at different times produced the same results.
12345678
RESULTS Figure 2 illustrates the amplification of HPV types 16 and 18 DNA with nested PCR. The HPV type 16 positivity is indicated by the presence of a DNA of 422 bp when DNA prepared from either CaSki cells or a patient with cervical squamous carcinoma was amplified, respectively (Fig. 2, lanes 1 and 2). A DNA band of 477 bp appeared after amplification of HeLa cells or a patient with HPV type 18 infection, suggesting the presence of HPV type 18 DNA (Fig. 2, lanes 5 and 6). The lower limits of detection for both type 16 and type 18 HPV DNA by the nested PCR procedures are calculated to be less than 10 HPV viral genomes equivalent by amplifying either a serial dilutions of purified cloned HPV DNA of known concentrations or DNA prepared from HeLa and CaSki cells (data not shown). The presence of excess amounts of human or bacterial E. coli DNA does not adversely affect the efficiency of HPV amplification (data not shown). The authenticity of the DNA resulting from amplification is confirmed by two independent methods. First, the restriction endonuclease patterns of the amplified DNA are compared with and found to match those derived from the known HPV DNA sequences and location of restriction endonuclease sites. When the amplified 422bp DNA from HPV type 16 (Fig. 2, lane 2) is digested with DraI and the 477-bp DNA from HPV type 18 (Fig. 2, lane 6) is digested with XbaI, the original DNA bands
FIG. 2. Agarose gel electrophoresis of amplified HPV types 16 and 18 DNA. pGEM-3 DNA digested with a mixture of restriction endonucleases Hi&I, RsuI, and Sin1 was used as a size standard in the two outside lanes, and the sizes are (from top to bottom) 2645, 1605, 1198, 676, 517, 460, 396, 350, 222, 179, 126, 75, 65, 51, and 36 bp. Lanes 1 and 2 are the amplification of DNA of CaSki cells and cervical carcinoma tissue from a patient that contain HPV type 16. Lane 3 is amplified HPV type 16 DNA after digestion with endonuclease DmI. Lanes 5 and 6 are the amplification of DNA of HeLa cells and cervical carcinoma tissue from a patient that contain HPV type 18. Lane 7 is amplified HPV type 18 DNA after digestion with endonuclease XbaI. Lanes 4 and 8 are the amplifications of 50 ng of human DNA with HPV types 16 and 18 primers, respectively.
disappear and are replaced with DNA of 220 and 202 bp for HPV type 16 (Fig. 2, lane 3) and with DNA of 292 and 185 bp for HPV type 18 (Fig. 2, lane 7), respectively. Second, Southern blot hybridization analysis shows that DNA resulting from the amplification of HPV types 16 and 18, both before and after restriction endonuclease digestion, hybridizes with type-specific internal oligonucleotide probes (Fig. 3). None of the uterine cervix tissues from 12 patients with small cell carcinoma of the uterine cervix contained de-
TABLE 2 Nucleotide Sequences of Primers for HPV DNA Amplification by PolymeraseChain Reaction and Lengthsof ResultingDNA after Amplification HPV type 16
HPV type 18
Initial PCR (5’ to 3’) Anti-sense Sense Product length
CGTG’ITCTTGATGATCTGC GAACTGCAATGT’ITCAGGACC 445 bp
CTCGTGACATAGAAGGTCAACCGG CACACCACAATACTATGGCGCGCT 586 bp
Nested PCR (5’ to 3’) Anti-sense Sense Product length
GCAACAAGACATACATCGACCG CAATGTITCAGGACCCACAGG 422 bp
CAATGTTGCC’ITAGGTCCATGC CIACAAGCTACCTGATCTGTGC 477 bp
HPV AND SMALL
12345678
of the Southern blot hybridization test of FIG. 3. Autoradiograph amplified HPV type 16 and type 18 DNA with internal oligonucleotide probes. Arrangements of samples are the same as in Fig. 2. Membrane filters containing lanes 1 to 4 and 5 to 8 were hybridized to an oligonucleotide probe specific for HPV type 16 and type 18, respectively. Probe sequences are indicated under Materials and Methods. The lower band in lane 6 is of unknown origin and appears only in specimens from certain patients. The exposure time was 2 hr at room temperature without an intensifying screen.
