GENE-39316; No. of pages: 7; 4C: Gene xxx (2013) xxx–xxx
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
4 5 6Q2 7Q3 8 9
Miao Fu a,d, Yan Gao a, Qiuju Zhou a, Qi Zhang a, Ying Peng b,c,1, Kegang Tian e, Jinhua Wang d, Xiaoqun Zheng a,b,c,⁎ a
Department of the Laboratory Medicine, The Second Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China School of Laboratory Medicine and Life Science, Wenzhou Medical University, Wenzhou, Zhejiang, China Key Laboratory of Laboratory Medicine, Ministry of Education, China d Jinhua Municipal Central Hospital, Jinhua, Zhejiang, China e Qingdao Municipal Central Hospital, Qingdao, Zhejiang, China b c
a r t i c l e
i n f o
P
10
a b s t r a c t
Background: MicroRNAs (miRNAs) play important roles in regulating gene expression of plants, animals and viruses. Comprehensive characterization of host and viral miRNA will help uncover the molecular mechanisms that underlie the progression of human cytomegalovirus (HCMV) latent infection. To investigate the miRNA expression profile of HCMV and host cells during latent infection, we performed deep-sequencing analysis of the small RNAs isolated from HCMV-infected and mock-infected human monocytic leukemia cell line, THP-1. Results: We established a HCMV latent infection cell model using the THP-1 cells. High-throughput sequencing technology was used to sequence small RNA libraries of the HCMV-infected and mock-infected THP-1 and to investigate their small RNA transcriptomes. We found eight miRNAs including miR-US25-1, miR-US25-2-5p and miR-UL112 that were expressed by HCMV during latent infection. The expressions of the host miRNAs were also affected by HCMV latent infection. At least 49 cellular miRNAs were differentially expressed: 39 were upregulated and 10 were down-regulated upon HCMV latent infection. The expression of the human miRNA hsamiR-124-3p was significantly up-regulated in the HCMV latent infection library. In addition, we found 14 cellular novel miRNAs in the HCMV-infected and mock-infected THP-1 libraries. Functional annotation of the target genes of the differentially expressed miRNAs suggested that the majority of the genes are involved in melanogenesis, pathways in cancer, endocytosis and wnt signaling pathway. Conclusions: The small RNA transcriptomes obtained in this study demonstrate the usefulness of the deepsequencing combined with bioinformatics approach in understanding of the expression and function of host and viral small RNAs in HCMV latent infection. This approach can also be applied to the study of other kinds of viruses. © 2013 Published by Elsevier B.V.
D
Article history: Accepted 6 December 2013 Available online xxxx
C
T
E
Keywords: Human cytomegalovirus Latent infection MiRNA Deep-sequencing Differentially expression
46
Abbreviations: miRNAs, microRNAs; HCMV, human cytomegalovirus; THP-1, human monocytic leukemia cell line; nt, nucleotides; mRNAs, messenger RNAs; 3′ UTR, 3′ untranslated regions; AIDS, Acquired Immune Deficiency Syndrome; HSV-1, herpes simplex virus 1; LATs, latency-associated transcripts; KSHV, Kaposi's sarcoma-associated herpesvirus; EBV, Epstein–Barr virus; MICB, major histocompatibility complex class 1-related chain B; smRNA, small RNA; HEL, Human embryonic lung; FBS, fetal bovine serum; MOI, multiplicity of infection; RT-PCR, reverse transcriptase PCR; qPCR, quantitative real-time PCR; IE, immediate early; TBE, tris–borate-EDTA; UCSC, University of California, Santa Cruz; KEGG, Kyoto encyclopedia of Genes and Genomes; DAVID, The Database for Annotation, Visualization and Integrated Discovery; snRNA, small nuclear RNA; LUNA, latency unique nuclear antigen; LAcmvIL-10, latency-associated cmvIL-10; vIL-10, HCMV IL-10; ER, endoplasmic reticulum; ERAP, endoplasmic reticulum associated aminopeptidase; CTLs, cytotoxic T lymphocytes; C/EBPα, CCAAT/enhancer-binding protein α; MAPKs, mitogenactivated protein kinase; mTOR, mammalian target of rapamycin. ⁎ Corresponding author at: Department of the Laboratory Medicine, The Second Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China. E-mail address: [email protected] (X. Zheng). 1 Current address: University of Missouri—Columbia, MO.
U
47
N C O
R
R
E
11 12 13 14 16 15 17 18 19 20 21 22 23
F
3Q1
O
2
Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA
R O
1
24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 45 44
1. Introduction
48
MicroRNAs (miRNAs) are short (about 22 nucleotides (nt)) RNAs that are involved in the posttranscriptional regulation of their target messenger RNAs (mRNAs). Generally, miRNAs bind to complimentary sequences in the 3′ untranslated regions (3′ UTR) of the mRNAs resulting in inhibiting translation and/or promoting mRNA degradation (Bartel and Chen, 2004). More than 200 viral miRNAs including from the herpesvirus have been identified by bioinformatic, sequencing, and direct cloning approaches (see review (Skalsky and Cullen, 2010)). Human cytomegalovirus (HCMV) is a member of the herpesvirus family, and it can maintain a persistent or latent infection during the lifetime of the virus in its host. Patients who are immunocompromised as a result of either AIDS or organ transplant-associated immunosuppression are extremely susceptible to HCMV infection (Khoshnevis and Tyring, 2002), and this observation has further energized HCMV studies. An understanding of the molecular basis of HCMV latency
49 50
0378-1119/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.gene.2013.12.012
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
51 52 53 54 55 56 57 58 59 60 61 62 63
118 119
Human embryonic lung (HEL) fibroblasts cells were obtained from the Kunming Institute of Zoology, Chinese Academy of Sciences, and THP-1 cells were obtained from the Cell Bank of Shanghai Institute. Both cell types were cultured at 37 °C with 5% CO2. HEL cells were cultured in Dulbecco's modified Eagle's medium (Gibco), while the THP-1 cells were maintained in RPMI 1640 medium (Gibco). Both media were supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 units/ml penicillin, and 100 μg/ml streptomycin.
