AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 30, Number 00, 2015 ª Mary Ann Liebert, Inc. DOI: 10.1089/aid.2014.0291
Human Immunodeficiency Virus Coinfection with Hepatitis B Virus Leads to a Decrease in Extracellular and Intracellular Hepatitis B Antigen Wei Pan,1 Zuoqiao Wu,1 Shuwen Wu,1 Deyin Guo,1 Xiaoyan Gong,2 and Tien Po1,3
Abstract
Chronic hepatitis B virus (HBV) infection could cause severe liver disease including cirrhosis, hepatocellular carcinoma, and end-stage liver failure in HIV-positive individuals. The available data from clinical studies suggest that HIV infection modulates the HBV-specific T cell response. However, the virological and molecular aspects of HIV–HBV coinfection are currently poorly understood due to the lack of appropriate model systems. In this study, the effect of HIV infection on the life cycle of HBV was explored using an in vitro model system. The present data show that the extracellular and intracellular hepatitis B surface antigen (HBsAg) and e antigen (HBeAg) decrease significantly in HepG2 cells cotransfected with HIV NL4-3 and pHBV1.3 as compared to those cells transfected only with pHBV1.3. Moreover, a significant decrease in HBV DNA and mRNA expression was also observed in the cotransfected cells. HIV Rev protein, an RNA-bound regulatory protein, could significantly decrease the expression levels of extracellular and intracellular HBsAg and HBeAg by mediating the expression of HBV mRNA in cells cotransfected with plasmids containing HIV-1 Rev and pHBV1.3. Further experiments demonstrate that HIV Rev manipulated neither the promoters of HBV nor the nuclear export of HBV mRNA. These results from the in vitro model system might provide clues to further understand the rapid progression of liver disease in HIV–HBV-coinfected patients. the precore/core region of the HBV genome has been associated with higher HBV DNA in HIV–HBV-coinfected individuals and might directly alter pathogenesis.12 In addition, the HBV-specific T cell immune response modulated by HIV might alter the cytokine environment and affect liver disease.13,14 HIV-related microbial translocation, immune activation, and increased hepatic stellate cell activation may underlie the mechanisms for accelerating liver disease progression.15,16 However, few studies have investigated the direct interaction between HIV and HBV in vitro. One study reported that an increase in intracellular hepatitis B surface antigen (HBsAg) in stable human hepatic cell lines expressing HBV (Hep3B and AD38 cells) was observed when VSV-NLNE pseudotyped HIV infected these cells.17 But these results are based on the HBV infection preceding the HIV infection and this model system cannot completely explain the observations that result when the HIV infection precedes the HBV infection or when HIV and HBV coinfection occur synchronously.18 In vivo, HIV can infect multiple cells in the liver, including hepatocytes and Kupffer cells.19 Moreover, the HIV DNA,
Introduction
H
uman immunodeficiency virus type 1 (HIV-1) and hepatitis B virus (HBV) infections are two major global public health problems. Coinfection with both HIV and HBV is common due to shared transmission routes. Up to 90% of HIV-infected patients have evidence of HBV exposure,1,2 while approximately 10–20% of HIV-positive individuals worldwide are coinfected with chronic HBV.3,4 Data from clinical studies indicate that HIV–HBV coinfection is associated with higher levels of HBV DNA,5–7 lower alanine aminotransferase (ALT) levels,5 a lower rate of HBV e antigen clearance,6,7 a higher risk for loss of protective antibody to HBV surface antigen, and subsequent reactivation of HBV.8,9 Of all these negative consequences, the most important is that HIV appears to accelerate the progression of HBV-related liver disease, resulting in cirrhosis10 and hepatocellular carcinoma.11 Clinical evidence might provide several possible reasons for this increased liver-related mortality in HIV–HBV coinfection compared with either infection alone. A mutation in 1 2 3
College of Life Sciences, Wuhan University, Wuhan, China. College of Chemistry and Molecular Sciences, Wuhan University, Wuhan, China. Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.
1
2
RNA, and capsid antigen (p24) can be detected in hepatocytes.20,21 In vitro, HIV-1 coreceptor CXCR4 can be expressed at the surface of hepatocytes22; in addition, HIV can enter into cultured hepatocytes (HepG2 and Huh7.5) through endocytosis mediated by ICAM-1/LFA-1 molecules, and the infectivity of HIV-1 can persist for at least 3 days.23 In this study, we aim to determine and define further the in vitro effects of HIV infection on HBV replication. The effects of HIV infection on the HBV replication cycle including HBV mRNA transcription, DNA replication, and protein translation were explored in human hepatic cells in vitro. Furthermore, the mechanism of inhibition of HIV Rev on HBV mRNA expression was explored. Results from the present study provide clues to understanding the mechanism of interaction between the two viruses and rapid progression of liver disease in HIV–HBV-coinfected patients. Materials and Methods Cell lines
The human hepatic cell line (HepG2) and nonhepatic cell lines (293T and TZM-bl) were cultured at 37C in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Invitrogen, Grand Island, NY). The medium was supplemented with 10% heat-inactivated fetal bovine serum (HyClone, Thermo Scientific, Beijing, China), 100 U/ml penicillin G, and 100 U/ml streptomycin. HIV viral stocks
VSV-G pseudotyped HIV-1 virus (VSV-HIV) with the luciferase gene in place of nef was produced by cotransfecting 293T cells with plasmids containing VSV-G and pNL4-3E - R - -luc. After 48 h, viral stocks were collected from culture supernatants and stored at - 70C until use. Plasmids construction
The sequences of HIV-1 that regulate proteins (Tat and Rev) were amplified by polymerase chain reaction (PCR) from the pNL4-3 clone of HIV-1 (GenBank accession no. AF324493), then inserted into a SalI and NotI digested pRK vector (provided by Professor H.B. Shu, Wuhan University). The pRK vector has an N-terminal tag of FLAG under the control of the CMV promoter.24 HBsAg (S, nt 157–nt 834) or the recombinant gene (SPRE, nt 157–nt 1,684) containing HBsAg and the region of posttranscriptional regulatory element (PRE, nt 1,151–nt 1,684)25,26 was amplified from the plasmid pHBV1.3 (provided by Professor Tien Po, Institute of Microbiology, Beijing), then cloned into the pRK vector.24 The pre-S1 (nt 2,219–2,780) or pre-S2/S promoter (nt 2,809–3,180) of HBV was cloned into the pGL3-Basic vector (provided by Professor D.Y. Guo, Wuhan University) to construct the pGL3-SPI and pGL3-SPII plasmids. The pGL3basic vector lacked eukaryotic promoter and enhancer sequences, thus the expression of luciferase depended on the function of the inserted promoter upstream from the luc + gene. HBsAg and HBeAg quantification
HepG2 or 293T cells were infected with or without VSVHIV pseudotyped virus, HIV-1 infection clone pNL4-3, and
PAN ET AL.
HIV individual proteins; subsequently cells were transfected with a pHBV1.3 plasmid. After transfection, the cell culture supernatants were collected directly to analyze extracellular HBsAg or HBeAg expression levels using an enzyme-linked immunosorbent assay (ELISA) assay. To analyze intracellular HBsAg or HBeAg expression levels, the cells were resuspended in 200 ll of phosphate-buffered saline (PBS) buffer per well and frozen and thawed twice in liquid nitrogen, and then the cell-free supernatants were isolated after centrifugation at 12,000 rpm for 1 min and subjected to an ELISA assay. HBsAg and HBeAg levels were quantified using the ELISA Assay Kit (KeHua Shanghai, China) according to the manufacturer’s instructions. HBV cccDNA and RNA quantification using real-time PCR
Seventy-two hours after transfection (293T after 24 h), cells were harvested for isolation of the total RNA and DNA using a DNA/RNA isolation kit (Tiangen Biotech, Beijing, China). Samples were stored at - 70C until further analysis. RNA samples were treated with Ambion Turbo DNA-free DNase I (Ambion, Austin, TX) at 37C for 30 min to remove residual DNA. cDNA was prepared from 2 lg of RNA using oligo(dT), M-MLV reverse transcriptase (Promega, Madison, WI), and RNasin Ribonuclease Inhibitor (Biostar International, Canada) in a total volume of 25 ll for 60 min at 37C. DNA samples extracted from the cells per well were dissolved in 30 ll of deionized water. Then 5 ll of the DNA sample was digested with Plasmid-Safe ATP-dependent DNase (Epicentre Technologies, Madison, WI) in a 50 ll reaction mixture at 37C for 1 h, and the mixture was incubated at 70C for 30 min to inactivate the enzyme. Two forward primers CCC1 and DRF1 and one reverse primer CCC227 were used at a ratio of 1:1:2 in 20 ll of reaction volume to amplify HBV DNA. Then 10 ll of the DNA sample without treatment with Plasmid-Safe ATP-dependent DNase was diluted in 100 ll for the detection of b-globin. DNAStar version 7 was used to design primers for realtime PCR applications (shown in Table 1). For each reaction, samples were mixed with the Thunderbird SYBR qPCR Mix (TOYOBO Co., Osaka, Japan), and the final primer concentrations were 0.3 lM. Amplifications were performed in a real-time PCR system (ABI 7300, Applied Biosystems Inc., USA). Conditions were 1 cycle of 95C for 5 min, followed by 40 cycles of 95C for 15 s, 60C for 15 s, and 72C for 45 s. The relative quantification of HBsAg mRNA and DNA replicative intermediates from HBV single infection and HIV-HBV dual infection groups was normalized to GAPDH and b-globin, respectively, using the 2 - DDCt method. Northern blot analysis
Seventy-two hours after transfection (293T after 24 h), total RNA was extracted from cells using the TRIzol reagent (Invitrogen, USA). Then 20 lg of total RNA was separated using electrophoresis in 1% agarose gel and transferred to a Hybond N + nylon membrane (GE Healthcare) following standard protocols. The probe labeling and sample detection were performed following the manufacturer’s instructions using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Germany).