tectable amounts of either HPV type 16, 18, 31, or 33 DNA as determined by the nested PCR method. On the other hand, 14 of the 15 (93.3%) uterine cervix tissues from same number of patients with squamous carcinoma contained HPV type 16 DNA and 6 of the same 15 (40.0%) tissues contained HPV type 18 DNA. Whereas 6 of these 15 squamous carcinoma patients had both types 16 and 18 DNA in their cervix tissue, another 8 of them had only type 16 DNA. One squamous carcinoma patient was free of both HPV types 16 and 18 DNA. Amplification of cervical small cell carcinoma and squamous carcinoma tissues with additional sets of primers for HPV types 16 and 18 yielded same results (data not shown). Furthermore, all 12 small cell carcinoma tissues could be amplified with human Ah or @globin gene primers, demonstrating the suitability of the DNA for amplification reaction (data not shown). DISCUSSION Since 1984, a total of 1154 cases of invasive cervical cancer greater than stage I have been staged at Chang Gung Memorial Hospital. After a thorough histopathological evaluation, 12 cases were determined to have met the histologic criteria for small cell carcinoma defined by Reagan and coworkers [l]. The 1.04% incidence rate of small cell carcinoma is comparable with those reported by others [4]. Cervical small cell carcinoma is defined as a tumor containing predominantly uniformly small cells with poorly defined cytoplasmic outlines and high nuclear cy-
CELL CARCINOMA
209
toplasmic ratio [4,15]. There are suggestionsthat cervical small cell carcinomas arise from endocervical argyrophil or multipotential neuroendocrine cells, which sets them apart from conventional neoplasia [16-181. Nuclear morphometry, epithelial markers, and neuropeptides have all been used to define cervical small cell carcinomas [4]. Although there is little doubt that small cell carcinomas represent highly aggressive tumors with ultrastructural, histochemical, and functional properties different from those of other carcinomas of the cervix, cervical small cell carcinoma is a difficult cell type to define and to differentiate from other types of cervical malignancies. During the last decade a large number of clinical, epidemiological, and experimental studies have suggested a role of HPV in the pathogenesis of cervical malignancies. Although some of the clinical and epidemiological studies have been criticized for a variety of reasons [19], by and large they have independently reached the similar conclusion that there is a strong association between the presence of specific types of HPV and the development of cervical malignancies. DNA-based technologies have been the methods of choice for the direct detection of HPV. The nested PCR method that we used in this study took the advantage of an additional set of primers that locate inside the initial primers and amplify the products resulting from the initial amplification. The nested PCR both increases the overall sensitivity and enhances the specificity of PCR by minimizing false-positive results [20,21]. Our data show that cervical small cell carcinoma probably has an additional fundamental difference from other types of cervical squamous carcinomas in that cervical small cell carcinoma does not seem to contain certain types of HPV that are found frequently in other cervical squamous carcinoma. If this finding can be substantiated by a larger number of cases, it could be construed to suggest that certain types of HPV, while associated in some yet unclear ways with the pathogenesis of cervical carcinoma, probably are not involved in the development of cervical small cell carcinoma. Since a high proportion of cervical carcinomas contain HPV of one type or another, the absence of these types of HPV can conceivably be used as an adjunct marker for differential diagnosis of cervical small cell carcinoma. With the ability to detect less than 10 HPV, the nested PCR is probably the most sensitive method currently available in HPV detection. In a recent report by Stoler et al. [22], HPV type 18 was detected in the majority of neuroendocrine-positive small cell carcinomas by the DNA in situ hybridization method. The difference between this and our finding may reflect a geographic difference in the associations between different types of HPV and specific histological types of cervical cancer. In summary, data from the current investigation seem
PA0 ET AL.
to indicate that certain types of HPV that are frequently found in cervical squamous carcinoma are probably either present in extremely small quantity (less than 1 copy per 15,000 cells) or, more likely, are not present in cervical small cell carcinoma cells at all. We believe that these results, when taken together with morphological and functional studies carried out by others, make it unlikely that HPV types 16, 18, 31, and 33 play any etiological role in the pathogenesis or development of small cell carcinoma of the uterine cervix.
lo,
11.
12.
ACKNOWLEDGMENTS This study was supported by Medical Research Grants CMRP-235 and CMRP-286 from Chang Gung Medical College, Taipei, Taiwan, Republic of China, awarded to C.C.P. The authors gratefully acknowledge the encouragements and support of Dr. Delon Wu and Dr. ChauHsiung Chang.