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113
120 121 122 123 124 125
C
87 88
E
85 86
R
83 84
R
81 82
O
79 80
C
77 78
N
75 76
U
73 74
2.2. Isolation of RNA
134
The total RNA was extracted from cells using Trizol (Invitrogen) according to the manufacturer's instructions. Aliquots of total RNA were either used directly to analyze the expression of HCMV latencyassociated transcripts by reverse transcriptase PCR (RT-PCR), or subjected to smRNA library construction, or used for miRNA quantification by quantitative real-time PCR (qPCR).
135 136
2.3. RT-PCR and quantification of viral DNA
141
An RT-PCR kit (TaKaRa) was used according to the manufacturer's recommendations to analyze the expression of HCMV latencyassociated transcripts. The primers that were used to amplify the cDNA are listed in Table S1. Total DNAs were isolated from the cells using the QIAamp DNA mini kit (Qiagen). The DNA was then subjected to a qPCR assay using the primers of immediate early (IE) genes (Table S1).
142
F
2.1. Cells culture and virus infections
71 72
O
117
70
R O
2. Materials and methods
68 69
126 127
P
116
66 67
The HEL cells were infected with a low-passage-number clinical isolate of HCMV (strain Toledo), at a multiplicity of infection (MOI) of 1, whereas THP-1 cells were infected at an MOI of 5. Viral titers were determined used standard plaque assays as previously described (Prichard et al., 1999), and the virus stock was stored at − 80 °C. The cells were infected as previously described (Reeves et al., 2005). Mock-infected cells were incubated with equal volumes of the culture media.
2.4. Small RNA library construction and deep-sequencing data analysis
128 129 130 131 132 133
137 138 139 140
143 144 145 146 147 148 149
The isolated total RNA was size-fractionated on a 15% tris–borateEDTA (TBE) urea polyacrylamide gel to isolate RNA with 18–30-nucleotide (nt) in size. These small RNAs were then ligated with 3′ and 5′ adapters and were reversely transcribed to cDNA. The cDNA were used templates for PCR amplification using the Solexa's small RNA primer set and sequenced using an Illumina GA IIx according to the manufacturer's protocols. Contaminant reads were removed and the final cleaned reads were refined. Data analysis of the smRNA transcriptome was performed using the mirTools program (Zhu et al., 2010). In brief, the filtered data sets containing smRNAs 18 to 30 nt long were then aligned to an index composed of both the human (University of California, Santa Cruz [UCSC] hg19 [http://genome.ucsc.edu]) and HCMV strain Toledo complete genome (GU937742.1) using the SOAP 2.0 program and allowing, at most, two mismatches. SmRNA annotations were obtained from miRBase, version v.18.0 (http://www.mirbase.org), and the UCSC Table Browser. To compare differentially expressed human miRNAs between HCMV-infected and mock-infected THP-1 cells, HCMV miRNA counts were removed from the data sets and the read counts of each identified miRNAs was normalized to the total number of miRNA reads. The target genes for each differentially expressed miRNA were predicted using miRanda (http://www.microrna.org/), and RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/rnahybrid/). The predicted target genes were annotated with KEGG pathways using the DAVID gene annotation tool (http://david.abcc.ncifcrf.gov/UTH) as described previously (Xu et al., 2010).
150 151
2.5. Real-time RT-PCR analysis of the miRNAs
176
miRNA cDNA was generated from the total RNA using an RT-PCR kit (TaKaRa) in 20-μl reaction mixtures containing 1 pmol of the miRNAspecific RT primer and 800 ng of total RNA, at 42 °C for 30 min with a final incubation at 95 °C for 5 min. The miRNA real-time RT-PCR was carried out using a miScript SYBR Green PCR kit (TaKaRa) on an Applied Biosystems 7900 real-time PCR machine (ABI). The PCR reaction was conducted at 95 °C for 30 s, followed by 40 cycles of incubation at
177 178
T
114 115
may help shed light on possible treatment strategies for HCMV infection. Whereas the limited protein-coding genes are expressed, many miRNAs are known to be transcribed during latency. For example, the herpes simplex virus 1 (HSV-1) miRNAs lie within the latencyassociated transcripts (LATs) and a fifth HSV-1 miRNA was identified in latently infected trigeminal ganglia (Umbach et al., 2008). The Kaposi's sarcoma-associated herpesvirus (KSHV) and Epstein–Barr virus (EBV) miRNAs are also transcribed and available to function during latent infection (Cai et al., 2005, 2006). In addition to encoding their own miRNAs, viruses are known to modulate the levels and functions of cellular miRNAs and vice versa. It has been reported that the HIV-1 down regulates many cellular miRNAs including the polycistronic cluster miR17/92, which has been implicated in many roles including cellular differentiation and proliferation (Triboulet et al., 2007). HCMV miR-UL112-1 can suppress the expression of MICB, which is a ligand of NKG2D, the natural killer cell activating receptor (Stern-Ginossar et al., 2007). To date, 17 HCMV miRNAs have been identified in cells undergoing lytic infection (see review (Tuddenham and Pfeffer, 2011)), but whether or not HCMV miRNAs are expressed during latent infection is still an open question. Deep-sequencing technologies have been used to discover new miRNAs. These technologies support a quantitative and in-depth investigation of small RNA (smRNA) transcriptomes. Deep-sequencing of the HCMV genome has revealed two novel HCMV miRNAs, miR-US22 and miRUS33as during lytic infection (Stark et al., 2012). However, the deep-sequencing technology has not been extended to analyze the smRNAs of HCMV latent-infected cells. Previous microarray-based studies have been limited to the assessment of cellular miRNAs levels (Wang et al., 2008). Recent studies suggest that miRNAs may play an important role in regulating HCMV gene expression and latency (Grey et al., 2007). The aim of the present study is to identify the miRNAs that are encoded by the HCMV genome and to determine their expression levels in latent-infected human monocytic leukemia cell line, THP-1, as well as cellular miRNA expression after HCMV infection. Firstly, we performed a comprehensive analysis by deep-sequencing of all smRNAs from HCMV infected THP-1 cells and fully characterized both the viral and human miRNA profiles. This led to the discovery of eight miRNAs that are expressed by the HCMV genome during latent infection and including miR-US25-1, miR-US25-2-5p and miR-UL112. Moreover, we found that a large number of cellular miRNAs are altered during latent carriage of HCMV and identified 49 miRNAs that are differentially expressed; hsa-miR-124-3p, for example, was increased in HCMV-infected THP-1 cell. Finally, the function annotation of the target genes of the differentially expressed miRNAs suggested that the majority of the genes are involved in melanogenesis, pathways in cancer, endocytosis and wnt signaling pathway. Identification of the HCMV miRNAs that are expressed during latency is crucial for us to understand their roles in HCMV persistence, pathogenesis, and disease. Similarly, knowledge of the host miRNAs that are expressed during latent infection will contribute to a more complete picture of HCMV pathogenesis and aid researchers in developing tools to combat the virus.