HIV-1 LEADS TO DECREASE IN HBV PROTEINS
3
Table 1. Sequences of Primers Selected for Real-Time Polymerase Chain Reaction Assays of Hepatitis B Virus Hepatitis B Surface Antigen mRNA and cccDNA Primers HBsAg_RT_F HBsAg_RT_R GAPDH_RT_F GAPDH_RT_R b-Globin_F b-Globin_R HBsAg_Northern_F HBsAg_Northern_R GAPDH_Northern_F GAPDH_Northern_R SP I_F SP I_R SP II_F SP II_R
Sequence (5¢*3¢)
Position in HBV genome
CCGCCTCCTGCCTCTACCAATC GGAGCCACCAGCAGGGAAATACA CCTGTTCGACAGTCAGCCG CGACCAAAATCCGTTGACTCC CTTGGGTTTCTGATAGGCAC CTTAGGGTTGCCCATAACAG TGCTCGTGTTACAGGCGGGG GCCAGACAGTGGGGGAAAGCC TCCCGCTTCGCTCTCTGCTCC CAGTTTCCCGGAGGGGCCATC CCCTCGAGCTTGTCTCACTTTTGGAA CCAAGCTTATAATATACCCGCCTTCC CCCTCGAGATTTTGTGGGTCACCATA CCAAGCTTACTGCATGGCCTGAGGAT
3,088–3,109 48–70
189–208 708–728 2,217–2,236 2,763–2,778 2,807–2,826 3,162–3,178
HBV, hepatitis B virus; HBsAg, hepatitis B virus surface antigen.
MTT assay
Cell viability was determined using the 3-(4,5)-dimethylthiazol(2-y1)-3,5-diphenyltetrazolium bromide (MTT) assay. Cells were seeded in 96-well plates and then infected with HIV virus or transfected with different plasmids at 50% confluence. After 72 h, the culture medium was removed and 0.1 ml MTT solution (final concentration: 0.5 mg/ml; Sigma) was added. The cells were incubated at 37C for 4 h, and then the medium was replaced by 0.1 ml of the triple Formanza
FIG. 1. The changes in extracellular hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) expression at different time points in HepG2 cells coinfected with VSV-G pseudotyped HIV-1 virus (VSV-HIV) and pHBV1.3. HepG2 cells were seeded in 24-well plates and incubated for 24 h at 37C. The cells were infected with or without HIV pseudotyped virus VSV-HIV 2 h prior to transfection. The cells were then washed three times by phosphate-buffered saline (PBS) and transfected with 0.5 lg of pHBV1.3 in each well using lipofectamine 2000 reagent (Invitrogen, USA). HepG2 cells transfected with the pUC18 empty vector were used as a negative control. At 48, 72, and 96 h posttransfection, the supernatants were collected for further analysis. The ratio of samples/negative (S/N) is represented by the absorbance of samples at OD 450 nm divided by that of the negative control provided by the enzyme-linked immunosorbent assay (ELISA) kit, and was referred to as HBsAg or HBeAg expression levels. The extracellular HBsAg (A) or HBeAg (B) expression level is shown on the y-axis (**p < 0.01).
solution [10% sodium dodecyl sulfate (SDS), 0.012 mol/liter HCl, 5% isobutyl alcohol]. The plates were agitated and incubated at 37C for 2*4 h and the optical density of the solution in the wells was measured at 570 nm on a photometer, with a wavelength of 655 nm as a reference. Statistical analysis
Two-way analysis of variance was used to compare differences between the HBV single infection and HIV-HBV
4
PAN ET AL.
FIG. 2. The change of hepatitis B virus (HBV) replication in NL4-3 and pHBV1.3 cotransfected HepG2 cells. HepG2 cells were cotransfected with or without 0.5 lg of HIV NL4-3 and 0.5 lg of pHBV1.3. HepG2 cells transfected with 1 lg of pUC18 empty vector were used as negative control. At 48, 72, and 96 h posttransfection, the supernatants were collected for an ELISA assay, and the cells were collected for quantifying HBV cccDNA and mRNA. The ratio of samples/negative (S/N) is represented by the absorbance of samples at OD 450 nm divided by that of the negative control provided by the ELISA kit and was used to characterize the expression level of HBsAg or HBeAg. The extracellular HBsAg (A) or HBeAg (B) expression level is shown on the y-axis (**p < 0.01). (C) The expression of HBV cccDNA in the pHBV1.3 only transfected cells (black bar) or HIV NL4-3/ pHBV1.3 cotransfected cells (gray bar). The cccDNA values were normalized to that of b-globin, and the fold change of HBV DNA is shown on the y-axis (**p < 0.01). (D) The expression of HBV mRNA in the pHBV1.3 only transfected cells (black bar) or HIV NL4-3/ pHBV1.3 cotransfected cells (gray bar). The HBV mRNA values were normalized to that of GAPDH, and the fold change of HBV mRNA is shown on the y-axis (**p < 0.01).
dual infection groups using SPSS version 16.0 (Chicago, IL). A p value of < 0.05 was considered significant. Results Decrease of HBsAg and HBeAg in VSV-HIV-infected HepG2 cells transfected with pHBV1.3
HIV has been shown to infect multiple cells in the liver including hepatocytes19 and hepatic cell lines (HepG2, Huh7) in
in vitro systems.15 To determine the effect of HIV infection on HBV replication in vitro, the HepG2 cells were infected with either HIV-1 NL4-3 or HIV-1IIIB, and then the cells were transfected with pHBV1.3. Although the extracellular HBsAg slightly decreased in HIV/pHBV1.3 dual-infected cells, there was no significant difference between the single HBV infection group and the HIV–HBV dual infection group (data not shown). To exclude the low infectivity part of the HIV virus,17 HepG2 cells were infected with VSV-G pseudotyped HIV
HIV-1 LEADS TO DECREASE IN HBV PROTEINS
virus VSV-HIV. The cells were then transfected with pHBV1.3. At 48, 72, and 96 h posttransfection, cell culture supernatants were collected to check the expression of the secreted HBV proteins. The viability of HepG2 cells infected by the amount of VSV-HIV was checked by the MTT assay; the results showed that no change in cells viability was observed upon HIV infection. As shown in Fig. 1A, the extracellular HBsAg has a significant decrease in HepG2 cells compared to the mockinfected controls 72 h and 96 h after transfection. The extracellular HBeAg also has a significant decrease 96 h after transfection (Fig. 1B). The extracellular HBsAg was not sufficient to measure at 24 h posttransfection. The change of HBV replication in NL4-3 and pHBV1.3 cotransfected HepG2 cells
In this study, the results from Fig. 1 show that the pseudotyped virus VSV-HIV infection decreased extracellular HBsAg and HBeAg in HepG2 cells transfected with pHBV1.3. Considering that VSV-HIV was one cycle of replication in HepG2 cells, HepG2 cells were cotransfected with HIV pNL4-3 and pHBV1.3 plasmids as described in Materials and Methods. As shown in Fig. 2, the extracellular HBsAg decreased significantly in HIV pNL4-3/pHBV1.3 cotransfected HepG2 cells compared to pHBV1.3 single transfected cells at 48, 72, and 96 h after transfection (Fig. 2A). Similarly, extracellular HBeAg also had a significant decrease at 72 and 96 h after transfection (Fig. 2B). The MTT assay was used to exclude the toxicity of HIV NL4-3 or
5
pHBV1.3 plasmids, and no difference was observed in cell viability between the test and mock groups. To explore the effect of HIV infection on the replication and transcription steps of HBV in vitro, HBV mRNA and cccDNA samples were isolated from transfected cells and were quantified by real-time PCR at 48, 72, and 96 h after transfection. In the cotransfection group, HBV cccDNA decreased significantly at 48, 72, and 96 h after transfection as compared to the single transfection group (Fig. 2C). Moreover, HBV mRNA significantly decreased at 72 and 96 h posttransfection (Fig. 2D). These results indicated that HIV NL4-3 affected the expression of HBsAg and HBeAg by influencing both the replication of the HBV genome cccDNA and the transcription of HBV mRNA. Decrease of HBsAg and HBeAg in HIV Rev/pHBV1.3 cotransfected HepG2 cells and 293T cells
HIV proteins Tat and Rev are regarded as regulatory elements and RNA-bound proteins among the nine HIV proteins. According to the analysis illustrated in Fig. 2, HIV NL4-3 inhibited the replication of HBV cccDNA and the transcription of HBV mRNA in HepG2 cells. To investigate whether Tat and Rev contributed to this inhibitory effect, the HepG2 cells were cotransfected with plasmids containing HIV Tat or Rev and pHBV1.3. As shown in Fig. 3A and B, HIV Rev decreased extracellular and intracellular HBsAg (Fig. 3A) and HBeAg (Fig. 3B) expression in HepG2 cells cotransfected with HIV Rev and pHBV1.3 as compared to only pHBV1.3 transfected cells. However, HIV Tat did not
FIG. 3. The changes of extracellular and intracellular HBsAg and HBeAg expression in cells cotransfected with HIV Tat or Rev and pHBV1.3. HepG2 and 293T cells were transfected with or without individual HIV proteins and pHBV1.3. At 72 h after transfection (24 h for 293T cells), the supernatants and cells were collected for an ELISA assay. (A, B) The expression levels of HBsAg (A) and HBeAg (B) in HepG2 cells. (C, D) The expression levels of HBsAg (C) and HBeAg (D) in 293T cells. The black bar shows the extracellular HBsAg or HBeAg and the gray bar shows the intracellular HBsAg and HBeAg. The pRK group represents cells transfected with only pHBV1.3 and the pRK empty vector and was used as negative control. The individual HIV protein groups represent cells cotransfected with individual HIV proteins and pHBV1.3, and the PUC group represents cells transfected with pUC18 and pRK empty vectors (*p < 0.05, **p < 0.01).