REFERENCES 1. Reagan, J. W., Hamonic, M. J., and Wentz, W. B. Analytical study of the cells in cervical squamous cell cancer, Lab. Invest. 6, 241250 (1957). 2. Ng, A. B., and Atkin N. B. Histological cell type and DNA value in the prognosis of squamous cell cancer of uterine cervix, Br. J. Cancer 28, 322-331 (1973). 3. Swan, D. S., and Roddick, J. W. A clinical-pathological correlation of cell type classification of cervical cancer. Am. J. Obstet. Gynecol.
13. I4 15.
16.
17.
18.
116,666-670(1973). 4. van Nagell, J. R., Powell, D. E., Gallion, H. H., Elliott, D. G., Donaldson, E. S., Carpenter, A. E., Higgins, R. V., Kryscio, R., and Pavlik, E. J. Small cell carcinoma of the uterine cervix, Cancer 62, 1586-1593 (1988). 5. Galloway, D. A., and McDougall, J. K. Human papillomaviruses and carcinomas, Adv. Virus Res. 37, 125-171 (1989). 6. Wright, T. C., and Richart, R. M. Role of human papillomavirus in the pathogenesis of genital tract warts and cancer, Gynecol. Oncol. 37, 151-164 (1990). 7. zur Hausen, H., and Schneider, A. The role of papillomaviruses in anogenital cancer, in Thepupovaviridae (N. P. Salzman and P. M. Howley, Eds.), Plenum, New York, pp. 245-263 (1987). 8. Shibata, D. K., Amheim, N., and Martin, J. Detection of human papilloma virus in paraffin-embedded tissue using the polymerase chain reaction, J. Exp. Med. 167,225-230(1988). 9. Pao, C. C., Lin, C. Y., Maa, J. S., Lai, C. H., Wu, S. Y., and
19.
20.
21.
22.
Soong, Y. K. Detection of human papillomavirus in cervicovaginal cells using polymerase chain reaction, J. Infect. Dis. 161,113-115 (1990). Pao, C. C., Lin, S. S., Lin, C. Y., Maa, J. S., Lai, C. H., and Hsieh, T. T. Identification of human papillomavirus in peripheral blood mononuclear cells by DNA amplification method, Am. J. Clin. Pathol, 95, 540-546 (1991). Lehn, H., Krieg, P., and Sauer, G. Papillomavirus genomes in human cervical tumors: Analysis of their transcriptional activity, Proc. Natl. Acad. Sci. USA 82, 5540-5544 (1985). Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Solis, R., Webster, T. D., Ledbetter, D. H., and Caskey, C. T. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources, Proc. Natl. Acad. Sci. USA 86, 6686-6690 (1989). Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, pp. 382-389 (1982). Sarkar, G., and Sommer, S. S. Shedding light on PCR contamination, Nuture 343, 27 (1990). Groben, P., Reddick, R., and Askin, F. The pathologic spectrum of small cell carcinoma of the cervix, Znt. J. Gynecof. Pathol. 4, 42-57 (1985). Albores-Saaverdra, J., Larraza, O., and Pourcell, S. Carcinoid of the uterine cervix: Additional observations on a new tumor entity, Cancer 38, 2328-2342 (1976). Pazdur, R., Bonomi, P., and Slayton, R. Neuroendocrine carcinoma of the cervix: Implications for staging and therapy, Gynecol. Oncol. 12, 120-128 (1981). Yamasaki, M., Tateishi, R., Hongo, J., Ozaki, Y., Inoue, M., and Ueda, G. Argyrophil small cell carcinomas of the uterine cervix, Znt. J. Gynecol. Pathol. 3, 146-152 (1984). Munoz, N., Bosch, X., and Kaldor, J. M. Does human papilIomavirus cause cervical cancer? The state of the epidemiological evidence, Br. J. Cancer 57, l-5 (1988). Albert, J., and Fenyo, E. M. Simple, sensitive and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers, J. C/in. Microbial. 28, 1560-1564 (1990). Garson, J. A., Tedder, R. S., Briggs, M., Tuke, P., Glazebrook, J. A., Turte, A., Parker, D., Barbara, J. A. J., Contreras, M., and Aloysius, S. Detection of hepatitis C viral sequences in blood donations by “nested” polymerase chain reaction and prediction of infectivity, Lancet 335, 1419-1422 (1990). Stoler, M. H., Mills, S. E., Gersell, D. J., and Walker, A. N. Small-cell neuroendocrine carcinoma of the cervix: A human papillomavirus type 18-associated cancer, Am. J. Surg. Puthof. 15, 2832 (1991).