D
64 65
M. Fu et al. / Gene xxx (2013) xxx–xxx
E
2
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175
179 180 181 182 183
M. Fu et al. / Gene xxx (2013) xxx–xxx
3. Results
189
3.1. The establishment of a HCMV latent infection cell model
190 191
THP-1 cells were infected at the high MOI of 5 with HCMV, and the intracellular viral DNA was measured by three independent real-time PCR experiments with primers specific for the IE gene. Viral DNA was maintained but failed to accumulate (Fig. 1A). The levels of viral DNA loads are likely consistent with previous study reflecting these experimentally infected cells as a robust model of latency (Jayarama et al., 2006). Three HCMV latency-associated transcripts have been described previously. Latency unique nuclear antigen (LUNA) RNA is coded
201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216
We prepared short cDNA libraries corresponding to 18 to 30 nt long sequences from HCMV-infected and mock-infected THP-1 cells at 10 d post-infection. High-throughput sequencing of the two smRNA libraries using the Illumina deep sequencing platform generated 11,372,154 and 10,894,624 clean reads for HCMV-infected and mock-infected THP-1 cells, respectively. An average of 43% of the smRNA reads were mapped uniquely to the human and viral genomes, allowing for, at most, two mismatches. From the length distributions of the smRNAs from both libraries, we found that the majorities were 22 nt in length (Fig. 2). This is consistent with the typical size of mature miRNAs. These results indicate that miRNAs have been enriched successively from both libraries.
218 219
3.3. Identification of HCMV miRNAs during latency
229
HCMV has been reported to encode 17 known mature miRNAs from 11 precursors (Tuddenham and Pfeffer, 2011). In this study, we found that eight of these miRNAs are expressed in the latent-infected THP-1 cells. Sequence information and read counts for these miRNAs are summarized in Table 1 and the relative abundances of the miRNAs are shown in (Fig. 3). Our data reveal that HCMV miR-US25-1 has the highest read count (176) followed by miR-US25-2-5p (45) and miRUL112 (13), constituting 65.2%, 10.7% and 5.6%, respectively, out of all reads mapped to HCMV miRNAs. Reads for the other known HCMV mature miRNAs, miR-UL70-3P, miR-UL70-5p, miR-US33-5p, miR-UL22A,
230
P
217
D
Fig. 1. Establishment of HCMV latent infection cell model (A) The THP-1 cells(1 × 106/ml, MOI = 5) was infected by HCMV as described in the Materials and methods section. Viral DNA was extracted from 1, 2, 3, 7, and 10 d p.i. and was quantified by qPCR. Viral genomes per cell were calculated by dividing the number of genomes (normalized to actin) by the cell number, and samples were run in three separate experiments. ANOVA was performed to test for variation in DNA content over time and yielded a P value of 0.54, supporting the interpretation that the means do not differ. (B) Latency-associated RNAs are present in HCMV infected THP-1 cells over a 10 d time course. Control assays were performed without reverse transcriptase (RT−) to monitor for DNA contamination. Glyceraldehyde 3phosphate dehydrogenase (GAPDH) as a loading control and mock-infected cells are indicated in lanes labeled M.
199 200
3.2. Global analysis of smRNA transcriptomes
E T C E R
198
R
196 197
N C O
194 195
U
192 193
F
188
antisense to the UL81–82 coding region, and it accumulates during latency in bone marrow and monocytes cells (Bego et al., 2005). Infected THP-1 monocyte cells express RNA that encodes US28 chemokine receptor (Beisser et al., 2001), and bone marrow cells express latencyassociated cmvIL-10 (LAcmvIL-10) RNA that encodes a variant of the HCMV IL-10 (vIL-10) (Jenkins et al., 2004). These three RNAs were detected on days 1–10 after infection of THP-1 cells (Fig. 1B). A subset of lytic HCMV RNAs is transiently expressed after infection of CD34 + HSCs (Goodrum et al., 2002) or granulocyte–macrophage progenitor cells with HCMV (Cheung et al., 2006). We infected THP-1 cell with HCMV and monitored the accumulation of UL123 IE RNAs that encode IE1 protein products that are essential for lytic replication (Nevels et al., 2004). Importantly, UL123 RNA was reduced at day 7 and disappeared on day 10 (Fig. 1B). We concluded that the virus enters a quiescent state with sustained expression of a limited set of RNAs after infection of THP-1 cell. Based on the observations described above, we believe that we have successfully established an in vitro cell model of HCMV latent infection.
R O
186 187
95 °C for 5 s, and 60 °C for 60 s. Each PCR reaction was repeated more than three times. The relative expression level of each miRNA was normalized to the level of U6 small nuclear RNA (snRNA) levels. Foldchange was calculated according to the 2−ΔΔCt method.
O
184 185
3
Fig. 2. Size distribution and annotation of smRNAs from the libraries of latent-infected and mock-infected THP-1 cells. Length distribution of sequenced reads. Both libraries accumulated 22-nucleotide smRNAs, which is consistent with the typical size of miRNAs.
