1748

Jonas Hummel et al.

DOI: 10.1002/eji.201445366

Eur. J. Immunol. 2015. 45: 1748–1759

Human endogenous retrovirus envelope proteins target dendritic cells to suppress T-cell activation Jonas Hummel1 , Ulrike K¨ ammerer2 , Nora M¨ uller1 , Elita Avota1 and Sibylle Schneider-Schaulies1 1 2

Institute for Virology and Immunobiology, University of Wuerzburg, Wuerzburg, Germany Department of Obstetrics and Gynaecology, University of Wuerzburg, Wuerzburg, Germany

Though mostly defective, human endogenous retroviruses (HERV) can retain open reading frames, which are especially expressed in the placenta. There, the envelope (env) proteins of HERV-W (Syncytin-1), HERV-FRD (Syncytin-2), and HERV-K (HML-2) were implicated in tolerance against the semi-allogenic fetus. Here, we show that the known HERV envbinding receptors ASCT-1 and -2 and MFSD2 are expressed by DCs and T-cells. When used as effectors in coculture systems, CHO cells transfected to express Syncytin-1, -2, or HML-2 did not affect T-cell expansion or overall LPS-driven phenotypic DC maturation, however, promoted release of IL-12 and TNF-α rather than IL-10. In contrast, HERV env expressing choriocarcinoma cell lines suppressed T-cell proliferation and LPS-induced TNF-α and IL-12 release, however, promoted IL-10 accumulation, indicating that these effects might not rely on HERV env interactions. However, DCs conditioned by choriocarcinoma, but also transgenic CHO cells failed to promote allogenic T-cell expansion. This was associated with a loss of DC/T-cell conjugate frequencies, impaired Ca2+ mobilization, and aberrant patterning of f-actin and tyrosine phosphorylated proteins in T-cells. Altogether, these findings suggest that HERV env proteins target T-cell activation indirectly by modulating the stimulatory activity of DCs.

Keywords: DCs r DC/T-cell conjugates r HERV r Immune tolerance r Immunological synapse T-cell activation



r

Additional supporting information may be found in the online version of this article at the publisher’s web-site

Introduction Human endogenous retroviruses (HERVs) are estimated to comprise about 8% of the human genome [1]. They are mainly germline transmitted. HERVs are typically defective as a result of multiple mutations in their genomes, and it is therefore only on exception that viral particles can be produced [1, 2]. Endogenous retroviruses (ERVs) can substantially regulate host cell gene expression and functions. In addition to viral transcripts, ERV encoded proteins translated from intact ORFs were implicated

Correspondence: Dr. Sibylle Schneider-Schaulies e-mail: [email protected]

 C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

in both pathological and physiological processes [3]. The latter has for instance been revealed for the envelope (env) regions of three HERVs (ERV-3, HERV-W, and HERV-FRD). These are highly expressed in early and late placentae, and their importance in successful accomplishment of pregnancy has been suggested [4–10], not least because spontaneous abortions or complications of gestation like preeclampsia are associated with reduced levels of HERV env proteins [11, 12]. In fact, their expression has been found crucial in the intrauterine fetal development in promoting syncytiotrophoblast formation, while the HERV-FRD env was also associated with fetomaternal tolerance to prevent rejection of the fetus [13–17]. Immunodeficiency is commonly associated with retroviral infections (for a recent review see [18]). Among the plethora of

www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1748–1759

effector mechanisms studied, immunosuppressive domains (ISD) were identified within the ectodomains of transmembrane env proteins of certain retroviruses, and a corresponding 17 aa synthetic peptide (CKS-17) was found to be immunosuppressive in vitro and in vivo [19, 20]. The immunosuppression (ISU) activity of retroviral env proteins in vitro was often reflected by their ability to inhibit stimulated expansion of PBMCs or T-cells indicating that they might directly act on these targets [21–23]. Mechanisms and targets of HERV env mediated ISU are not fully defined. ISD-like sequences are detectable in many, but not all HERVs [18, 24, 25]. The ISU activity of HERV env proteins has been extensively documented by their ability to regulate immune control thereby promoting tumor outgrowth in vivo in tumor rejection models (reviewed in [26]). In one of these studies the ISU activity of Syncytin-2 (but not Syncytin-1) could be linked to a 20 aa peptide with similarity to the CKS-17, which, when transferred into Syncytin-1, conferred, and when mutated in Syncytin-2, prevented ISU activity [17]. Syncytin-1 did not have ISU activity in these assays, however, inhibited stimulated cytokine responses in vitro when transferred by placental exosomes [27]. More recently, the ISU activity of the transmembrane domain of HERVK/HML-2 protein was revealed by the ability of a recombinant env protein to inhibit proliferation and to modulate cytokine release of stimulated human PBMCs or murine splenocytes in vitro [25]. Based on their ISU activities and their high expression levels in placental tissue, HERV env proteins have been suggested to contribute to fetomaternal tolerance. Mechanisms of env mediated inhibition and especially immune target cells remained, however, ill defined. Interaction between dendritic and T-cells crucially shapes magnitude and quality of adaptive immunity and both cell populations are abundant in healthy early pregnancy deciduae [28]. We therefore decided to generate CHO cells expressing particular HERV env proteins singly or in combination and use them as effector cells to test their ISU activity on T cells and monocyte derived DCs as models for decidual immune cells. In contrast to choriocarcinoma cells, which were included as HERV env expressing placental cells, CHO effector cells did not directly interfere with stimulated T-cell expansion. They did not detectably affect LPSdriven phenotypic DC maturation, however, modulated cytokine release. However, all effector cells substantially affected the ability of DCs to promote allogenic T-cell expansion, and this was associated with a reduced ability of DCs to recruit T-cells into conjugates and to organize functional immune synapses (IS). Altogether, our findings support the interpretation that HERV env proteins act to dampen T-cell activation by targeting the DC allostimulatory activity.