6
PAN ET AL.
FIG. 4. Changes of HBV cccDNA and mRNA levels in PRK-REV and pHBV1.3 cotransfected cells. HepG2 and 293T cells were transfected with or without PRK-REV and pHBV1.3. After transfection, the cells were collected for real-time PCR. (A) The expression of HBV cccDNA in the pHBV1.3 only transfected cells (black bar) or PRK-REV/pHBV1.3 cotransfected cells (gray bar). The values of HBV cccDNA were normalized to that of b-globin, and the fold change is shown on the y-axis. (B) The expression of HBV mRNA in the pHBV1.3 only transfected cells (black bar) or PRK-REV/pHBV1.3 cotransfected cells (gray bar). The values of HBV mRNA were normalized to that of GAPDH, and the fold change is shown on the y-axis (*p < 0.05, **p < 0.01). (C) 293T and HepG2 cells were transfected with either pHBV1.3 alone or plasmids containing PRK-REV and pHBV1.3. Then 72 h after transfection (293T cell after 24 h), the cells were collected to isolate RNA for Northern blot analysis as described in Materials and Methods. A total RNA of 20 lg was loaded in each lane.
affect the expression of extracellular and intracellular HBsAg (Fig. 3A) and HBeAg (Fig. 3B). No change of cell viability was observed in the MTT assay. To investigate whether the effect of HIV proteins on HBsAg expression had a tropism for hepatic cells, 293T cells were cotransfected with plasmids containing individual HIV proteins and pHBV1.3. Both HIV Rev and Tat significantly decreased intracellular and extracellular HBeAg expression in 293 T cells (Fig. 3D). In addition, both HIV Rev and Tat significantly decreased intracellular HBsAg expression, but the two HIV proteins did not affect extracellular HBsAg expression in 293T cells (Fig. 3C). These results suggest that HIV Rev affected HBsAg and HBeAg expression levels re-
gardless of cell tropism; however, HIV Tat could affect HBsAg and HBeAg expression in 293 T cells rather than in HepG2 cells. Effect of HIV-1 Rev on the cccDNA and mRNA expression of HBV in different cells
To determine the effect of HIV Rev on the replication of HBV in vitro, the HBV cccDNA was isolated and quantified using real-time PCR. The results indicate that the amount of HBV cccDNA in HepG2 and 293T cells showed no significant difference between the single HBV and HIV Rev/HBV cotransfection groups (Fig. 4A).
HIV-1 LEADS TO DECREASE IN HBV PROTEINS
At the same time, the expression of HBV mRNA was measured using real-time PCR and Northern blot. As shown in Fig. 4B and C, HBV mRNA decreased in the HIV Rev/ pHBV1.3 cotransfection group in both the hepatic cell (HepG2) and nonhepatic (293T) cell lines as compared to the pHBV1.3 single transfected cells. Effect of HIV-1 Rev on the posttranscriptional process of HBsAg mRNA
The plasmid pHBV1.3 was constructed by inserting HBV 1.3 · into the genomes of the pUC18 vector. This plasmid could produce pgRNA transcription as well as the other three expression transcriptions driving the HBV intrinsic promoter. The results (Fig. 4) suggest that HIV Rev downregulates HBV mRNA in HepG2 and 293T cells. To determine whether this inhibition occurs transcriptionally, the recombinant plasmid pGL3-SPI or pGL3-SPII containing the pre-S1 or pre-S2/S promoter of HBV was transfected into cells (HepG2 and 293T) with or without PRK-REV. However, there was no significant difference between the pGL3-SPI/pGL3-SPII and PRK-REV cotransfection and pGL3-SPI/pGL3-SPII single transfection groups, which indicates that HIV Rev could not manipulate the pre-S1 and pre-S2/S promoters of HBV (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/aid). Since HIV Rev did not inhibit HBV mRNA expression transcriptionally, we hypothesized that the HIV-1 Rev protein induced the decrease of HBV mRNA posttranscriptionally. It was previously known that HIV Rev could bind to a cis-acting RNA element known as the Rev-responsive element (RRE),
7
thus promoting the nuclear export of RNAs. A similar element (posttranscriptional regulatory element, PRE) in hepatitis B virus (HBV) has been identified.25,28 Similar to the Rev-RRE system in HIV, the HBV PRE can mediate the nuclear export of viral pre-S/S RNAs.29 In addition, viral pre-S/S RNAs lacking the PRE fail to translocate to the cytoplasm and degrade in the nucleus via a mechanism that remains elusive. HepG2 or 293T cells were cotransfected with PRK-REV and S-PRE/S; meanwhile, cells cotransfected with pRK vector and S-PRE/S functioned as the control groups. As shown in Fig. 5, the intracellular and extracellular HBsAg levels increased in cells (HepG2 or 293T) transfected with SPRE as compared to cells transfected with S. These results were consistent with previous studies,28,29 revealing that HBV PRE could facilitate the transport and utilization of HBV transcripts regardless of the presence of PRK-REV. No significant differences were observed between control groups and cells cotransfected with S-PRE/S and PRK-REV plasmids, which indicates that HIV-1 Rev cannot interact with HBV PRE directly and thus affect the nuclear export of HBV mRNA. Taken together, HIV Rev decreased HBV mRNA expression in HepG2 or 293T cells (Fig. 4), and this inhibition effect did not occur in either transcriptional or posttranscriptional modulation of the HBV RNA (Fig. 5), suggesting that HIV Rev might affect the degradation of the HBV mRNA. Discussion
Coinfection with HBV and HIV remains a public health problem, due to the higher incidence of hepatocellular
FIG. 5. The effect of PRK-REV on HBV PRE in HepG2 and 293T cells. Cells were transfected with either S-PRE/S alone or plasmids containing S-PRE/S and a different amount of PRK-REV; the amount of plasmid transfected in each well was kept constant. Then 72 h posttransfection (293T for 24 h) supernatant and cells were collected for ELISA assay. The black bars show the HBsAg expression levels in 293T (A, B) and HepG2 (C, D) cells transfected with S-PRE and a different amount of PRK-REV; the gray bars show the HBsAg expression levels in cells cotransfected with S and different amounts of PRK-REV. The NC group represents cells transfected with the pRK empty vector. The y-axis shows the expression levels of intracellular or extracellular HBsAg.
8
carcinoma and an excess of liver-related mortality among coinfected individuals as compared to single HBV or HIV infections.30 An investigation of liver-related death among HIV-infected patients in 2005 compared to those in 2000 demonstrated that the rate of liver-related death increased from 13.4% (in 2000) to 15.4% (in 2005), and hepatocellular carcinoma among those liver-related deaths increased from 15% to 25%.31 Although the clinical challenge posed by HIV-HBV coinfections is important, the virological and molecular aspects of this coinfection are poorly understood due to a lack of appropriate model systems. In this study, the results suggest that the decrease of secreted HBV proteins might be due to the decreased expression of HBV mRNA in HepG2 cells cotransfected with HIV NL4-3 and pHBV1.3 plasmids. HIV Rev, an RNA-bound regulatory protein, decreased the expression of HBV mRNA in HepG2 and 293T cells in this study, suggesting that the interaction between HIV Rev and HBV mRNA was host cell independent. We then sought to define how the HBV mRNA responded to HIV Rev. The regulatory HIV-1 protein Rev belongs to the argininerich motifs (ARMs) family of RNA-binding proteins and regulates the expression and usage of viral transcripts by binding to a cis-acting target, the RRE, in HIV. The Rev–RRE complex participates in posttranscriptional regulation by promoting the transport of mRNA from the nucleus into the cytoplasm and enhancing the association of Rev-dependent viral RNA with polysomes to promote translation.32,33 Similar to these HIV RRE properties, a cis-acting element within the HBV genome was identified and referred to as a PRE; it facilitates the nucleocytoplasmic transport of unspliced preS/S subgenomic RNAs.25,28,29 To determine whether HIV Rev decreased HBV mRNA by binding to HBV PRE, a plasmid containing HBsAg and HBV PRE was constructed and transfected into HepG2 cells with HIV Rev; however, no direct interaction of HIV Rev and HBV PRE was observed. In addition, HIV Rev could not manipulate the HBV promoters. Thus, HIV Rev might affect the degradation of HBV mRNA through some other pathway. Although the region in the HBV genome corresponding to HIV Rev was not explored in the present study or in any other studies, one study on hepatitis C virus replication indicated that HIV Rev could bind directly to the HCV 5¢-UTR and stimulate HCV gene expression.34 Nevertheless, future studies are needed to more accurately determine the target sequence in the HBV genome that mediates the decay of HBV RNA when induced by HIV Rev. Data from clinical studies indicate that HIV–HBV coinfection is associated with higher levels of HBV DNA.5–7 However, the increase in the expression level of HBV DNA was not observed in vitro. In Iser’s study,17 an HBV expression cell line (Hep3B or AD38) was reinfected with HIV, and HIV infection did not affect the expression of HBV DNA. In the present study, HepG2 cells were cotransfected with HIV NL4-3 and pHBV1.3 at the same time, and under these conditions HIV infection decreased the expression levels of HBV DNA. Actually, the HBV DNA detected by the real-time PCR assay in this study included the HBV cccDNA and the input HBV plasmid, which was not digested by a plasmid-safe enzyme. However, both the control and cotransfection groups were transfected with the same amount of pHBV1.3 plasmids; therefore, the decrease in the HBV DNA level in cells between the two groups might be caused by HIV
PAN ET AL.