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
220 221 222 223 224 225 226 227 228
231 232 233 234 235 236 237 238 239
4 t1:1 t1:2
M. Fu et al. / Gene xxx (2013) xxx–xxx
Table 1 HCMV miRNA sequence detected in latent-infected and mock-infected THP-1 cell libraries.
t1:3
miRNA name hcmv-miRa Sequenceb
Read count % of total
t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10
US25-1-5p US25-2-5p UL112-3p US5-2-3p US4-5p US5-1-3p US25-2-3p
176 45 15 11 6 6 6
65.2 16.7 5.6 4.1 2.2 2.2 2.2
5
1.9
t1:11
UL36-5p
AACCGCTCAGTGGCTCGGACC AGCGGTCTGTTCAGGTGGATGA AAGTGACGGTGAGATCCAGGCT TTATGATAGGTGTGACGATGT TGGACGTGCAGGGGGATGTCT TGACAAGCCTGACGAGAGCGT ATCCACTTGGAGAGCTCCCGCG GT TCGTTGAAGACACCTGGAAAGA
a
253 254 255 256 257 258 259 260 261 262 263 264 265
To explore the potential impact of HCMV latent infection on the miRNA expression profile of the host cells, we identified the human miRNAs that were differentially expressed in the latent-infected and mock-infected cells. The expression of the miRNAs in the two samples was visualized in a scatter plot (Fig. 4). We found that the distinct miRNAs had significantly different expression levels as measured by the frequency of read counts, indicating an excellent functional divergence of these miRNAs. For example, the hsa-let-7 family (hsa-let-7a5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, hsa-let-7f-5p, hsa-let7g-5p and hsa-let-7i-5p) was the most highly expressed miRNAs in the two samples. Virus latent infections can be expected to result in changes in cellular miRNA expression, biogenesis and/or activity. The relative counts of the sequencing reads were used to quantify the miRNA expression levels between latent-infected and mock-infected cells. Based on a normalized
F O R O
P
D
E
251 252
3.4. Differentially expressed cellular miRNAs between latent-infected and mock- infected THP-1 cells
Fig. 4. The miRNA expression level of latent-infected and mock-infected THP-1 cells. The count of each miRNA was plotted after normalization. Red color points show upexpressed miRNAs in latent-infected compare with mock-infected THP-1 cells with at least a 2-fold change and P-value below 0.001; Green color points show downexpressed miRNAs in latent-infected compare with mock-infected THP-1 cells; Blue color points show equally-expressed miRNAs between the two libraries. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
number of reads in the two samples, 49 of the cellular miRNAs showed a significantly greater (P-value ≤ 0.001) than two-fold change during latency (Table 2 and Table S2). Of these 49 miRNAs, 39 were up-regulated and 10 were down-regulated. To further validate these differentially expressed miRNAs, 13 were selected to perform quantitative RT-PCR assay from independent biological replicates. The 13 selected miRNAs comprised both highly expressed (e.g. hsa-miR-340-5p, hsa-miR-215p, hsa-miR-223-5p and hsa-miR-92b-3p) and poorly expressed miRNAs (e.g. hsa-miR-151a-3p, hsa-miR-320c and hsa-miR-451a) (see Table 3). As shown in (Fig. 5), a strong correlation (Pearson's correlation = 0.94) was revealed between the quantitative RT-PCR measurements and the deep sequencing data, indicating the robustness of deep sequencing-based expression analysis Previously, Poole et al. (2011) investigated the miRNA activity during virus latent infection and found that HCMV infection of CD34+ progenitor cells led to decreased expression of hsa-miR-92a, which resulted in the increased expression of GATA-2 expression and a subsequent increase in the expression of cellular IL-10. The virus may interact with cellular miRNAs differently in different cell types or in different human tissues. Intriguingly, among the miRNAs that were highly up-
T
250
C
249
E
248
R
246 247 Q4
R
244 245
O
242 243
miR-UL22A-3P, miR-UL148D, miR-UL36-3P, miR-US33-5p, and miRUS25-1-3P, were not detected in our deep sequencing libraries. Compared with the expression levels of virus miRNA in productive infections that were reported previously (Stark et al., 2012), the expression levels of the miRNAs in the latent infections in our libraries were much lower. This finding indicates that the expression level of miRNA is different in latent-infected and productive-infected cells. Among the viral miRNAs, four of them exhibited sequence counts large than 10. These four miRNAs were validated by real-time RT-PCR (see Table 3).
C
240 241
N
t1:13
We added “-5p” and “-3p” to indicate the miRNA origin on the corresponding precursor hairpin. b We picked as representative sequence the one with highest reads in the deepsequencing (given from 5′ to 3′).
U
t1:12
268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285
Table 2 t2:1 Top 10 miRNAs differentially expressed between the latent-infected and mock-infected li- t2:2 braries. t2:3 miRNA name
Fig. 3. HCMV miRNAs read counts in the deep-sequencing from HCMV-infected THP-1 cells. Read counts of all known HCMV miRNAs detected by deep-sequencing from HCMV-infected THP-1 cells.