Results Expression of HERV env fusion receptors on target cells and HERV env proteins on effector cells Susceptibility to HERV env protein mediated immunomodulation requires the availability of specific receptors. Though they  C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Immunomodulation

have only been implicated in HERV env fusion (however not in immunomodulation) we first analyzed expression patterns of ASCT-1 (SLC1A4) (binding Syncytin-1), ASCT-2 (SLC1A5), and MFSD2A (binding Syncytin-2; the HML-2-specific receptor is unknown) by potential targets such as immature DCs (iDCs) or T-cells. ASCT-1, -2, and MFSD2A were surface expressed on iDCs and in T-cell enriched populations with levels of ASCT-1 and ASCT-2 being substantially higher on DCs as measured by flow cytometry (Fig. 1A). Surface display levels of MFSD2A were slightly higher than those of the other receptors on both DCs and the T-cell enriched population, this did, however, not reach statistical significance (Fig. 1A). For transgenic expression in CHO cells (which do not express HERV env proteins or their receptors), Syncytin-1, -2, and HML-2 were amplified from RNA isolated from BeWo choriocarcinoma cells. In CHO cells transfected to stably express Syncytin-1 or -2, overall transgene levels were high, however, surface display was highly restricted and could be enhanced only upon a 48 h exposure to forskolin (not shown). Because the presence of this compound might also confound target cell responses, we decided to use transient expression of the effector proteins which reproducibly yielded surface expression levels of at least 87% (which were maintained for at least 96 h post transfection) as controlled by flow cytometry prior to each experiment detailed below (exemplified in Fig. 1C). The choriocarcinoma cell lines BeWo and JEG expressing all three potential effector proteins on their surface (albeit to lower levels than the transfectants) (Fig. 1B and C) were included as positive, while non- or vector-transfected CHO cells served as negative controls in all subsequent experiments. An appropriate negative control for the choriocarcinoma cell lines was not available, because tumor, especially placenta derived cell lines often express HERV env proteins or their receptors. Choriocarcinoma or CHO transfectants were subsequently used and termed as “effector cells” in cocultures with T-cells or DCs, respectively.

Choriocarcinoma, but not CHO effector cells, inhibit stimulated T-cell proliferation To address whether HERV env protein interaction affects T-cell expansion directly, proliferation of purified CFSE-labeled human T-cells preexposed to effector cells was measured 5 days following PMA/ionomycin activation by flow cytometry (exemplified in Fig. 2A). Choriocarcinoma BeWo or JEG cells efficiently inhibited T-cell expansion (Fig. 2B; left panel). In contrast, transgenic CHO cells did not significantly affect T-cell expansion in this system (Fig. 2B; right panel). Importantly, using standard conditions, T-cell proliferation also was not affected after coculture with CHO cells transfected to express two or even three HERV env proteins (not shown). Because HERV env protein surface expression on CHO effector cells was at least comparable, if not higher than that on JEG and BeWo cells (Fig. 1B and C), it is more than unlikely that these proteins cause T-cell inhibition directly. www.eji-journal.eu

1749

1750

Jonas Hummel et al.

Eur. J. Immunol. 2015. 45: 1748–1759

Figure 1. Expression of HERV env proteins on effector and their receptors on immune cells. (A) ASCT-1, -2, and MFSD2A surface expression levels were analyzed on iDC and T-cell enriched populations (each population gated by FSC/SSC) by flow cytometry using specific primary antibodies. Representative histogram plots from three independent experiments are shown. Gray histograms show control cells stained only with secondary antibody. Numbers indicate MFIs for the different antibodies. (B) Syncytin-1 or -2 (left panels) or HML2 (right panels) were detected on the surface of BeWo (upper panels) or JEG cells (bottom panels) by flow cytometry. Representative histogram plots from three independent experiments are shown. Gray histograms show control cells stained only with secondary antibody. Numbers indicate MFIs for the different antibodies. (C) Surface display of Syncytin-1, Syncytin-2, or HML-2 48 h following transient transfection into CHO cells (left, middle, and right panel, dashed lines). Expression levels were analyzed by flow cytometry with specific antibodies. Vector-transfected CHO cells served as negative control (black solid lines). Representative histogram plots from six independent experiments are shown. Numbers indicate MFIs for the different antibodies.

Effector cells conditioning affects cytokine production, but not phenotypic DC maturation To evaluate a potential impact of HERV env proteins on DC maturation, iDCs were cocultured with BeWo or JEG cells or transgenic CHO cells for 24 h and used for surface marker upregulation or cytokine analysis after a further 24 h culture in medium supplemented with LPS or not. Coculture with BeWo or JEG cells already promoted CD86 upregulation prior to activation by LPS, which did not significantly further enhance surface expression of this molecule (Fig. 3A). DC conditioning by non- or empty vector transfected CHO cells per se increased surface display of maturation markers (Fig. 3A–D, each first bar, and not shown for untransfected CHO cells) and that by CHO effector cells expressing Syncytin-1 and -2, but not HML-2 significantly interfered with LPS-induced CD86 upregulation (Fig. 3C). LPS driven upregulation of CD40, CD80, and CD83 were unaffected by CHO effector cells, and this also applied to BeWo

 C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

and JEG cells (Fig. 3B and D, and not shown for CD80 and CD83). In cocultures with choriocarcinoma cells, LPS-stimulated production of IL-12 and TNF-α was found suppressed, while IL-10 accumulated (Fig. 4A–C, left panels). In contrast, Syncytin-1 or -2, but not HML-2 expressing cells enhanced both LPS-driven IL12p70 and TNF-α release (IL-12 induction by HML-2 in iDCs was nonsignificant; Fig. 4A and B, right panels) which, as analyzed for IL-12p70, was also the case upon coculture with CHO cells transfected to express all three HERV env proteins simultaneously (not shown). Interestingly, IL-10 production was unaffected by the presence of either CHO transfectant (Fig. 4C, right panel). Altogether, these data indicate that HERV env exposure alone might promote production of proinflammatory instead of suppressive cytokines. Cytokine patterns induced in BeWo or JEG cell/DC cocultures are rather compatible with the induction of an antiinflammatory environment, most likely induced by factors other than HERV env proteins.

www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1748–1759

Immunomodulation

Figure 2. HERV env proteins do not inhibit T-cell expansion directly. (A) Expansion of CFSE-labeled T-cells alone (left panel) or cocultured with BeWo cells or CHO cells transfected with empty vector (NC), Syncytin-1, or -2 was determined five days following PMA/ionomycin activation by measuring the percentage of CFSE+ cells within the gated T-cell population by flow cytometry. Representative dot plots out of five experiments are shown. (B) Quantification of T-cell proliferation by flow cytometry analysis of CFSE labeled T-cells in the presence or absence of BeWo and JEG choriocarcinoma cell lines (left panel) or transfected CHO cells expressing HERV env (right panel). Bars show mean ± SEM from in five independent experiments and the values were normalized to unconditioned activated T-cells (set to 1). *p < 0.05, determined by ANOVA analysis of variance for multiple comparisons with Bonferroni post-test.