NL4-3 transfection. The contradictory evidence of HBV DNA levels from in vivo and in vitro studies might be due to HBV reactivation under immunosuppression in vivo.10,35 In the present study, HBV secreted proteins including HBsAg and HBeAg decreased in HIV/pHBV1.3 cotransfected HepG2 cells. However, coinfection with HIV and HBV led to an increase in intracellular HBsAg in Hep3B and AD38 cells.17 The reason for these opposite findings might be the different cell lines and very different temporal context during HIV/HBV coinfection. In Iser’s study, an HBV expression cell line (Hep3B or AD38) was reinfected with HIV. Under these circumstances the increased intracellular HBsAg could facilitate hepatocyte toxicity, and thus might contribute to accelerated liver disease in HIV–HBV-coinfected individuals.17 However, in the present study cells were infected by VSV-HIV pseudotyped virus prior to transfection with pHBV1.3 or cotransfection with HIV NL4-3/HIV Rev and pHBV1.3 at the same time. During the interaction of HIV with HBV, HIV decreased the expression of HBsAg and HBeAg by inhibiting HBV mRNA levels. Ultimately, the gradually decreasing HBsAg might cause occult HBV infection (OBI). OBI, defined as the presence of HBV DNA and the absence of HBV surface antigen in plasma or serum in HBV-infected patients, was well recognized in HIV-positive individuals.36 The differences between Iser’s study17 and the present study suggest that the order of virus infection plays an important role in HIV–HBV coinfection. According to the statistical data, in areas with low HBV prevalence ( < 2% HBsAg positive), such as the United States and Western Europe, where HBV transmission is primarily due to injecting drugs and unprotected sex, HIV infection commonly occurs before HBV. In high HBV prevalence areas ( > 8% and approaching 15% HBsAgpositive), such as Africa and Asia, most HBV infections are due to perinatal transmission, close contact, or tattoos, and the patients are usually infected with HBV prior to HIV.16,18 Further studies concerning the order of the relationship between these two virus infections and the rapid progression of liver-related disease in HIV–HBV-coinfected patients would be helpful in the clinical treatment of these patients. Taken together, our results provide further insight into the effect of HIV infection on the replication of HBV in vitro. The results in the present study might provide clues to understanding the mechanism of interaction between the two viruses. Acknowledgments
We thank Drs. Haoming Wu, Wenjie Ouyang, and Tai An and three anonymous reviewers for critiques that greatly improved this article. This work is supported by grants from the National Basic Research Program of China (973 Program) (grants 2010CB530102 and 2011CB504703), by the National Natural Science Foundation of China (NSFC, grants 81021003 and 81071341), and by the Natural Science Foundation of Hubei Province (grant 2013CFB259). X.G. conceived and designed the experiments; W.P. performed the experiments; W.P. and X.G. analyzed the data; T.P. contributed reagents/materials; and W.P., X.G., S.W., Z.W., D.G., and T.P. wrote the article. Author Disclosure Statement
No competing financial interests exist.
HIV-1 LEADS TO DECREASE IN HBV PROTEINS References
1. Hofer M, Joller-Jemelka HI, Grob PJ, et al.: Frequent chronic hepatitis B virus infection in HIV-infected patients positive for antibody to hepatitis B core antigen only. Swiss HIV Cohort Study. Eur J Clin Microbiol Infect Dis 1998;17(1):6–13. 2. Sulkowski MS: Viral hepatitis and HIV coinfection. J Hepatol 2008;48(2):353–367. 3. Koziel MJ and Peters MG: Viral hepatitis in HIV infection. N Engl J Med 2007;356(14):1445–1454. 4. Alter MJ: Epidemiology of viral hepatitis and HIV coinfection. J Hepatol 2006;44(1 Suppl):S6–9. 5. Colin JF, Cazals-Hatem D, Loriot MA, et al.: Influence of human immunodeficiency virus infection on chronic hepatitis B in homosexual men. Hepatology 1999;29(4):1306–1310. 6. Krogsgaard K, Lindhardt BO, Nielson JO, et al.: The influence of HTLV-III infection on the natural history of hepatitis B virus infection in male homosexual HBsAg carriers. Hepatology 1987;7(1):37–41. 7. Gilson RJ, Hawkins AE, Beecham MR, et al.: Interactions between HIV and hepatitis B virus in homosexual men: Effects on the natural history of infection. AIDS 1997; 11(5):597–606. 8. Biggar RJ, Goedert JJ, and Hoofnagle J: Accelerated loss of antibody to hepatitis B surface antigen among immunodeficient homosexual men infected with HIV. N Engl J Med 1987;316(10):630–631. 9. Laukamm-Josten U, Muller O, Bienzle U, et al.: Decline of naturally acquired antibodies to hepatitis B surface antigen in HIV-1 infected homosexual men. AIDS 1988;2(5):400–401. 10. Thio CL, Seaberg EC, Skolasky R Jr, et al.: HIV-1, hepatitis B virus, and risk of liver-related mortality in the Multicenter Cohort Study (MACS). Lancet 2002;360(9349):1921–1926. 11. Clifford GM, Rickenbach M, Polesel J, et al.: Influence of HIV-related immunodeficiency on the risk of hepatocellular carcinoma. AIDS 2008;22(16):2135–2141. 12. Revill PA, Littlejohn M, Ayres A, et al.: Identification of a novel hepatitis B virus precore/core deletion mutant in HIV/hepatitis B virus co-infected individuals. AIDS 2007; 21(13):1701–1710. 13. Chang JJ, Wightman F, Bartholomeusz A, et al.: Reduced hepatitis B virus (HBV)-specific CD4 + T-cell responses in human immunodeficiency virus type 1-HBV-coinfected individuals receiving HBV-active antiretroviral therapy. J Virol 2005;79(5):3038–3051. 14. Chang JJ, Sirivichayakul S, Avihingsanon A, et al.: Impaired quality of the hepatitis B virus (HBV)-specific T-cell response in human immunodeficiency virus type 1-HBV coinfection. J Virol 2009;83(15):7649–7658. 15. Iser DM and Lewin SR: The pathogenesis of liver disease in the setting of HIV-hepatitis B virus coinfection. Antivir Ther 2009;14(2):155–164. 16. Thio CL: Hepatitis B and human immunodeficiency virus coinfection. Hepatology 2009;49(5 Suppl):S138–145. 17. Iser DM, Warner N, Revill PA, et al.: Coinfection of hepatic cell lines with human immunodeficiency virus and hepatitis B virus leads to an increase in intracellular hepatitis B surface antigen. J Virol 2010;84(12):5860– 5867. 18. Lacombe K, Bottero J, Lemoine M, et al.: HIV/hepatitis B virus co-infection: Current challenges and new strategies. J Antimicrob Chemother 2010;65(1):10–17. 19. Blackard JT and Sherman KE: HCV/HIV co-infection: Time to re-evaluate the role of HIV in the liver? J Viral Hepat 2008;15(5):323–330.
9
20. Cao YZ, Dieterich D, Thomas PA, et al.: Identification and quantitation of HIV-1 in the liver of patients with AIDS. AIDS 1992;6(1):65–70. 21. Cao YZ, Friedman-Kien AE, Huang YX, et al.: CD4-independent, productive human immunodeficiency virus type 1 infection of hepatoma cell lines in vitro. J Virol 1990; 64(6):2553–2559. 22. Vlahakis SR, Villasis-Keever A, Gomez TS, et al.: Human immunodeficiency virus-induced apoptosis of human hepatocytes via CXCR4. J Infect Dis 2003;188(10):1455–1460. 23. Fromentin R, Tardif MR, and Tremblay MJ: Human hepatoma cells transmit surface bound HIV-1 to CD4 + T cells through an ICAM-1/LFA-1-dependent mechanism. Virology 2010;398(2):168–175. 24. Zhong B, Yang Y, Li S, et al.: The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity 2008;29(4):538–550. 25. Huang J and Liang TJ: A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products. Mol Cell Biol 1993;13(12):7476–7486. 26. Donello JE, Beeche AA, Smith GJ 3rd, et al.: The hepatitis B virus posttranscriptional regulatory element is composed of two subelements. J Virol 1996;70(7):4345–4351. 27. Bowden S, Jackson K, Littlejohn M, and Locarnini S: Quantification of HBV covalently closed circular DNA from liver tissue by real-time PCR. Methods Mol Med 2004;95:41–50. 28. Huang ZM and Yen TS: Role of the hepatitis B virus posttranscriptional regulatory element in export of intronless transcripts. Mol Cell Biol 1995;15(7):3864–3869. 29. Huang ZM and Yen TS: Hepatitis B virus RNA element that facilitates accumulation of surface gene transcripts in the cytoplasm. J Virol 1994;68(5):3193–3199. 30. Joshi D, O’Grady J, Dieterich D, et al.: Increasing burden of liver disease in patients with HIV infection. Lancet 2011;377(9772):1198–1209. 31. Salmon-Ceron D, Rosenthal E, Lewden C, et al.: Emerging role of hepatocellular carcinoma among liver-related causes of deaths in HIV-infected patients: The French National Mortality 2005 study. J Hepatol 2009;50(4):736–745. 32. Emerman M and Malim MH: HIV-1 regulatory/accessory genes: Keys to unraveling viral and host cell biology. Science 1998;280(5371):1880–1884. 33. Fields B, Knipe D, and Howley P: Fields’ Virology (5th ed.). Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia, 2007. 34. Qu J, Yang Z, Zhang Q, et al.: Human immunodeficiency virus-1 Rev protein activates hepatitis C virus gene expression by directly targeting the HCV 5’-untranslated region. FEBS Lett 2011;585(24):4002–4009. 35. Shi YH and Shi CH: Molecular characteristics and stages of chronic hepatitis B virus infection. World J Gastroenterol 2009;15(25):3099–3105. 36. Ramezani A, Banifazl M, Mohraz M, et al.: Occult hepatitis B virus infection: A major concern in HIV-infected patients: Occult HBV in HIV. Hepat Mon 2011;11(1):7–10.