266 267
hsa-miR-124-3p hsa-miR-1307-5p hsa-miR-33a-5p hsa-miR-378c hsa-miR-331-3p hsa-miR-185-3p hsa-miR-27a-3p hsa-miR-223-5p hsa-miR-4521 hsa-miR-642a-5p
Relative count Mock-infected
Latent-infected
1.6522 0.5507 2.0193 1.2850 0.5507 0.5507 10.3721 529.2519 30.2902 1.5604
95.7602 23.3905 33.2391 18.4662 6.8589 6.4192 84.5926 29.6338 5.5398 0.3517
Fold change
P-value
57.9592 42.4741 16.4607 14.3706 12.4549 11.6564 8.1558 17.8597 5.4677 4.4367
3.78E−285 1.86E−68 7.31E−82 1.67E−44 1.15E−16 2.29E−15 7.21E−161 0.00 1.54E−47 0.0032
t2:4 t2:5
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
t2:6 t2:7 t2:8 t2:9 t2:10 t2:11 t2:12 t2:13 t2:14 t2:15
M. Fu et al. / Gene xxx (2013) xxx–xxx
qRT-PCR Sequence confirmed
√
AACCGCTCAGTGGCTCGGACC
√
AGCGGTCTGTTCAGGTGGAT 0.00 45.00 GA AAGTGACGGTGAGATCCAGG 0.00 15.00 CT TTATGATAGGTGTGACGATG 0.00 11.00 TC UAAGGCACGCGGUGAAUGCC 1.65 95.76 CUAGACUGAAGCUCCUUG 3.21 7.83 AGG AACUGGCCUACAAAGUCCCA 3.03 17.76 GU CUGUGCGUGUGACAGCGGCU 10.19 23.57 GA UAGCUUAUCAGACUGAUGUU 2349.69 4678.36 GA 10.37 84.59 UUCACAGUGGCUAAGUUC CGC AAAAGCUGGGUUGAGAGGGU 2.94 7.21 UUAUAAAGCAAUGAGACUGA 110.05 259.41 UU UAUUGCACUCGUCCCGGCCU 39.93 85.03 CC UGGCUCAGUUCAGCAGGAAC 50.21 121.70 AG GCUAAGGAAGUCCUGUGCUC 30.29 5.54 AG CGUGUAUUUGACAAGCUGAG 529.25 29.63 UU AAACCGUUACCAUUACUGAG 1.56 0.53 UU AAATGAATCATGTTGGGCCT 77.00 59.00 GT AGGGGCGCGGCCCAGGAGCT 28.00 0.00 CAGA GAGTTAGCGGGGAGTGATAT 37.00 14.00 ATT CAAAATGATGAGGTACCTGA 15.00 0.00 TA GGAGGAACCTTGGAGCTTCG 29.00 40.00 GCA TCGGGCGGGAGTGGTGGCTT 4075.00 3547.00 TT AGGGGCGCGGCCCAGGAGCT 0.00 16.00 CAG
hsa-miR-210
√
t3:13
hsa-miR-21-5p
√
t3:14
hsa-miR-27a-3p
√
t3:15 t3:16
hsa-miR-320c hsa-miR-340-5p
√ √
t3:17
hsa-miR-92b-3p
√
t3:18
hsa-miR-24-3p
√
t3:19
hsa-miR-4521
√
t3:20
hsa-miR-223-5p
√
t3:21
hsa-miR-451a
√
t3:22
novel-miR-01
√
t3:23
novel-miR-02
√
t3:24
novel-miR-03
√
t3:26
novel-miR-05
√
t3:27
novel-miR-06
√
t3:28
novel-miR-07
√
t3:29
a
286
N C O
novel-miR-04
Indicates that the miRNA has not been validated by qRT-PCR.
292
3.5. Identification of novel cellular miRNAs
293 294
One of the advantages for high-throughput sequencing of smRNA transcriptomes is the potential discovery of novel miRNAs. Since Illumina sequence reads were also detected outside annotated cellular miRNA regions, we subjected the data sets to the MIREAP, an exquisite tool commonly used to identify putative novel miRNAs from highthroughput sequencing data (Chen et al., 2009). We identified 14 putative novel miRNAs from both libraries (Table S3): 11 in the HCMVinfected THP-1 library and 11 in the mock-infected THP-1 library, and 8 of them were common to both libraries. To further validate these
289
295 296 297 298 299 300 301
U
290 291
regulated in latent infection, hsa-miR-124 (58-fold) was the highest. Our attention was drawn to hsa-miR-124, which has also been implicated in the modulator of monocyte and macrophage activation. It has been reported that the miR-124 deactivated bone marrow-derived macrophages in vitro (Ponomarev et al., 2011), and might be important for HCMV that stay latently in cells of myeloid lineage.
287 288
Fig. 5. Validation of the Solexa sequencing with qRT-PCR analysis. Sequencing vs. qRT-PCR of miRNA fold-changes.
potentially novel miRNAs, we performed real-time RT-PCR analysis on 7 miRNA candidates with a normalized sequencing frequency larger than 10 (the other miRNAs were excluded because their expression levels were too low to be detected by real-time RT-PCR). As a result, we have validated six of them (Table 3), indicating that 85% could be validated by a sequencing-independent method.
T
a
t3:25
F
t3:12
O
√
√
R O
hsa-miR-193a-3p
t3:8
√
P
t3:11
t3:7
176.00
D
√ √
t3:6
0.00
E
t3:9 t3:10
hcmv-miR-US251-5p hcmv-miR-US252-5p hcmv-miR-UL1123p hcmv-miR-US-23p hsa-miR-124-3p hsa-miR-151a-3p
C
t3:5
Relative count MockLatentinfected infected
E
miRNA ID
t3:4
R
t3:3
Table 3 The miRNAs validated by qRT-PCR.
R
t3:1 t3:2
5
302 303 304 305 306 307
3.6. Predicted targets of differentially expressed cellular miRNAs
308
To explore the biological function of the differentially expressed miRNAs identified in our analysis, we used two independent algorithms, miRanda and RNAhybrid, to predicted mRNA targets for each of the miRNAs that was differentially expressed significantly. Table S4 lists the targets that are predicted by both algorithms. Using this criterion, a total of 300 genes are predicted as the potential targets of these miRNAs. To analyze the role that the miRNAs might play in the regulatory networks, we assigned the putative miRNA targets to KEGG pathways, and found that 11 of the pathways are significantly enriched (P b 0.001 with Benjamini correction). It has been shown that most of the significant KEGG terms were involved in melanogenesis (ko04916), pathways in cancer (ko05200), endocytosis (ko04144) and wnt signaling pathway (ko04310). Some of these predicted targets are also associated with cellular pathways related to MAPK signaling and mTOR signaling, which were important during HCMV infection (Reeves et al., 2012; Wang et al., 2008).