Exposure to CHO and choriocarcinoma effector cells impairs DC allostimulatory activity The ability of DCs cocultured with CHO effectors or BeWo or JEG cells to promote expansion of allogenic T-cells was addressed by performing MLRs. SEB-loaded LPS-matured DCs exposed to BeWo or JEG cells, but also to CHO effector cells were highly restricted in their ability to stimulate allogenic T-cell proliferation. Virtually no differences were seen in this regard between the HERV env proteins that did not appear to act additive when coexpressed (all p < 0.05; Fig. 5A). Corroborating the suppressive effect of both HERV env expressing CHO and choriocarcinoma effectors cells on DC-dependent T-cell activation, amounts of IFN-γ released into the supernatants of the respective MLRs were substantially lower than those measured in control cultures (Fig. 5B).

HERV env proteins affect DC/T-cell conjugate formation and activity Because recruitment into and maintenance within stable conjugates with DCs is prerequisite to T-cell activation, we analyzed  C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

whether conditioning by effector cells affected this parameter. For this, we analyzed formation of conjugates after 20 min of coculture of CFSE-labeled T-cells and allogenic SEB-loaded DCs preexposed to the effector cells by flow cytometry. Indeed, the frequency of conjugates formed between DCs preexposed to CHO cells expressing Syncytin-2 and HML-2 as well as BeWo and JEG cells with T-cells was significantly reduced as compared to control cultures (Fig. 6A). Though DCs conditioned by Syncytin-1-expressing CHO cells also tended to be restricted in their ability to conjugate allogenic T-cells, this did not reach statistical relevance (Fig. 6A). Impairments of conjugate formation upon effector cell preexposure could not be attributed to ICAM-1 or LFA-1 surface levels on DCs that were identical to those on controls (not shown). To assess whether conjugates formed were functional, T-cells were loaded with Fluo-4 prior to coculture with allogenic LPSmatured SEB-loaded DCs preexposed to effector cells or not and Ca2+ -mobilization was determined by flow cytometry. Preexposure to BeWo, JEG, and Syncytin-2- or HML-2-expressing CHO effector cells significantly impaired Ca2+ -mobilization as compared to control conjugates (Fig. 6B). DC conditioned by Syncytin-1 CHO cells were also less efficient at promoting Ca2+ -mobilization in T-cells, this did, however, not reach statistical significance www.eji-journal.eu

1751

1752

Jonas Hummel et al.

Eur. J. Immunol. 2015. 45: 1748–1759

Figure 3. LPS-driven upregulation of DC maturation markers is selectively affected by effector cells. Surface display of CD86 (A, B) and CD40 (C, D) was determined on gated CD11c+ DCs co-cultured for 24 h with BeWo or JEG cells (A, C) or CHO cells expressing HERV envs (B, D) and LPS stimulated or not was determined by by flow cytometry Bars show mean ± SEM out of three independent experiments;*p < 0.05; determined by ANOVA analysis of variance for multiple comparisons with Bonferroni post-test.

(Fig. 6B). Altogether, these findings indicate that at least a fraction of conjugates formed with DCs preexposed to effector cells is unable to promote T-cell activation. To study whether this would correlate with aberrant patterning within the IS, we analyzed subcellular distribution of tyrosine phosphorylated protein species (p-tyr) and f-actin within interfaces of SEB-loaded mDCs preexposed to effector cells or not and allogenic T-cells after 20 min. In control conjugates, f-actin was virtually excluded from the IS center and p-tyrspecific signals clearly accumulated within the interface, while conjugates involving effector cell conditioned DCs were prone to retain f-actin therein and p-tyr was barely detectable at the contact site (Fig. 6C and D). The seemingly strong f-actin accumulation in BeWo conditioned DCs was only seen upon immunofluorescence staining and not by flow cytometry (not shown). Altogether, these data support the interpretation that conditioning of DCs by HERV env proteins impairs their ability to efficiently form stable conjugates with T-cells, and the majority of those recruited appears to receive stimulatory signals insufficient to promote correct pattering within the IS and Ca2+ mobilization.

Discussion Using a transgenic expression system in CHO cells, we established that the HERV env proteins Syncytin-1, -2, and HML-2 act to suppress T-cell expansion not by directly acting on these targets. They rather condition monocyte-derived DCs that are subse C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

quently impaired in recruiting T-cells into stable conjugates and to promote Ca2+ mobilization (Syncytin-2, HML-2), correct IS patterning of f-actin and p-tyr in the IS and expansion of allogenic T-cells (all three env proteins). As they may be prerequisite for functional interactions (see below), expression of Syncytin-1 and -2 binding/fusion receptors on the surface of both T-cells and DCs was firstly established in our study (Fig. 1). Though in our system, both choriocarcinoma cell lines efficiently abrogated T-cell expansion, neither of the transgenic HERV env proteins impacted on this parameter of T-cell activation (Fig. 2B). It is unlikely that this was due to nonfunctional expression of these proteins on CHO cells, because both Syncytin-1 and -2 caused fusion late after coculture with cells expressing the respective receptors (not shown) and all env proteins efficiently acted on DCs to inhibit T-cell activation (Fig. 5). Moreover, surface expression levels of the transgenes did not markedly differ from, or even exceeded those measured on BeWo or JEG cells (Fig. 1B and C) strongly arguing against a dosage effect. It rather appears that surface proteins other than HERV env or in conjunction with them are active on choriocarcinoma cell lines to cause T-cell suppression. The transmembrane domain of recombinant HML-2 or its ISU peptide conjugated to BSA, were found to efficiently interfere with PBMC or splenocyte expansion driven by ConA or phytohemagglutinin [25]. This contrasts with the lack of HML-2 to inhibit T-cell expansion in our system (Fig. 2B). Reasons for this obvious discrepancy may include differences in the target cell population (T-cells enriched from human PBLs versus PBMCs or splenocytes), stimulation protocols (PMA/ionomycin versus lectin cross-linking) or, at least equally important, modes www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1748–1759