Address correspondence to: Xiaoyan Gong College of Chemistry and Molecular Sciences Wuhan University Wuhan 430072 China E-mail: [email protected]
Human Immunodeficiency Virus Coinfection with Hepatitis B Virus Leads to a Decrease in Extracellular and Intracellular Hepatitis B Antigen Wei Pan,1 Zuoqiao Wu,1 Shuwen Wu,1 Deyin Guo,1 Xiaoyan Gong,2 and Tien Po1,3
Abstract
Chronic hepatitis B virus (HBV) infection could cause severe liver disease including cirrhosis, hepatocellular carcinoma, and end-stage liver failure in HIV-positive individuals. The available data from clinical studies suggest that HIV infection modulates the HBV-specific T cell response. However, the virological and molecular aspects of HIV–HBV coinfection are currently poorly understood due to the lack of appropriate model systems. In this study, the effect of HIV infection on the life cycle of HBV was explored using an in vitro model system. The present data show that the extracellular and intracellular hepatitis B surface antigen (HBsAg) and e antigen (HBeAg) decrease significantly in HepG2 cells cotransfected with HIV NL4-3 and pHBV1.3 as compared to those cells transfected only with pHBV1.3. Moreover, a significant decrease in HBV DNA and mRNA expression was also observed in the cotransfected cells. HIV Rev protein, an RNA-bound regulatory protein, could significantly decrease the expression levels of extracellular and intracellular HBsAg and HBeAg by mediating the expression of HBV mRNA in cells cotransfected with plasmids containing HIV-1 Rev and pHBV1.3. Further experiments demonstrate that HIV Rev manipulated neither the promoters of HBV nor the nuclear export of HBV mRNA. These results from the in vitro model system might provide clues to further understand the rapid progression of liver disease in HIV–HBV-coinfected patients. the precore/core region of the HBV genome has been associated with higher HBV DNA in HIV–HBV-coinfected individuals and might directly alter pathogenesis.12 In addition, the HBV-specific T cell immune response modulated by HIV might alter the cytokine environment and affect liver disease.13,14 HIV-related microbial translocation, immune activation, and increased hepatic stellate cell activation may underlie the mechanisms for accelerating liver disease progression.15,16 However, few studies have investigated the direct interaction between HIV and HBV in vitro. One study reported that an increase in intracellular hepatitis B surface antigen (HBsAg) in stable human hepatic cell lines expressing HBV (Hep3B and AD38 cells) was observed when VSV-NLNE pseudotyped HIV infected these cells.17 But these results are based on the HBV infection preceding the HIV infection and this model system cannot completely explain the observations that result when the HIV infection precedes the HBV infection or when HIV and HBV coinfection occur synchronously.18 In vivo, HIV can infect multiple cells in the liver, including hepatocytes and Kupffer cells.19 Moreover, the HIV DNA,
Introduction
H
uman immunodeficiency virus type 1 (HIV-1) and hepatitis B virus (HBV) infections are two major global public health problems. Coinfection with both HIV and HBV is common due to shared transmission routes. Up to 90% of HIV-infected patients have evidence of HBV exposure,1,2 while approximately 10–20% of HIV-positive individuals worldwide are coinfected with chronic HBV.3,4 Data from clinical studies indicate that HIV–HBV coinfection is associated with higher levels of HBV DNA,5–7 lower alanine aminotransferase (ALT) levels,5 a lower rate of HBV e antigen clearance,6,7 a higher risk for loss of protective antibody to HBV surface antigen, and subsequent reactivation of HBV.8,9 Of all these negative consequences, the most important is that HIV appears to accelerate the progression of HBV-related liver disease, resulting in cirrhosis10 and hepatocellular carcinoma.11 Clinical evidence might provide several possible reasons for this increased liver-related mortality in HIV–HBV coinfection compared with either infection alone. A mutation in 1 2 3
College of Life Sciences, Wuhan University, Wuhan, China. College of Chemistry and Molecular Sciences, Wuhan University, Wuhan, China. Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.
1
2
RNA, and capsid antigen (p24) can be detected in hepatocytes.20,21 In vitro, HIV-1 coreceptor CXCR4 can be expressed at the surface of hepatocytes22; in addition, HIV can enter into cultured hepatocytes (HepG2 and Huh7.5) through endocytosis mediated by ICAM-1/LFA-1 molecules, and the infectivity of HIV-1 can persist for at least 3 days.23 In this study, we aim to determine and define further the in vitro effects of HIV infection on HBV replication. The effects of HIV infection on the HBV replication cycle including HBV mRNA transcription, DNA replication, and protein translation were explored in human hepatic cells in vitro. Furthermore, the mechanism of inhibition of HIV Rev on HBV mRNA expression was explored. Results from the present study provide clues to understanding the mechanism of interaction between the two viruses and rapid progression of liver disease in HIV–HBV-coinfected patients. Materials and Methods Cell lines
The human hepatic cell line (HepG2) and nonhepatic cell lines (293T and TZM-bl) were cultured at 37C in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Invitrogen, Grand Island, NY). The medium was supplemented with 10% heat-inactivated fetal bovine serum (HyClone, Thermo Scientific, Beijing, China), 100 U/ml penicillin G, and 100 U/ml streptomycin. HIV viral stocks
VSV-G pseudotyped HIV-1 virus (VSV-HIV) with the luciferase gene in place of nef was produced by cotransfecting 293T cells with plasmids containing VSV-G and pNL4-3E - R - -luc. After 48 h, viral stocks were collected from culture supernatants and stored at - 70C until use. Plasmids construction
The sequences of HIV-1 that regulate proteins (Tat and Rev) were amplified by polymerase chain reaction (PCR) from the pNL4-3 clone of HIV-1 (GenBank accession no. AF324493), then inserted into a SalI and NotI digested pRK vector (provided by Professor H.B. Shu, Wuhan University). The pRK vector has an N-terminal tag of FLAG under the control of the CMV promoter.24 HBsAg (S, nt 157–nt 834) or the recombinant gene (SPRE, nt 157–nt 1,684) containing HBsAg and the region of posttranscriptional regulatory element (PRE, nt 1,151–nt 1,684)25,26 was amplified from the plasmid pHBV1.3 (provided by Professor Tien Po, Institute of Microbiology, Beijing), then cloned into the pRK vector.24 The pre-S1 (nt 2,219–2,780) or pre-S2/S promoter (nt 2,809–3,180) of HBV was cloned into the pGL3-Basic vector (provided by Professor D.Y. Guo, Wuhan University) to construct the pGL3-SPI and pGL3-SPII plasmids. The pGL3basic vector lacked eukaryotic promoter and enhancer sequences, thus the expression of luciferase depended on the function of the inserted promoter upstream from the luc + gene. HBsAg and HBeAg quantification
HepG2 or 293T cells were infected with or without VSVHIV pseudotyped virus, HIV-1 infection clone pNL4-3, and
PAN ET AL.
HIV individual proteins; subsequently cells were transfected with a pHBV1.3 plasmid. After transfection, the cell culture supernatants were collected directly to analyze extracellular HBsAg or HBeAg expression levels using an enzyme-linked immunosorbent assay (ELISA) assay. To analyze intracellular HBsAg or HBeAg expression levels, the cells were resuspended in 200 ll of phosphate-buffered saline (PBS) buffer per well and frozen and thawed twice in liquid nitrogen, and then the cell-free supernatants were isolated after centrifugation at 12,000 rpm for 1 min and subjected to an ELISA assay. HBsAg and HBeAg levels were quantified using the ELISA Assay Kit (KeHua Shanghai, China) according to the manufacturer’s instructions. HBV cccDNA and RNA quantification using real-time PCR
Seventy-two hours after transfection (293T after 24 h), cells were harvested for isolation of the total RNA and DNA using a DNA/RNA isolation kit (Tiangen Biotech, Beijing, China). Samples were stored at - 70C until further analysis. RNA samples were treated with Ambion Turbo DNA-free DNase I (Ambion, Austin, TX) at 37C for 30 min to remove residual DNA. cDNA was prepared from 2 lg of RNA using oligo(dT), M-MLV reverse transcriptase (Promega, Madison, WI), and RNasin Ribonuclease Inhibitor (Biostar International, Canada) in a total volume of 25 ll for 60 min at 37C. DNA samples extracted from the cells per well were dissolved in 30 ll of deionized water. Then 5 ll of the DNA sample was digested with Plasmid-Safe ATP-dependent DNase (Epicentre Technologies, Madison, WI) in a 50 ll reaction mixture at 37C for 1 h, and the mixture was incubated at 70C for 30 min to inactivate the enzyme. Two forward primers CCC1 and DRF1 and one reverse primer CCC227 were used at a ratio of 1:1:2 in 20 ll of reaction volume to amplify HBV DNA. Then 10 ll of the DNA sample without treatment with Plasmid-Safe ATP-dependent DNase was diluted in 100 ll for the detection of b-globin. DNAStar version 7 was used to design primers for realtime PCR applications (shown in Table 1). For each reaction, samples were mixed with the Thunderbird SYBR qPCR Mix (TOYOBO Co., Osaka, Japan), and the final primer concentrations were 0.3 lM. Amplifications were performed in a real-time PCR system (ABI 7300, Applied Biosystems Inc., USA). Conditions were 1 cycle of 95C for 5 min, followed by 40 cycles of 95C for 15 s, 60C for 15 s, and 72C for 45 s. The relative quantification of HBsAg mRNA and DNA replicative intermediates from HBV single infection and HIV-HBV dual infection groups was normalized to GAPDH and b-globin, respectively, using the 2 - DDCt method. Northern blot analysis
Seventy-two hours after transfection (293T after 24 h), total RNA was extracted from cells using the TRIzol reagent (Invitrogen, USA). Then 20 lg of total RNA was separated using electrophoresis in 1% agarose gel and transferred to a Hybond N + nylon membrane (GE Healthcare) following standard protocols. The probe labeling and sample detection were performed following the manufacturer’s instructions using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Germany).