309 310
4. Discussion
325
Previous studies of human herpesviruses and their miRNAs have focused on the virally encoded miRNAs during lytic infection and not during latent infections when virally encoded miRNAs can also play roles. During latency, some viral miRNAs contribute to maintaining the IE genes in an inactive state (Grey et al., 2007; Murphy et al., 2008; Umbach et al., 2008), which are expected to result in changes in cellular miRNA expression, biogenesis, or activity. Here we examined the connection between latent infection and virus–host interactions present within the HCMV-infected THP-1 cells. In this study, we found that eight HCMV-encoded mature miRNAs were expressed during latency. MiR-US25-1 and miR-US25-2 are constituted almost 82% of the total HCMV miRNAs reads. The extremely high expression of these two miRNAs suggests that these miRNAs may contribute to the establishment of latency. These two miRNAs have been shown to inhibit viral DNA synthesis and viral replication of both
326 327
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
311 312 313 314 315 316 317 318 319 320 321 322 323 324
328 329 330 331 332 333 334 335 336 337 338 339 340
364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406
415
We declare that there is no conflict of interests.
F
Acknowledgments
409 410 411 412 413 414
416 417 418 419
References
424
O
We thank Jinyu Wu for technical assistance with in-depth data analysis and manuscript organization. This work was supported by the grants from the National Science Foundation of China (No. 81071365), Zhejiang Provincial Natural Science Foundation of China (LY13H190006) and Key Science and Technology Innovation Team of Zhejiang Province (2012R10048-11).
R O
362 363
Conflict of interests
P
360 361
407 408
Bartel, D.P., Chen, C.Z., 2004. Micromanagers of gene expression: the potentially widespread influence of metazoan microRNAs. Nat. Rev. Genet. 5 (5), 396–400. Skalsky, R.L., Cullen, B.R., 2010. Viruses, microRNAs, and host interactions. Annu. Rev. Microbiol. 64, 123–141. Khoshnevis, M., Tyring, S.K., 2002. Cytomegalovirus infections. Dermatol. Clin. 20 (2), 291–299. Umbach, J.L., Kramer, M.F., Jurak, I., Karnowski, H.W., Coen, D.M., Cullen, B.R., 2008. MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs. Nature 454 (7205), 780–783. Cai, X., Lu, S., Zhang, Z., Gonzalez, C.M., Damania, B., Cullen, B.R., 2005. Kaposi's sarcomaassociated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc. Natl. Acad. Sci. U. S. A. 102 (15), 5570–5575. Cai, X., et al., 2006. Epstein–Barr virus microRNAs are evolutionarily conserved and differentially expressed. PLoS Pathog. 2 (3), e23. Triboulet, R., et al., 2007. Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Science 315 (5818), 1579–1582. Stern-Ginossar, N., et al., 2007. Host immune system gene targeting by a viral miRNA. Science 317 (5836), 376–381. Tuddenham, L., Pfeffer, S., 2011. Roles and regulation of microRNAs in cytomegalovirus infection. Biochim. Biophys. Acta 1809 (11–12), 613–622. Stark, T.J., Arnold, J.D., Spector, D.H., Yeo, G.M., 2012. High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection. J. Virol. 86 (1), 226–235. Wang, F.Z., Weber, F., Croce, C., Liu, C.G., Liao, X., Pellett, P.E., 2008. Human cytomegalovirus infection alters the expression of cellular microRNA species that affect its replication. J. Virol. 82 (18), 9065–9074. Grey, F., Meyers, H., White, E.A., Spector, D.H., Nelson, J., 2007. A human cytomegalovirusencoded microRNA regulates expression of multiple viral genes involved in replication. PLoS Pathog. 3 (11), e163. Prichard, M.N., Gao, N., Jairath, S., Mulamba, G., Krosky, P., Coen, D.M., et al., 1999. A recombinant human cytomegalovirus with a large deletion in UL97 has a severe replication deficiency. J. Virol. 73 (7), 5663–5670. Reeves, M.B., MacAry, P.A., Lehner, P.J., Sissons, J.G., Sinclair, J.H., 2005. Latency, chromatin remodeling, and reactivation of human cytomegalovirus in the dendritic cells of healthy carriers. Proc. Natl. Acad. Sci. U. S. A. 102 (11), 4140–4145. Zhu, E., et al., 2010. mirTools: microRNA profiling and discovery based on highthroughput sequencing. Nucleic Acids Res. 38, W392–397 (Web Server issue). Xu, G., et al., 2010. Characterization of the small RNA transcriptomes of androgen dependent and Independent prostate cancer cell line by deep sequencing. PLoS ONE 5 (11), e15519. Jayarama, V., et al., 2006. Development of models and detection methods for different forms of cytomegalovirus for the evaluation of viral inactivation agents. Transfusion 46 (9), 1580–1588. Bego, M., Maciejewski, J., Khaiboullina, S., Pari, G., St Jeor, S., 2005. Characterization of an antisense transcript spanning the UL81–82 locus of human cytomegalovirus. J. Virol. 79 (17), 11022–11034. Beisser, P.S., Laurent, L., Virelizier, J.L., Michelson, S., 2001. Human cytomegalovirus chemokine receptor gene US28 is transcribed in latently infected THP-1 monocytes. J. Virol. 75 (13), 5949–5957. Jenkins, C., Abendroth, A., Slobedman, B., 2004. A novel viral transcript with homology to human interleukin-10 is expressed during latent human cytomegalovirus infection. J. Virol. 78 (3), 1440–1447. Goodrum, F.D., Jordan, C.T., High, K., Shenk, T., 2002. Human cytomegalovirus gene expression during infection of primary hematopoietic progenitor cells: a model for latency. Proc. Natl. Acad. Sci. U. S. A. 99 (25), 16255–16260.
D
358 359
In summary, we used a miRNA sequencing approach to study the HCMV-host transcriptomes in latently infected THP-1 cells and found several HCMV miRNAs and differentially expressed cellular miRNAs. This approach could lead to the development of a miRNA-based therapeutic approach that could reduce the severity of viral infection in immunocompromised individuals. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2013.12.012.