Immunomodulation

Figure 4. HERV env proteins promote release of proinflammatory cytokines. Release of (A) IL-12 p70 (B) TNF-α and (C) IL-10 from DCs after 24 h of coculture with BeWo or JEG cells (each left panels) or CHO cell expressing HERV envs (each right panels) and LPS stimulated or not was determined by flow cytometry bead assay. Bars show mean ± SEM from two independent experiments. The values were normalized to the release of each respective cytokine by unconditioned LPS-DCs (set to 1); *p < 0.05; determined by Student’s t-test.

of application of the effector proteins. These were provided as purified proteins or BSA-coupled peptides [25], or, by direct cell-tocell assay with surface expression of HERV env proteins and their receptors in our system. Notably, purified proteins or BSA-coupled peptides were inhibitory at high concentrations most likely exceeding those achieved upon transient expression in CHO or in BeWo or JEG cells. It is also possible that coculture with these, but not CHO effector cells acts to increase surface availability and or signaling properties of receptors relaying T-cell inhibitory signals. It is, however, unclear whether these are identical to ASCT-1, -2, or HML-2 that are known to bind HERV env proteins and support fusion, however, there is no evidence they interact with their ISDs [29, 30]. When used as effectors in cocultures with immature DCs, BeWo, and JEG cells did not alter LPS-induced phenotypic maturation of these antigen-presenting cells (Fig. 3). This mirrors observations made in cocultures involving peripheral DCs with primary first trimester trophoblasts where the cytokine profile released from DCs was altered and, by reduction of IL-12 and

 C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

TNF-α and increase in IL-10, was consistent with a noninflammatory, tolerogenic response [31–34]. Conditioning with choriocarcinoma cell lines appeared to fully mimic this effect on maturing DCs (Fig. 4). It is, however, not clear as to whether IL-10 production can be attributed to DCs only in these cocultures (Fig. 4C). This is because BeWo (but not JEG cells) constitutively produce IL-10 that is further increased by GM-CSF (also contained within the coculture maintenance medium) [35]. Because JEG cells were found LPS-reactive in terms of NF-κB activation and cytokine release, and express TLR4-specific transcripts these cells possibly also contribute to LPS-induced cytokine responses in the cocultures [35–37]. Preexposure to HERV env protein expressing effector cells (which do not release human cytokines and thereby not confound their analysis) did not affect of IL-10 release from iDCs or LPS-DCs indicating that, in case this is stimulated in cocultures with choriocarcinoma cells, factors other than the HERV envs would be responsible (Fig. 4C). Syncytin-1 and -2 were clearly also not involved in suppressing LPS-induced IL-12 and TNF-α induction both of which they rather

www.eji-journal.eu

1753

1754

Jonas Hummel et al.

Eur. J. Immunol. 2015. 45: 1748–1759

Figure 5. Coculture with effector cells impairs allostimulatory activity of DCs. (A) Expansion of allogenic T-cells stimulated by DCs (LPS-matured or not) cocultured with BeWo or JEG cells (left panel) or control vector transfected or HERV env expressing CHO cells (right panel) was measured after five days by H3 -thymidine incorporation. Bars show mean ± SEM of three independent experiments. The values were normalized to H3 -thymidine incorporation by T-cells stimulated with allogenic unconditioned LPS-DCs (set to 1); *p < 0.05; **p < 0.005; determined by ANOVA analysis of variance for multiple comparisons with Bonferroni post-test. (B) Supernatants of the MLRs in (A) were used to determine IFN-γ release by flow cytometry bead assay five days after MLR onset. Bars show mean ± SEM from two independent experiments. The values were normalized to IFN-γ production in cocultures involving unconditioned DCs and allogenic T-cells (set to 1); *p < 0.05; **p < 0.005; determined by Student’s t-test.

enhanced (Fig. 4). Though the capability of Syncytin-1 to promote TNF-α production from PBMCs or monocytes has been revealed, Syncytin-1 delivered by microvesicles inhibited LPS-induced production of this cytokine from PBMCs [38, 39]. An enhancing activity of Syncytin-1 on the release of proinflammatory mediators also including TNF-α and IL-12 was also reported from human monocytes in the absence of further activation [39], which does not match our observations made with iDCs (Fig. 4). Moreover, in this study, recombinant Syncytin-1 caused phenotypic maturation of monocytes, but also DCs as reflected by surface marker upregulation also including CD86 [39]. Though LPS-driven CD86 upregulation was also enhanced by Syncytin-1 and -2 expressing effector cells in our system, that of CD40 and CD80 as measured with recombinant Syncytin-1 was not [39]. Most likely, differences in effector structure display to target cells may account for the differential effects. Though their overall surface marker profile determined in response to LPS activation was consistent with fully matured DCs, DCs conditioned by HERV env interaction were substantially impaired in recruiting T-cells into stable conjugates (though less pronounced for Syncytin-1, Fig. 6A) and apparently, to efficiently activate T-cells still recruited as reflected by lower levels of Ca2+ mobilization (Syncytin-2, HML-2, less pronounced for Syncytin-1) and IFN-γ production (Figs. 5B and 6B). At a cellular level, this was accompanied by the inability of T-cells to spatially correctly organize f-actin and p-tyr protein species within the IS (Fig. 6C and D). DCs accumulate in the uterus during pregnancy (referred to as uterine DCs, uDCs). They are poorly characterized with regard to their distinctive phenotype, anatomical localization, and function, however, appear to be important in embryo implantation and,  C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

most likely, in regulating placenta-specific tolerance to the semiallograft [28, 40, 41]. There are several reports documenting that DCs conditioned by trophoblasts in vitro fail to promote expansion of T cells or stimulate differentiation of regulatory T cells, which was mainly attributed to the production of soluble mediators such as IDO, TSLP, or MIC-1 [32, 33, 42, 43]. Though we cannot exclude that soluble mediators may contribute in DC silencing by choriocarcinoma cells in our system, these are unlikely to contribute in cocultures involving CHO transfectants, which would only release hamster-specific factors not triggering a response in human target cells. Interference of the allostimulatory activity of DCs appeared more pronounced for conditioning by CHO transfectants than by BeWo or JEG cells (Fig. 5A) which was, however, inversed for parameters such as conjugate stabilities or Ca2+ mobilization (Fig. 6A and B) supporting the hypothesis that molecules other than the three HERV env proteins tested are present on or released by choriocarcinoma cells to modulate DCs. The mechanism of how the three HERV env proteins displayed on CHO cells exactly condition DCs remains to be resolved. As they are expressed on the DC surface, the Syncytin-1 and -2 receptors ASCT-1 and or -2 or MFSD2 are candidates to be involved. These large transmembrane proteins function as Na+-dependent exchange transporters for neutral amino acids (ASCT-1 and -2) or carbohydrates (MFSD2) and are expressed in the placenta [7, 12, 29, 30, 44, 45]. Their expression on uDCs has, however, not been directly confirmed. Their function has mainly been studied in nutrient transport, and their ablation may cause apoptosis in tumor cells supporting their importance in the tumor metabolome [45, 46]. There is, however, evidence that at least ASCT-2 may have activities other than serving as nutrient transporter [46] and it is possible, that HERV env interactions might trigger

www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1748–1759

 C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Immunomodulation

www.eji-journal.eu

1755

1756

Jonas Hummel et al.