HIV-1 LEADS TO DECREASE IN HBV PROTEINS
3
Table 1. Sequences of Primers Selected for Real-Time Polymerase Chain Reaction Assays of Hepatitis B Virus Hepatitis B Surface Antigen mRNA and cccDNA Primers HBsAg_RT_F HBsAg_RT_R GAPDH_RT_F GAPDH_RT_R b-Globin_F b-Globin_R HBsAg_Northern_F HBsAg_Northern_R GAPDH_Northern_F GAPDH_Northern_R SP I_F SP I_R SP II_F SP II_R
Sequence (5¢*3¢)
Position in HBV genome
CCGCCTCCTGCCTCTACCAATC GGAGCCACCAGCAGGGAAATACA CCTGTTCGACAGTCAGCCG CGACCAAAATCCGTTGACTCC CTTGGGTTTCTGATAGGCAC CTTAGGGTTGCCCATAACAG TGCTCGTGTTACAGGCGGGG GCCAGACAGTGGGGGAAAGCC TCCCGCTTCGCTCTCTGCTCC CAGTTTCCCGGAGGGGCCATC CCCTCGAGCTTGTCTCACTTTTGGAA CCAAGCTTATAATATACCCGCCTTCC CCCTCGAGATTTTGTGGGTCACCATA CCAAGCTTACTGCATGGCCTGAGGAT
3,088–3,109 48–70
189–208 708–728 2,217–2,236 2,763–2,778 2,807–2,826 3,162–3,178
HBV, hepatitis B virus; HBsAg, hepatitis B virus surface antigen.
MTT assay
Cell viability was determined using the 3-(4,5)-dimethylthiazol(2-y1)-3,5-diphenyltetrazolium bromide (MTT) assay. Cells were seeded in 96-well plates and then infected with HIV virus or transfected with different plasmids at 50% confluence. After 72 h, the culture medium was removed and 0.1 ml MTT solution (final concentration: 0.5 mg/ml; Sigma) was added. The cells were incubated at 37C for 4 h, and then the medium was replaced by 0.1 ml of the triple Formanza
FIG. 1. The changes in extracellular hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) expression at different time points in HepG2 cells coinfected with VSV-G pseudotyped HIV-1 virus (VSV-HIV) and pHBV1.3. HepG2 cells were seeded in 24-well plates and incubated for 24 h at 37C. The cells were infected with or without HIV pseudotyped virus VSV-HIV 2 h prior to transfection. The cells were then washed three times by phosphate-buffered saline (PBS) and transfected with 0.5 lg of pHBV1.3 in each well using lipofectamine 2000 reagent (Invitrogen, USA). HepG2 cells transfected with the pUC18 empty vector were used as a negative control. At 48, 72, and 96 h posttransfection, the supernatants were collected for further analysis. The ratio of samples/negative (S/N) is represented by the absorbance of samples at OD 450 nm divided by that of the negative control provided by the enzyme-linked immunosorbent assay (ELISA) kit, and was referred to as HBsAg or HBeAg expression levels. The extracellular HBsAg (A) or HBeAg (B) expression level is shown on the y-axis (**p < 0.01).
solution [10% sodium dodecyl sulfate (SDS), 0.012 mol/liter HCl, 5% isobutyl alcohol]. The plates were agitated and incubated at 37C for 2*4 h and the optical density of the solution in the wells was measured at 570 nm on a photometer, with a wavelength of 655 nm as a reference. Statistical analysis
Two-way analysis of variance was used to compare differences between the HBV single infection and HIV-HBV
4
PAN ET AL.
FIG. 2. The change of hepatitis B virus (HBV) replication in NL4-3 and pHBV1.3 cotransfected HepG2 cells. HepG2 cells were cotransfected with or without 0.5 lg of HIV NL4-3 and 0.5 lg of pHBV1.3. HepG2 cells transfected with 1 lg of pUC18 empty vector were used as negative control. At 48, 72, and 96 h posttransfection, the supernatants were collected for an ELISA assay, and the cells were collected for quantifying HBV cccDNA and mRNA. The ratio of samples/negative (S/N) is represented by the absorbance of samples at OD 450 nm divided by that of the negative control provided by the ELISA kit and was used to characterize the expression level of HBsAg or HBeAg. The extracellular HBsAg (A) or HBeAg (B) expression level is shown on the y-axis (**p < 0.01). (C) The expression of HBV cccDNA in the pHBV1.3 only transfected cells (black bar) or HIV NL4-3/ pHBV1.3 cotransfected cells (gray bar). The cccDNA values were normalized to that of b-globin, and the fold change of HBV DNA is shown on the y-axis (**p < 0.01). (D) The expression of HBV mRNA in the pHBV1.3 only transfected cells (black bar) or HIV NL4-3/ pHBV1.3 cotransfected cells (gray bar). The HBV mRNA values were normalized to that of GAPDH, and the fold change of HBV mRNA is shown on the y-axis (**p < 0.01).
dual infection groups using SPSS version 16.0 (Chicago, IL). A p value of < 0.05 was considered significant. Results Decrease of HBsAg and HBeAg in VSV-HIV-infected HepG2 cells transfected with pHBV1.3
HIV has been shown to infect multiple cells in the liver including hepatocytes19 and hepatic cell lines (HepG2, Huh7) in
in vitro systems.15 To determine the effect of HIV infection on HBV replication in vitro, the HepG2 cells were infected with either HIV-1 NL4-3 or HIV-1IIIB, and then the cells were transfected with pHBV1.3. Although the extracellular HBsAg slightly decreased in HIV/pHBV1.3 dual-infected cells, there was no significant difference between the single HBV infection group and the HIV–HBV dual infection group (data not shown). To exclude the low infectivity part of the HIV virus,17 HepG2 cells were infected with VSV-G pseudotyped HIV
HIV-1 LEADS TO DECREASE IN HBV PROTEINS
virus VSV-HIV. The cells were then transfected with pHBV1.3. At 48, 72, and 96 h posttransfection, cell culture supernatants were collected to check the expression of the secreted HBV proteins. The viability of HepG2 cells infected by the amount of VSV-HIV was checked by the MTT assay; the results showed that no change in cells viability was observed upon HIV infection. As shown in Fig. 1A, the extracellular HBsAg has a significant decrease in HepG2 cells compared to the mockinfected controls 72 h and 96 h after transfection. The extracellular HBeAg also has a significant decrease 96 h after transfection (Fig. 1B). The extracellular HBsAg was not sufficient to measure at 24 h posttransfection. The change of HBV replication in NL4-3 and pHBV1.3 cotransfected HepG2 cells
In this study, the results from Fig. 1 show that the pseudotyped virus VSV-HIV infection decreased extracellular HBsAg and HBeAg in HepG2 cells transfected with pHBV1.3. Considering that VSV-HIV was one cycle of replication in HepG2 cells, HepG2 cells were cotransfected with HIV pNL4-3 and pHBV1.3 plasmids as described in Materials and Methods. As shown in Fig. 2, the extracellular HBsAg decreased significantly in HIV pNL4-3/pHBV1.3 cotransfected HepG2 cells compared to pHBV1.3 single transfected cells at 48, 72, and 96 h after transfection (Fig. 2A). Similarly, extracellular HBeAg also had a significant decrease at 72 and 96 h after transfection (Fig. 2B). The MTT assay was used to exclude the toxicity of HIV NL4-3 or
5
pHBV1.3 plasmids, and no difference was observed in cell viability between the test and mock groups. To explore the effect of HIV infection on the replication and transcription steps of HBV in vitro, HBV mRNA and cccDNA samples were isolated from transfected cells and were quantified by real-time PCR at 48, 72, and 96 h after transfection. In the cotransfection group, HBV cccDNA decreased significantly at 48, 72, and 96 h after transfection as compared to the single transfection group (Fig. 2C). Moreover, HBV mRNA significantly decreased at 72 and 96 h posttransfection (Fig. 2D). These results indicated that HIV NL4-3 affected the expression of HBsAg and HBeAg by influencing both the replication of the HBV genome cccDNA and the transcription of HBV mRNA. Decrease of HBsAg and HBeAg in HIV Rev/pHBV1.3 cotransfected HepG2 cells and 293T cells
HIV proteins Tat and Rev are regarded as regulatory elements and RNA-bound proteins among the nine HIV proteins. According to the analysis illustrated in Fig. 2, HIV NL4-3 inhibited the replication of HBV cccDNA and the transcription of HBV mRNA in HepG2 cells. To investigate whether Tat and Rev contributed to this inhibitory effect, the HepG2 cells were cotransfected with plasmids containing HIV Tat or Rev and pHBV1.3. As shown in Fig. 3A and B, HIV Rev decreased extracellular and intracellular HBsAg (Fig. 3A) and HBeAg (Fig. 3B) expression in HepG2 cells cotransfected with HIV Rev and pHBV1.3 as compared to only pHBV1.3 transfected cells. However, HIV Tat did not
FIG. 3. The changes of extracellular and intracellular HBsAg and HBeAg expression in cells cotransfected with HIV Tat or Rev and pHBV1.3. HepG2 and 293T cells were transfected with or without individual HIV proteins and pHBV1.3. At 72 h after transfection (24 h for 293T cells), the supernatants and cells were collected for an ELISA assay. (A, B) The expression levels of HBsAg (A) and HBeAg (B) in HepG2 cells. (C, D) The expression levels of HBsAg (C) and HBeAg (D) in 293T cells. The black bar shows the extracellular HBsAg or HBeAg and the gray bar shows the intracellular HBsAg and HBeAg. The pRK group represents cells transfected with only pHBV1.3 and the pRK empty vector and was used as negative control. The individual HIV protein groups represent cells cotransfected with individual HIV proteins and pHBV1.3, and the PUC group represents cells transfected with pUC18 and pRK empty vectors (*p < 0.05, **p < 0.01).