T
356 357
C
354 355
E
352 353
R
350 351
R
348 349
O
347
C
345 346
N
343 344
HCMV and other DNA viruses (HSV-1 and adenovirus) (Stern-Ginossar et al., 2009). Thus, we hypothesized that targets of miR-US25-1 and miR-US25-2 are essential for viral growth. Recently, Grey et al. (2010) demonstrated that miR-US25-1 targets many of the cellular genes associated with cell cycle control. They found that miR-US25-1 could bind to regions within the 5′ UTR of different mRNA transcripts, including cyclin BRCC3, EID1, E2, MAPRE2 and CD147 (Grey et al., 2010). Similar to these discoveries for HCMV, HSV-1 also expresses at least two miRNAs in latently infected neurons that target the ICP4 and ICP0, and it has been suggested that these miRNAs may contribute to the establishment and maintenance of latency by inhibiting IE and early gene expression (Umbach et al., 2008). The less highly expressed miR-UL112 in our study is predicted to target UL114, reducing its activity as a uracil DNA glycosylase (Stern-Ginossar et al., 2009). MiR-UL112 has also been shown to target the IE genes (including the major IE gene, IE72) (Grey et al., 2007; Murphy et al., 2008). Interestingly, miR-UL-112 also averts natural killer cell recognition by targeting the cellular stress-inducible MICB ligand for the NKG2D activating receptor (Nachmani et al., 2010; Stern-Ginossar et al., 2007). Thus, these studies begin to define an elegant mechanism by which miR-UL112 coordinately down-modulates the immune response and viral replication for viral persistence. Taken together, it seems that the expression of viral miRNAs provides herpesviruses with a nonimmunogenic strategy to stably alter the cellular environment during persistence. Furthermore, we were able to find the expression of other HCMV miRNAs, including miR-US5-2, miR-US5-1, miR-US4-5p, miR-US25-23P, and miR-UL-36-5p. The recent studies demonstrated that the miRNAs miR-US5-1 and miR-US5-2 encoded by HCMV synergistically regulate US7, even at a very low concentration (Tirabassi et al., 2011). MiR-US4-1 specifically represses the expression of endoplasmic reticulum (ER)-associated aminopeptidase (ERAP)1, an inhibitor of cytotoxic T lymphocytes (CTLs) response (Kim et al., 2011). We hypothesized that an additional tactics of immune evasion may be mediated by these miRNAs, especially during latent infection. Given the limited viral gene expression during HCMV latency, it is likely that the virus would use multiple methods to modulate and fine tune cellular gene expression in order to optimize carriage and reactivation of the latent virus. In this study, we have generated a large data set of cellular miRNAs that are differentially expressed between latentinfected and mock-infected THP-1 cells. One interesting observation is the 50-fold over-expression of has-miR-124 in the latent-infected THP-1 cells. Several studies have demonstrated that non-differentiated THP-1 cells do not support HCMV lytic infection unless they are differentiated into macrophage-like cells (Khaiboullina et al., 2004; Turtinen and Seufzer, 1994). In addition, another study reported that miR-124 modulated monocyte and macrophage activation by direct inhibition of C/EBP-α and its downstream transcription factor PU.1 (Ponomarev et al., 2011). In the present study, has-miR-124 was highly up-regulated during HCMV latency, suggesting that it could have a major role in inhibiting macrophage activation to create an environment suitable for establishing latency. We also identified a set of differentially expressed human miRNAs including miR-340-5p, miR-21-5p, miR-92b-3p, miR-151a-3p, hsamiR-320c, hsa-miR-451a; miR-24 and miR-27 that have been reported to have a global antiviral role against all viruses (Santhakumar et al., 2010). Interestingly, we found that miR-223-5p was one of the most dramatically down-regulated miRNAs following HCMV infection and miR-223-5p has been reported to target the 3′ UTR of HIV-1 mRNA. MiRNA-mediated regulation of HIV-1 transcripts has been shown to play a role in the maintenance of viral latency (Huang et al., 2007). Functional annotation of the miRNA target genes indicated that most of the differentially expressed miRNA targeted genes were involved in signal transduction and cell communication, especially the melanogenesis, pathways in cancer endocytosis, wnt signaling, MAPK signaling and mTOR signaling. Cellular signaling events are important for creating a cellular environment that is permissive for latency.
U
341 342
M. Fu et al. / Gene xxx (2013) xxx–xxx
E
6
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
420 421 422 423 Q5
425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479
M. Fu et al. / Gene xxx (2013) xxx–xxx
Grey, F., et al., 2010. A viral microRNA down-regulates multiple cell cycle genes through mRNA 5′ UTRs. PLoS Pathog. 6 (6), e1000967. Nachmani, D., Lankry, D., Wolf, D.G., Mandelboim, O., 2010. The human cytomegalovirus microRNA miR-UL112 acts synergistically with a cellular microRNA to escape immune elimination. Nat. Immunol. 11 (9), 806–813. Tirabassi, R., et al., 2011. Human cytomegalovirus US7 is regulated synergistically by two virally encoded microRNAs and by two distinct mechanisms. J. Virol. 85 (22), 11938–11944. Kim, S., et al., 2011. Human cytomegalovirus microRNA miR-US4-1 inhibits CD8(+) T cell responses by targeting the aminopeptidase ERAP1. Nat. Immunol. 12 (10), 984–991. Khaiboullina, S.F., et al., 2004. Human cytomegalovirus persists in myeloid progenitors and is passed to the myeloid progeny in a latent form. Br. J. Haematol. 126 (3), 410–417. Turtinen, L.W., Seufzer, B.J., 1994. Selective permissiveness of TPA differentiated THP-1 myelomonocytic cells for human cytomegalovirus strains AD169 and Towne. Microb. Pathog. 16 (5), 373–378. Santhakumar, D., et al., 2010. Combined agonist–antagonist genome-wide functional screening identifies broadly active antiviral microRNAs. Proc. Natl. Acad. Sci. U. S. A. 107 (31), 13830–13835. Huang, J., et al., 2007. Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat. Med. 13 (10), 1241–1247.