signaling via these receptors (though not studied yet) or modify their nutrient transporter activities to modulate TLR4 driven maturation parameters essential for efficient T-cell conjugation and stimulation. Possibly, however, receptors others than ASCT-1, -2, or MFSD2 are required for HERV env conditioning. Firstly, there is no evidence for a direct interaction of ISDs with these fusion receptors. Secondly, the ISU activity of HERV env proteins can be separated from their fusogenic activity [17], rendering it very likely that alternative receptors are required for ISU. HERV env binding to their respective receptors may, however, act to strengthen the interaction of ISDs to uncharacterized ISU receptors that may be of low affinity in the absence of this support. Receptor binding might also act to chaperone and thereby stabilize a conformation required for exposure of residues important in ISD interaction with ISU receptors. This scenario is reminiscent to observations made for immunosuppression induced by the measles virus glycoprotein complex. There, T-cell inhibition relies on proteolytic cleavage of the fusion protein, however, also requires the hemagglutinin protein that mediates binding to entry receptors, but not immunosuppression [47].

Materials and methods Cell culture Choriocarcinoma BeWo and JEG cell lines and primary cells were maintained in RPMI medium supplied with 10% fetal calf serum (FCS) (Invitrogen), CHO (Chinese ovary hamster) cells were grown in minimal essential medium with 5% FCS. All culture media were supplemented with penicillin (50 U/mL) and streptomycin (50 μg/mL). T-cells and monocytes were enriched from blood samples of healthy donors (provided by the department of transfusion medicine and hemotherapy of the University Hospital Wuerzburg). All experiments involving human material were conducted according to the principles expressed in the Declaration of Helsinki and ethically approved by the Ethical commit-

Eur. J. Immunol. 2015. 45: 1748–1759

tee of the Medical Faculty of the University of Wuerzburg. Following Ficoll (Histopaq 1077, Sigma-Aldrich) gradient centrifugation, monocytes were separated from PBLs by adherence for 2 h in 10% FCS/RPMI medium. T-cells were enriched from the non-adherent fraction to about 70–80% purity by using nylon wool. Monocyte derived DCs were generated by culturing monocytes for five days in 10% FCS/RPMI supplemented with IL-4 (2.5 ng/mL; Miltenyi Biotec, Germany) and GM-CSF (90 ng/mL; Leukine [Sargramostim], Immunex) and the medium was refreshed every second day supplemented with fresh cytokines. When indicated, 100 μM forskolin (Sigma-Aldrich, St. Louis, Missouri, USA) was added to the culture medium.

Plasmid constructions and transfection Syncytin-1, -2, and HML-2-specific cDNAs were amplified from BeWo cell RNA by reverse transcription or using a CloneJET PCR cloning kit (Thermo Scientific) applying the following specific primer sets: Syncytin-1: FW: ATGGCCCTCCCTTATCATATTTTT, Rev: CTAACTGCTTCCTGCTGAATTG; Syncytin-2: FW: ATGGGCCTGCTCCTGCTGGT, Rev: TTAGAAGGGTGACTCTTGAATATT; HML-2: FW: TCAGCTTCCTGTTTGGATACCC, Rev: GCCTTGAGATTCTGTTAATVTAT) and cloned into a pCG vector. A total of 2—3 × 105 CHO cells were transfected in a 6-well plate with 3 μg DNA of pCG-Syncytin-1, -2, or -HML-2 by using 12 μg polyethylenimine (Polyscience) and transfection efficiencies were determined after 48 for up to 96 h by flow cytometry using FACS Calibur (Becton Dickinson).

Flow cytometry For detection of HERV env receptor proteins on DCs or T-cells (gated based on FSC/SSC), antibodies directed against SLC1A4 (ASCT-1; Abcam), SLC1A5 (ASCT-2; Creative BioMart) MFSD2A (LifeSpan BioSciences), Syncytin-1 (Antibody online), Syncytin2 (Biocat), and HML-2 (Austral Biologicals) were used, followed by secondary anti-rabbit alexa 647 (Invitrogen) or an anti-mouse



Figure 6. DC preexposure to effector cells reduces DC/T-cell conjugate frequencies, impairs Ca2+− mobilization, and alters immune synapse architecture. (A) SEB-loaded DCs (LPS-matured or not) preexposed to BeWo or JEG cells (left panel) or CHO transfectants (right panel) were cocultured with CFSE-labeled allogenic T-cells and the efficiency of conjugate formation was determined after 20 min by measuring the percentage of CFSE+ cells within the gated DC population by flow cytometry. Bars show mean ± SEM from three independent experiments. The values were normalized to unconditioned DC conjugates (set to 1); *p < 0.05; **p < 0.005; determined by ANOVA analysis of variance for multiple comparisons with Bonferroni post-test. (B) SEB-loaded DCs (LPS-matured) preexposed to BeWo or JEG cells (left panel) or CHO transfectants (right panel) were cocultured with Fluo-4-labeled allogenic T-cells and Ca2+ mobilization within conjugates was determined after 20 min by flow cytometry by measuring of Fluo-4 intensity within the gated DC population. Bars show mean ± SEM from five independent experiments. The values were normalized to unconditioned LPS-DCs (set to 1); *p < 0.05; **p < 0.005; determined by ANOVA analysis of variance for multiple comparisons with Bonferroni post-test. (C) Conjugates formed between SEB loaded mDCs preexposed to JEG or BeWo cells or CHO transfectants and allogenic T-cells were fixed after 20 min and tyrosine phosphorylated proteins (green) and f-actin (red) were detected. DC/T-cell interface areas were acquired (as exemplified by the boxed areas (each left panel)) and used for 3D reconstructions. The view from T cell side toward the synapse of each one representative out of at least 30 conjugates analyzed is shown. (CHO-NC: CHO cell empty vector control; Syn-1: Syncytin-1; Syn-2: Syncytin-2). Magnification: 40 × oil objective (Plan-Apochromat). (D) Quantitative assessment of p-tyr IS accumulation in T-cells recruited into conjugates with DCs conditioned by BeWo or JEG cells (left panel) or CHO transfectants (right panel) or left unconditioned or preexposed to vector transfected CHO cells, respectively (each 30 conjugates were analyzed). Black bars represent total numbers of conjugates and white bars represent number of p-tyr accumulating conjugates. Bars show mean ± SEM from 30 analyzed conjugates from two individual experiments. The values were normalized to unconditioned LPS-DCs (set to 1); *p < 0.05; **p < 0.005; determined by Student’s t-test.  C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1748–1759