6
PAN ET AL.
FIG. 4. Changes of HBV cccDNA and mRNA levels in PRK-REV and pHBV1.3 cotransfected cells. HepG2 and 293T cells were transfected with or without PRK-REV and pHBV1.3. After transfection, the cells were collected for real-time PCR. (A) The expression of HBV cccDNA in the pHBV1.3 only transfected cells (black bar) or PRK-REV/pHBV1.3 cotransfected cells (gray bar). The values of HBV cccDNA were normalized to that of b-globin, and the fold change is shown on the y-axis. (B) The expression of HBV mRNA in the pHBV1.3 only transfected cells (black bar) or PRK-REV/pHBV1.3 cotransfected cells (gray bar). The values of HBV mRNA were normalized to that of GAPDH, and the fold change is shown on the y-axis (*p < 0.05, **p < 0.01). (C) 293T and HepG2 cells were transfected with either pHBV1.3 alone or plasmids containing PRK-REV and pHBV1.3. Then 72 h after transfection (293T cell after 24 h), the cells were collected to isolate RNA for Northern blot analysis as described in Materials and Methods. A total RNA of 20 lg was loaded in each lane.
affect the expression of extracellular and intracellular HBsAg (Fig. 3A) and HBeAg (Fig. 3B). No change of cell viability was observed in the MTT assay. To investigate whether the effect of HIV proteins on HBsAg expression had a tropism for hepatic cells, 293T cells were cotransfected with plasmids containing individual HIV proteins and pHBV1.3. Both HIV Rev and Tat significantly decreased intracellular and extracellular HBeAg expression in 293 T cells (Fig. 3D). In addition, both HIV Rev and Tat significantly decreased intracellular HBsAg expression, but the two HIV proteins did not affect extracellular HBsAg expression in 293T cells (Fig. 3C). These results suggest that HIV Rev affected HBsAg and HBeAg expression levels re-
gardless of cell tropism; however, HIV Tat could affect HBsAg and HBeAg expression in 293 T cells rather than in HepG2 cells. Effect of HIV-1 Rev on the cccDNA and mRNA expression of HBV in different cells
To determine the effect of HIV Rev on the replication of HBV in vitro, the HBV cccDNA was isolated and quantified using real-time PCR. The results indicate that the amount of HBV cccDNA in HepG2 and 293T cells showed no significant difference between the single HBV and HIV Rev/HBV cotransfection groups (Fig. 4A).
HIV-1 LEADS TO DECREASE IN HBV PROTEINS
At the same time, the expression of HBV mRNA was measured using real-time PCR and Northern blot. As shown in Fig. 4B and C, HBV mRNA decreased in the HIV Rev/ pHBV1.3 cotransfection group in both the hepatic cell (HepG2) and nonhepatic (293T) cell lines as compared to the pHBV1.3 single transfected cells. Effect of HIV-1 Rev on the posttranscriptional process of HBsAg mRNA
The plasmid pHBV1.3 was constructed by inserting HBV 1.3 · into the genomes of the pUC18 vector. This plasmid could produce pgRNA transcription as well as the other three expression transcriptions driving the HBV intrinsic promoter. The results (Fig. 4) suggest that HIV Rev downregulates HBV mRNA in HepG2 and 293T cells. To determine whether this inhibition occurs transcriptionally, the recombinant plasmid pGL3-SPI or pGL3-SPII containing the pre-S1 or pre-S2/S promoter of HBV was transfected into cells (HepG2 and 293T) with or without PRK-REV. However, there was no significant difference between the pGL3-SPI/pGL3-SPII and PRK-REV cotransfection and pGL3-SPI/pGL3-SPII single transfection groups, which indicates that HIV Rev could not manipulate the pre-S1 and pre-S2/S promoters of HBV (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/aid). Since HIV Rev did not inhibit HBV mRNA expression transcriptionally, we hypothesized that the HIV-1 Rev protein induced the decrease of HBV mRNA posttranscriptionally. It was previously known that HIV Rev could bind to a cis-acting RNA element known as the Rev-responsive element (RRE),
7
thus promoting the nuclear export of RNAs. A similar element (posttranscriptional regulatory element, PRE) in hepatitis B virus (HBV) has been identified.25,28 Similar to the Rev-RRE system in HIV, the HBV PRE can mediate the nuclear export of viral pre-S/S RNAs.29 In addition, viral pre-S/S RNAs lacking the PRE fail to translocate to the cytoplasm and degrade in the nucleus via a mechanism that remains elusive. HepG2 or 293T cells were cotransfected with PRK-REV and S-PRE/S; meanwhile, cells cotransfected with pRK vector and S-PRE/S functioned as the control groups. As shown in Fig. 5, the intracellular and extracellular HBsAg levels increased in cells (HepG2 or 293T) transfected with SPRE as compared to cells transfected with S. These results were consistent with previous studies,28,29 revealing that HBV PRE could facilitate the transport and utilization of HBV transcripts regardless of the presence of PRK-REV. No significant differences were observed between control groups and cells cotransfected with S-PRE/S and PRK-REV plasmids, which indicates that HIV-1 Rev cannot interact with HBV PRE directly and thus affect the nuclear export of HBV mRNA. Taken together, HIV Rev decreased HBV mRNA expression in HepG2 or 293T cells (Fig. 4), and this inhibition effect did not occur in either transcriptional or posttranscriptional modulation of the HBV RNA (Fig. 5), suggesting that HIV Rev might affect the degradation of the HBV mRNA. Discussion
Coinfection with HBV and HIV remains a public health problem, due to the higher incidence of hepatocellular
FIG. 5. The effect of PRK-REV on HBV PRE in HepG2 and 293T cells. Cells were transfected with either S-PRE/S alone or plasmids containing S-PRE/S and a different amount of PRK-REV; the amount of plasmid transfected in each well was kept constant. Then 72 h posttransfection (293T for 24 h) supernatant and cells were collected for ELISA assay. The black bars show the HBsAg expression levels in 293T (A, B) and HepG2 (C, D) cells transfected with S-PRE and a different amount of PRK-REV; the gray bars show the HBsAg expression levels in cells cotransfected with S and different amounts of PRK-REV. The NC group represents cells transfected with the pRK empty vector. The y-axis shows the expression levels of intracellular or extracellular HBsAg.
8
carcinoma and an excess of liver-related mortality among coinfected individuals as compared to single HBV or HIV infections.30 An investigation of liver-related death among HIV-infected patients in 2005 compared to those in 2000 demonstrated that the rate of liver-related death increased from 13.4% (in 2000) to 15.4% (in 2005), and hepatocellular carcinoma among those liver-related deaths increased from 15% to 25%.31 Although the clinical challenge posed by HIV-HBV coinfections is important, the virological and molecular aspects of this coinfection are poorly understood due to a lack of appropriate model systems. In this study, the results suggest that the decrease of secreted HBV proteins might be due to the decreased expression of HBV mRNA in HepG2 cells cotransfected with HIV NL4-3 and pHBV1.3 plasmids. HIV Rev, an RNA-bound regulatory protein, decreased the expression of HBV mRNA in HepG2 and 293T cells in this study, suggesting that the interaction between HIV Rev and HBV mRNA was host cell independent. We then sought to define how the HBV mRNA responded to HIV Rev. The regulatory HIV-1 protein Rev belongs to the argininerich motifs (ARMs) family of RNA-binding proteins and regulates the expression and usage of viral transcripts by binding to a cis-acting target, the RRE, in HIV. The Rev–RRE complex participates in posttranscriptional regulation by promoting the transport of mRNA from the nucleus into the cytoplasm and enhancing the association of Rev-dependent viral RNA with polysomes to promote translation.32,33 Similar to these HIV RRE properties, a cis-acting element within the HBV genome was identified and referred to as a PRE; it facilitates the nucleocytoplasmic transport of unspliced preS/S subgenomic RNAs.25,28,29 To determine whether HIV Rev decreased HBV mRNA by binding to HBV PRE, a plasmid containing HBsAg and HBV PRE was constructed and transfected into HepG2 cells with HIV Rev; however, no direct interaction of HIV Rev and HBV PRE was observed. In addition, HIV Rev could not manipulate the HBV promoters. Thus, HIV Rev might affect the degradation of HBV mRNA through some other pathway. Although the region in the HBV genome corresponding to HIV Rev was not explored in the present study or in any other studies, one study on hepatitis C virus replication indicated that HIV Rev could bind directly to the HCV 5¢-UTR and stimulate HCV gene expression.34 Nevertheless, future studies are needed to more accurately determine the target sequence in the HBV genome that mediates the decay of HBV RNA when induced by HIV Rev. Data from clinical studies indicate that HIV–HBV coinfection is associated with higher levels of HBV DNA.5–7 However, the increase in the expression level of HBV DNA was not observed in vitro. In Iser’s study,17 an HBV expression cell line (Hep3B or AD38) was reinfected with HIV, and HIV infection did not affect the expression of HBV DNA. In the present study, HepG2 cells were cotransfected with HIV NL4-3 and pHBV1.3 at the same time, and under these conditions HIV infection decreased the expression levels of HBV DNA. Actually, the HBV DNA detected by the real-time PCR assay in this study included the HBV cccDNA and the input HBV plasmid, which was not digested by a plasmid-safe enzyme. However, both the control and cotransfection groups were transfected with the same amount of pHBV1.3 plasmids; therefore, the decrease in the HBV DNA level in cells between the two groups might be caused by HIV
PAN ET AL.