alexa 488 antibody (Invitrogen) for 45 min at 4°C. Surface expression of CD40, CD80, CD83, and CD86 (all: BD) on gated CD11+ DCs were measured by using directly conjugated antibodies for 45 min at 4°C and analyzed in a final concentration of 1 × 105 cells/100 μL with BD FACS Calibur using Flowjo software (Ashland). Levels of LFA-1 (NKI-15, kindly provided by T. Geijtenbeek, Amsterdam) and ICAM-1 (Chemicon) were determined on iDCs or LPS-DCs 24 h following conditioning by the respective effector cell population.

DC coculture assay and cytokine measurement Each 5 × 105 DCs per well (Greiner Bio-One) were cocultured with each 2.5 × 105 CHO (used 48 h following transfection with the respective pCG-construct or the empty vector), BeWo or JEG cells for 24 h. Cocultures also containing the effector cells were kept for further 24 h with fresh media and cytokines in the presence or absence of LPS (100 ng/mL; Sigma Aldrich) and DCs were immediately used for flow cytometry analysis of surface marker expression and for MLRs. Supernatants were snap frozen and stored at –80°C until cytokine measurement using the FlowCytomixTM multiplex bead system (eBioscience) according to manufacturers instructions. The beads were measured with a BD FACS Calibur and the data were analyzed by eBioscience FlowCytomix Pro software.

T-cell proliferation assay and mixed leukocyte reaction Each 2.5 × 105 cells/well CHO transfectants or BeWo and JEG cells were cocultured with CFSE-labeled T-cells (2.5 μM; Molecular Probes) for 24 h and subsequently stimulated with phorbol myristate acetate (PMA; 40 ng/mL; Invitrogen)/ionomycin (0.5 μM; Sigma Aldrich). Following removal of the effector cells 48 h following stimulation, CFSE intensity was analyzed in the gated T-cell population after five days by flow cytometry (BD FACS Calibur). For MLRs, DCs, LPS activated or not (2 × 104 cells/well 96-well plate (BD)) and precultured with CHO, BeWo, or JEG effector cells were cocultured with 2 × 105 allogenic T cells. After four days, H3 -thymidine was added and T-cell proliferation was measured after an 18 h H3 -thymidine pulse (0.5 μCi/well; Hartmann Analytic).

Immunomodulation

T-cells within the DC population (defined by FSC and SSC) were quantified by flow cytometry. For imaging IS analyses, 2.5 × 104 SEB loaded DCs were seeded onto a poly-l-lysine coated 8-well chamber slides (Nunc, Lab-TekII Chamber Slide) for 20 min at 37°C and a tenfold excess of T-cells was added. After 20 min at 37°C conjugates were fixed, and tyrosine phosphorylated proteins (p-tyrosine) and f-actin were detected using a specific antibody (anti-p-tyrosine, 4G10) or phalloidin alexa 594 (both: Invitrogen), analyzed by confocal microscopy (Zeiss LSM 780) and processed with ZEN software. Images were taken with a 40× oil objective (Plan-Apochromat) at laser lines 488 nm and 594 nm. The IS interface was analyzed by visualization of 20–30 z-sections in a 0.15 μm interval. 3D reconstructions were performed using ZEN software. Quantifications involved at least 30 conjugates per sample.

Statistical analysis The statistical analysis was assessed by Prism4 software (GraphPad, San Diego, CA, USA). Statistical significance was determined using one-way analysis of variance for multiple comparisons with Bonferroni post-test or Student’s t-test (*p < 0.05, **p < 0005; ns: nonsignificant).

Acknowledgments: We thank J¨ urgen Schneider-Schaulies, and Manfred Lutz for helpful discussion, Rebekka Springel, Belinda Aul, Charlene B¨ ortlein, and Michaela Kapp for excellent technical assistance and the Interdisciplinary Center for Clinical Research, University of W¨ urzburg, for financial support (A-196: SchneiderSchaulies/K¨ ammerer).

Conflict of interest: The authors declare no commercial or financial conflict of interest.

References 1 Bannert, N. and Kurth, R., Retroelements and the human genome: new perspectives on an old relation. Proc. Natl. Acad. Sci. USA 2004. 101(Suppl 2): 14572–14579.

Conjugate and IS analyses

2 Boller, K., Schonfeld, K., Lischer, S., Fischer, N., Hoffmann, A., Kurth, R. and Tonjes, R. R., Human endogenous retrovirus HERV-K113 is capable

For DC/T cell conjugate quantification, 5 × 105 cells/well Staphylococcus aureus enterotoxin B (SEB) (1 μg/mL; Sigma Aldrich) loaded DCs were cocultured with 5 × 106 allogenic T-cells for 20 min at 37°C. Prior to onset of the coculture, T cells were labeled with either CFSE (2.5 μM; Molecular Probes) for 5 min or Fluo-4 (Molecular Probes) according to the manufacturers instructions. For DC/T cell conjugate analysis, CFSE or Fluo-4 positive  C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

of producing intact viral particles. J. Gen. Virol. 2008. 89: 567–572. 3 Kassiotis, G., Endogenous retroviruses and the development of cancer. J. Immunol. 2014. 192: 1343–1349. 4 Harris, J. R., Placental endogenous retrovirus (ERV): structural, functional, and evolutionary significance. Bioessays 1998. 20: 307–316. 5 Kammerer, U., Germeyer, A., Stengel, S., Kapp, M. and Denner, J., Human endogenous retrovirus K (HERV-K) is expressed in villous and extravillous

www.eji-journal.eu

1757

1758

Jonas Hummel et al.

cytotrophoblast cells of the human placenta. J. Reprod. Immunol. 2011. 91: 1–8. 6 Blond, J. L., Beseme, F., Duret, L., Bouton, O., Bedin, F., Perron, H., Mandrand, B. et al., Molecular characterization and placental expression of HERV-W, a new human endogenous retrovirus family. J. Virol. 1999. 73: 1175–1185.

Eur. J. Immunol. 2015. 45: 1748–1759

22 Denner, J., Wunderlich, V. and Bierwolf, D., Suppression of human lymphocyte mitogen response by proteins of the type-D retrovirus PMFV. Int. J. Cancer 1986. 37: 311–316. 23 Denner, J., Immunosuppression by retroviruses: implications for xenotransplantation. Ann. NY Acad. Sci. 1998. 862: 75–86. 24 deParseval, N., Lazar, V., Casella, J. F., Benit, L. and Heidmann, T., Survey

7 Blond, J. L., Lavillette, D., Cheynet, V., Bouton, O., Oriol, G., Chapel-

of human genes of retroviral origin: identification and transcriptome of

Fernandes, S., Mandrand, B. et al., An envelope glycoprotein of the

the genes with coding capacity for complete envelope proteins. J. Virol.

human endogenous retrovirus HERV-W is expressed in the human pla-

2003. 77: 10414–10422.

centa and fuses cells expressing the type D mammalian retrovirus receptor. J. Virol. 2000. 74: 3321–3329. 8 Malassine, A., Blaise, S., Handschuh, K., Lalucque, H., Dupressoir, A., Evain-Brion, D. and Heidmann, T., Expression of the fusogenic HERVFRD Env glycoprotein (syncytin 2) in human placenta is restricted to villous cytotrophoblastic cells. Placenta 2007. 28: 185–191. 9 Malassine, A., Frendo, J. L., Blaise, S., Handschuh, K., Gerbaud, P., Tsatsaris, V., Heidmann, T. et al., Human endogenous retrovirus-FRD envelope protein (syncytin 2) expression in normal and trisomy 21-affected placenta. Retrovirology 2008. 5: 6. 10 Mi, S., Lee, X., Li, X., Veldman, G. M., Finnerty, H., Racie, L., LaVallie, E. et al., Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 2000. 403: 785–789. 11 Vargas, A., Toufaily, C., LeBellego, F., Rassart, E., Lafond, J. and Barbeau, B., Reduced expression of both syncytin 1 and syncytin 2 correlates with severity of preeclampsia. Reprod. Sci. 2011. 18: 1085–1091.

25 Morozov, V. A., Dao Thi, V. L. and Denner, J., The transmembrane protein of the human endogenous retrovirus–K (HERV-K) modulates cytokine release and gene expression. PLoS One 2013. 8: e70399. 26 Ruprecht, K., Mayer, J., Sauter, M., Roemer, K. and Mueller-Lantzsch, N., Endogenous retroviruses and cancer. Cell Mol. Life Sci. 2008. 65: 3366–3382. 27 Tolosa, J. M., Schjenken, J. E., Clifton, V. L., Vargas, A., Barbeau, B., Lowry, P., Maiti, K. et al., The endogenous retroviral envelope protein syncytin-1 inhibits LPS/PHA-stimulated cytokine responses in human blood and is sorted into placental exosomes. Placenta 2012. 33: 933–941. 28 Bartmann, C., Segerer, S. E., Rieger, L., Kapp, M., Sutterlin, M. and Kammerer, U., Quantification of the predominant immune cell populations in decidua throughout human pregnancy. Am. J. Reprod. Immunol. 2014. 71: 109–119. 29 Esnault, C., Priet, S., Ribet, D., Vernochet, C., Bruls, T., Lavialle, C., Weis-

12 Lee, X., Keith, J. C., Jr., Stumm, N., Moutsatsos, I., McCoy, J. M., Crum,

senbach, J. et al., A placenta-specific receptor for the fusogenic, endoge-

C. P., Genest, D. et al., Downregulation of placental syncytin expression

nous retrovirus-derived, human syncytin-2. Proc. Natl. Acad. Sci. USA 2008.

and abnormal protein localization in pre-eclampsia. Placenta 2001. 22:

105: 17532–17537.

808–812. 13 Kalter, S. S., Helmke, R. J., Heberling, R. L., Panigel, M., Fowler, A. K., Strickland, J. E. and Hellman, A., Brief communication: C-type particles in normal human placentas. J. Natl. Cancer Inst. 1973. 50: 1081–1084. 14 Larsson, E. and Andersson, G., Beneficial role of human endogenous retroviruses: facts and hypotheses. Scand. J. Immunol. 1998. 48: 329–338.

30 Hayward, M. D., Potgens, A. J., Drewlo, S., Kaufmann, P. and Rasko, J. E., Distribution of human endogenous retrovirus type W receptor in normal human villous placenta. Pathology 2007. 39: 406–412. 31 Grasso, E., Paparini, D., Hauk, V., Salamone, G., Leiros, C. P. and Ramhorst, R., Differential migration and activation profile of monocytes after trophoblast interaction. PLoS One 2014. 9: e97147.

15 Rote, N. S., Chakrabarti, S. and Stetzer, B. P., The role of human endoge-

32 Salamone, G., Fraccaroli, L., Gori, S., Grasso, E., Paparini, D., Geffner, J.,

nous retroviruses in trophoblast differentiation and placental develop-

Perez Leiros, C. et al., Trophoblast cells induce a tolerogenic profile in

ment. Placenta 2004. 25: 673–683.

dendritic cells. Hum. Reprod. 2012. 27: 2598–2606.

16 Blaise, S., deParseval, N., Benit, L. and Heidmann, T., Genomewide

33 Du, M. R., Guo, P. F., Piao, H. L., Wang, S. C., Sun, C., Jin, L. P., Tao, Y.

screening for fusogenic human endogenous retrovirus envelopes identi-

et al., Embryonic trophoblasts induce decidual regulatory T cell differen-

fies syncytin 2, a gene conserved on primate evolution. Proc. Natl. Acad.

tiation and maternal-fetal tolerance through thymic stromal lymphopoi-

Sci. USA 2003. 100: 13013–13018.

etin instructing dendritic cells. J. Immunol. 2014. 192: 1502–1511.