NL4-3 transfection. The contradictory evidence of HBV DNA levels from in vivo and in vitro studies might be due to HBV reactivation under immunosuppression in vivo.10,35 In the present study, HBV secreted proteins including HBsAg and HBeAg decreased in HIV/pHBV1.3 cotransfected HepG2 cells. However, coinfection with HIV and HBV led to an increase in intracellular HBsAg in Hep3B and AD38 cells.17 The reason for these opposite findings might be the different cell lines and very different temporal context during HIV/HBV coinfection. In Iser’s study, an HBV expression cell line (Hep3B or AD38) was reinfected with HIV. Under these circumstances the increased intracellular HBsAg could facilitate hepatocyte toxicity, and thus might contribute to accelerated liver disease in HIV–HBV-coinfected individuals.17 However, in the present study cells were infected by VSV-HIV pseudotyped virus prior to transfection with pHBV1.3 or cotransfection with HIV NL4-3/HIV Rev and pHBV1.3 at the same time. During the interaction of HIV with HBV, HIV decreased the expression of HBsAg and HBeAg by inhibiting HBV mRNA levels. Ultimately, the gradually decreasing HBsAg might cause occult HBV infection (OBI). OBI, defined as the presence of HBV DNA and the absence of HBV surface antigen in plasma or serum in HBV-infected patients, was well recognized in HIV-positive individuals.36 The differences between Iser’s study17 and the present study suggest that the order of virus infection plays an important role in HIV–HBV coinfection. According to the statistical data, in areas with low HBV prevalence ( < 2% HBsAg positive), such as the United States and Western Europe, where HBV transmission is primarily due to injecting drugs and unprotected sex, HIV infection commonly occurs before HBV. In high HBV prevalence areas ( > 8% and approaching 15% HBsAgpositive), such as Africa and Asia, most HBV infections are due to perinatal transmission, close contact, or tattoos, and the patients are usually infected with HBV prior to HIV.16,18 Further studies concerning the order of the relationship between these two virus infections and the rapid progression of liver-related disease in HIV–HBV-coinfected patients would be helpful in the clinical treatment of these patients. Taken together, our results provide further insight into the effect of HIV infection on the replication of HBV in vitro. The results in the present study might provide clues to understanding the mechanism of interaction between the two viruses. Acknowledgments
We thank Drs. Haoming Wu, Wenjie Ouyang, and Tai An and three anonymous reviewers for critiques that greatly improved this article. This work is supported by grants from the National Basic Research Program of China (973 Program) (grants 2010CB530102 and 2011CB504703), by the National Natural Science Foundation of China (NSFC, grants 81021003 and 81071341), and by the Natural Science Foundation of Hubei Province (grant 2013CFB259). X.G. conceived and designed the experiments; W.P. performed the experiments; W.P. and X.G. analyzed the data; T.P. contributed reagents/materials; and W.P., X.G., S.W., Z.W., D.G., and T.P. wrote the article. Author Disclosure Statement
No competing financial interests exist.
HIV-1 LEADS TO DECREASE IN HBV PROTEINS References
1. Hofer M, Joller-Jemelka HI, Grob PJ, et al.: Frequent chronic hepatitis B virus infection in HIV-infected patients positive for antibody to hepatitis B core antigen only. Swiss HIV Cohort Study. Eur J Clin Microbiol Infect Dis 1998;17(1):6–13. 2. Sulkowski MS: Viral hepatitis and HIV coinfection. J Hepatol 2008;48(2):353–367. 3. Koziel MJ and Peters MG: Viral hepatitis in HIV infection. N Engl J Med 2007;356(14):1445–1454. 4. Alter MJ: Epidemiology of viral hepatitis and HIV coinfection. J Hepatol 2006;44(1 Suppl):S6–9. 5. Colin JF, Cazals-Hatem D, Loriot MA, et al.: Influence of human immunodeficiency virus infection on chronic hepatitis B in homosexual men. Hepatology 1999;29(4):1306–1310. 6. Krogsgaard K, Lindhardt BO, Nielson JO, et al.: The influence of HTLV-III infection on the natural history of hepatitis B virus infection in male homosexual HBsAg carriers. Hepatology 1987;7(1):37–41. 7. Gilson RJ, Hawkins AE, Beecham MR, et al.: Interactions between HIV and hepatitis B virus in homosexual men: Effects on the natural history of infection. AIDS 1997; 11(5):597–606. 8. Biggar RJ, Goedert JJ, and Hoofnagle J: Accelerated loss of antibody to hepatitis B surface antigen among immunodeficient homosexual men infected with HIV. N Engl J Med 1987;316(10):630–631. 9. Laukamm-Josten U, Muller O, Bienzle U, et al.: Decline of naturally acquired antibodies to hepatitis B surface antigen in HIV-1 infected homosexual men. AIDS 1988;2(5):400–401. 10. Thio CL, Seaberg EC, Skolasky R Jr, et al.: HIV-1, hepatitis B virus, and risk of liver-related mortality in the Multicenter Cohort Study (MACS). Lancet 2002;360(9349):1921–1926. 11. Clifford GM, Rickenbach M, Polesel J, et al.: Influence of HIV-related immunodeficiency on the risk of hepatocellular carcinoma. AIDS 2008;22(16):2135–2141. 12. Revill PA, Littlejohn M, Ayres A, et al.: Identification of a novel hepatitis B virus precore/core deletion mutant in HIV/hepatitis B virus co-infected individuals. AIDS 2007; 21(13):1701–1710. 13. Chang JJ, Wightman F, Bartholomeusz A, et al.: Reduced hepatitis B virus (HBV)-specific CD4 + T-cell responses in human immunodeficiency virus type 1-HBV-coinfected individuals receiving HBV-active antiretroviral therapy. J Virol 2005;79(5):3038–3051. 14. Chang JJ, Sirivichayakul S, Avihingsanon A, et al.: Impaired quality of the hepatitis B virus (HBV)-specific T-cell response in human immunodeficiency virus type 1-HBV coinfection. J Virol 2009;83(15):7649–7658. 15. Iser DM and Lewin SR: The pathogenesis of liver disease in the setting of HIV-hepatitis B virus coinfection. Antivir Ther 2009;14(2):155–164. 16. Thio CL: Hepatitis B and human immunodeficiency virus coinfection. Hepatology 2009;49(5 Suppl):S138–145. 17. Iser DM, Warner N, Revill PA, et al.: Coinfection of hepatic cell lines with human immunodeficiency virus and hepatitis B virus leads to an increase in intracellular hepatitis B surface antigen. J Virol 2010;84(12):5860– 5867. 18. Lacombe K, Bottero J, Lemoine M, et al.: HIV/hepatitis B virus co-infection: Current challenges and new strategies. J Antimicrob Chemother 2010;65(1):10–17. 19. Blackard JT and Sherman KE: HCV/HIV co-infection: Time to re-evaluate the role of HIV in the liver? J Viral Hepat 2008;15(5):323–330.
9
20. Cao YZ, Dieterich D, Thomas PA, et al.: Identification and quantitation of HIV-1 in the liver of patients with AIDS. AIDS 1992;6(1):65–70. 21. Cao YZ, Friedman-Kien AE, Huang YX, et al.: CD4-independent, productive human immunodeficiency virus type 1 infection of hepatoma cell lines in vitro. J Virol 1990; 64(6):2553–2559. 22. Vlahakis SR, Villasis-Keever A, Gomez TS, et al.: Human immunodeficiency virus-induced apoptosis of human hepatocytes via CXCR4. J Infect Dis 2003;188(10):1455–1460. 23. Fromentin R, Tardif MR, and Tremblay MJ: Human hepatoma cells transmit surface bound HIV-1 to CD4 + T cells through an ICAM-1/LFA-1-dependent mechanism. Virology 2010;398(2):168–175. 24. Zhong B, Yang Y, Li S, et al.: The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity 2008;29(4):538–550. 25. Huang J and Liang TJ: A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products. Mol Cell Biol 1993;13(12):7476–7486. 26. Donello JE, Beeche AA, Smith GJ 3rd, et al.: The hepatitis B virus posttranscriptional regulatory element is composed of two subelements. J Virol 1996;70(7):4345–4351. 27. Bowden S, Jackson K, Littlejohn M, and Locarnini S: Quantification of HBV covalently closed circular DNA from liver tissue by real-time PCR. Methods Mol Med 2004;95:41–50. 28. Huang ZM and Yen TS: Role of the hepatitis B virus posttranscriptional regulatory element in export of intronless transcripts. Mol Cell Biol 1995;15(7):3864–3869. 29. Huang ZM and Yen TS: Hepatitis B virus RNA element that facilitates accumulation of surface gene transcripts in the cytoplasm. J Virol 1994;68(5):3193–3199. 30. Joshi D, O’Grady J, Dieterich D, et al.: Increasing burden of liver disease in patients with HIV infection. Lancet 2011;377(9772):1198–1209. 31. Salmon-Ceron D, Rosenthal E, Lewden C, et al.: Emerging role of hepatocellular carcinoma among liver-related causes of deaths in HIV-infected patients: The French National Mortality 2005 study. J Hepatol 2009;50(4):736–745. 32. Emerman M and Malim MH: HIV-1 regulatory/accessory genes: Keys to unraveling viral and host cell biology. Science 1998;280(5371):1880–1884. 33. Fields B, Knipe D, and Howley P: Fields’ Virology (5th ed.). Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia, 2007. 34. Qu J, Yang Z, Zhang Q, et al.: Human immunodeficiency virus-1 Rev protein activates hepatitis C virus gene expression by directly targeting the HCV 5’-untranslated region. FEBS Lett 2011;585(24):4002–4009. 35. Shi YH and Shi CH: Molecular characteristics and stages of chronic hepatitis B virus infection. World J Gastroenterol 2009;15(25):3099–3105. 36. Ramezani A, Banifazl M, Mohraz M, et al.: Occult hepatitis B virus infection: A major concern in HIV-infected patients: Occult HBV in HIV. Hepat Mon 2011;11(1):7–10.
Address correspondence to: Xiaoyan Gong College of Chemistry and Molecular Sciences Wuhan University Wuhan 430072 China E-mail: [email protected]