17 Mangeney, M., Renard, M., Schlecht-Louf, G., Bouallaga, I., Heidmann,

34 Guo, P. F., Du, M. R., Wu, H. X., Lin, Y., Jin, L. P. and Li, D. J., Thymic stro-

O., Letzelter, C., Richaud, A. et al., Placental syncytins: genetic disjunc-

mal lymphopoietin from trophoblasts induces dendritic cell-mediated

tion between the fusogenic and immunosuppressive activity of retroviral

regulatory TH2 bias in the decidua during early gestation in humans.

envelope proteins. Proc. Natl. Acad. Sci. USA 2007. 104: 20534–20539.

Blood 2010. 116: 2061–2069.

18 Denner, J., The transmembrane proteins contribute to immunodefi-

35 Bennett, W. A., Lagoo-Deenadayalan, S., Whitworth, N. S., Brackin, M.

ciencies induced by HIV-1 and other retroviruses. AIDS 2014. 28: 1081–

N., Hale, E. and Cowan, B. D., Expression and production of interleukin-

1090.

10 by human trophoblast: relationship to pregnancy immunotolerance.

19 Haraguchi, S., Good, R. A., Cianciolo, G. J., Engelman, R. W. and Day, N. K.,

Early Pregnancy 1997. 3: 190–198.

Immunosuppressive retroviral peptides: immunopathological implica-

36 Komine-Aizawa, S., Majima, H., Yoshida-Noro, C. and Hayakawa, S.,

tions for immunosuppressive influences of retroviral infections. J. Leukoc.

Stimuli through Toll-like receptor (TLR) 3 and 9 affect human chorionic

Biol. 1997. 61: 654–666.

gonadotropin (hCG) production in a choriocarcinoma cell line. J. Obstet.

20 Cianciolo, G. J., Copeland, T. D., Oroszlan, S. and Snyderman, R., Inhibition of lymphocyte proliferation by a synthetic peptide homologous to retroviral envelope proteins. Science 1985. 230: 453–455. 21 Weislow, O. S., Fisher, O. U., Jr., Twardzik, D. R., Hellman, A. and

Gynaecol. Res. 2008. 34: 144–151. 37 Tangeras, L. H., Stodle, G. S., Olsen, G. D., Leknes, A. H., Gundersen, A. S., Skei, B., Vikdal, A. J. et al., Functional Toll-like receptors in primary first-trimester trophoblasts. J. Reprod. Immunol. 2014. 106: 89–99.

Fowler, A. K., Depression of mitogen-induced lymphocyte blastogene-

38 Holder, B. S., Tower, C. L., Forbes, K., Mulla, M. J., Aplin, J. D. and Abra-

sis by baboon endogenous retrovirus-associated components. Proc. Soc.

hams, V. M., Immune cell activation by trophoblast-derived microvesi-

Exp. Biol. Med. 1981. 166: 522–527.

cles is mediated by syncytin 1. Immunology 2012. 136: 184–191.

 C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 1748–1759

Immunomodulation

39 Rolland, A., Jouvin-Marche, E., Viret, C., Faure, M., Perron, H. and Marche,

46 Fuchs, B. C., Perez, J. C., Suetterlin, J. E., Chaudhry, S. B. and Bode, B. P.,

P. N., The envelope protein of a human endogenous retrovirus-W family

Inducible antisense RNA targeting amino acid transporter ATB0/ASCT2

activates innate immunity through CD14/TLR4 and promotes Th1-like

elicits apoptosis in human hepatoma cells. Am. J. Physiol. Gastrointest.

responses. J. Immunol. 2006. 176: 7636–7644.

Liver Physiol. 2004. 286: G467–G478.

40 Plaks, V., Birnberg, T., Berkutzki, T., Sela, S., BenYashar, A., Kalchenko,

47 Schneider-Schaulies, J. and Schneider-Schaulies, S., Receptor inter-

V., Mor, G. et al., Uterine DCs are crucial for decidua formation during

actions, tropism, and mechanisms involved in morbillivirus-induced

embryo implantation in mice. J. Clin. Invest. 2008. 118: 3954–3965.

immunomodulation. Adv. Virus Res. 2008. 71: 173–205.

41 Laskarin, G., Kammerer, U., Rukavina, D., Thomson, A. W., Fernandez, N. and Blois, S. M., Antigen-presenting cells and materno-fetal tolerance: an emerging role for dendritic cells. Am. J. Reprod. Immunol. 2007. 58: 255– 267. 42 Ban, Y., Chang, Y., Dong, B., Kong, B. and Qu, X., Indoleamine 2,3dioxygenase levels at the normal and recurrent spontaneous abortion

Abbreviations: ERV: endogenous retrovirus · FCS: fetal calf serum · HERV: human endogenous retrovirus · iDC: immature DC · IS: immune synapse · ISD: immunosuppressive domain · ISU: immunosuppression

fetal-maternal interface. J. Int. Med. Res. 2013. 41: 1135–1149. 43 Segerer, S. E., Rieger, L., Kapp, M., Dombrowski, Y., Muller, N., Dietl, J. and Kammerer, U., MIC-1 (a multifunctional modulator of dendritic cell phenotype and function) is produced by decidual stromal cells and trophoblasts. Hum. Reprod. 2012. 27: 200–209.

Full correspondence: Dr. Sibylle Schneider-Schaulies, Institute for Virology and Immunobiology, University of Wuerzburg, Versbacher Str. 7, D-97078 Wuerzburg, Germany e-mail: [email protected]

44 Green, B. J., Lee, C. S. and Rasko, J. E., Biodistribution of the RD114/mammalian type D retrovirus receptor, RDR. J. Gene Med. 2004. 6: 249–259. 45 Fuchs, B. C. and Bode, B. P., Amino acid transporters ASCT2 and LAT1 in cancer: partners in crime? Semin. Cancer Biol. 2005. 15: 254–266.

 C 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Received: 24/11/2014 Revised: 4/2/2015 Accepted: 3/3/2015 Accepted article online: 9/3/2015

www.eji-journal.eu

1759