F
Cheung, A.K., Abendroth, A., Cunningham, A.L., Slobedman, B., 2006. Viral gene expression during the establishment of human cytomegalovirus latent infection in myeloid progenitor cells. Blood 108 (12), 3691–3699. Nevels, M., Paulus, C., Shenk, T., 2004. Human cytomegalovirus immediate-early 1 protein facilitates viral replication by antagonizing histone deacetylation. Proc. Natl. Acad. Sci. U. S. A. 101 (49), 17234–17239. Poole, E., McGregor Dallas, S.R., Colston, J., Joseph, R.S., Sinclair, J., 2011. Virally induced changes in cellular microRNAs maintain latency of human cytomegalovirus in CD34+ progenitors. J. Gen. Virol. 92 (pt 7), 1539–1549. Ponomarev, E.D., Veremeyko, T., Barteneva, N., Krichevskyam, A.M., Weiner, H.L., 2011. MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU.1 pathway. Nat. Med. 17 (1), 64–70. Chen, X., et al., 2009. Identification and characterization of novel amphioxus microRNAs by Solexa sequencing. Genome Biol. 10 (7), R78. Reeves, M.B., Breidenstein, A., Compton, T., 2012. Human cytomegalovirus activation of ERK and myeloid cell leukemia-1 protein correlates with survival of latently infected cells. Proc. Natl. Acad. Sci. U. S. A. 109 (2), 588–593. Murphy, E., Vanicek, J., Robins, H., Shenk, T., Levine, A.J., 2008. Suppression of immediateearly viral gene expression by herpesvirus-coded microRNAs: implications for latency. Proc. Natl. Acad. Sci. U. S. A. 105 (14), 5453–5458. Stern-Ginossar, N., Saleh, N., Goldberg, M.D., Prichard, M., Wolf, D.G., Mandelboim, O., 2009. Analysis of human cytomegalovirus-encoded microRNA activity during infection. J. Virol. 83 (20), 10684–10693.
O
480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502
7
U
N C O
R
R
E
C
T
E
D
P
R O
526
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
4 5 6Q2 7Q3 8 9
Miao Fu a,d, Yan Gao a, Qiuju Zhou a, Qi Zhang a, Ying Peng b,c,1, Kegang Tian e, Jinhua Wang d, Xiaoqun Zheng a,b,c,⁎ a
Department of the Laboratory Medicine, The Second Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China School of Laboratory Medicine and Life Science, Wenzhou Medical University, Wenzhou, Zhejiang, China Key Laboratory of Laboratory Medicine, Ministry of Education, China d Jinhua Municipal Central Hospital, Jinhua, Zhejiang, China e Qingdao Municipal Central Hospital, Qingdao, Zhejiang, China b c
a r t i c l e
i n f o
P
10
a b s t r a c t
Background: MicroRNAs (miRNAs) play important roles in regulating gene expression of plants, animals and viruses. Comprehensive characterization of host and viral miRNA will help uncover the molecular mechanisms that underlie the progression of human cytomegalovirus (HCMV) latent infection. To investigate the miRNA expression profile of HCMV and host cells during latent infection, we performed deep-sequencing analysis of the small RNAs isolated from HCMV-infected and mock-infected human monocytic leukemia cell line, THP-1. Results: We established a HCMV latent infection cell model using the THP-1 cells. High-throughput sequencing technology was used to sequence small RNA libraries of the HCMV-infected and mock-infected THP-1 and to investigate their small RNA transcriptomes. We found eight miRNAs including miR-US25-1, miR-US25-2-5p and miR-UL112 that were expressed by HCMV during latent infection. The expressions of the host miRNAs were also affected by HCMV latent infection. At least 49 cellular miRNAs were differentially expressed: 39 were upregulated and 10 were down-regulated upon HCMV latent infection. The expression of the human miRNA hsamiR-124-3p was significantly up-regulated in the HCMV latent infection library. In addition, we found 14 cellular novel miRNAs in the HCMV-infected and mock-infected THP-1 libraries. Functional annotation of the target genes of the differentially expressed miRNAs suggested that the majority of the genes are involved in melanogenesis, pathways in cancer, endocytosis and wnt signaling pathway. Conclusions: The small RNA transcriptomes obtained in this study demonstrate the usefulness of the deepsequencing combined with bioinformatics approach in understanding of the expression and function of host and viral small RNAs in HCMV latent infection. This approach can also be applied to the study of other kinds of viruses. © 2013 Published by Elsevier B.V.
D
Article history: Accepted 6 December 2013 Available online xxxx
C
T
E
Keywords: Human cytomegalovirus Latent infection MiRNA Deep-sequencing Differentially expression
46
Abbreviations: miRNAs, microRNAs; HCMV, human cytomegalovirus; THP-1, human monocytic leukemia cell line; nt, nucleotides; mRNAs, messenger RNAs; 3′ UTR, 3′ untranslated regions; AIDS, Acquired Immune Deficiency Syndrome; HSV-1, herpes simplex virus 1; LATs, latency-associated transcripts; KSHV, Kaposi's sarcoma-associated herpesvirus; EBV, Epstein–Barr virus; MICB, major histocompatibility complex class 1-related chain B; smRNA, small RNA; HEL, Human embryonic lung; FBS, fetal bovine serum; MOI, multiplicity of infection; RT-PCR, reverse transcriptase PCR; qPCR, quantitative real-time PCR; IE, immediate early; TBE, tris–borate-EDTA; UCSC, University of California, Santa Cruz; KEGG, Kyoto encyclopedia of Genes and Genomes; DAVID, The Database for Annotation, Visualization and Integrated Discovery; snRNA, small nuclear RNA; LUNA, latency unique nuclear antigen; LAcmvIL-10, latency-associated cmvIL-10; vIL-10, HCMV IL-10; ER, endoplasmic reticulum; ERAP, endoplasmic reticulum associated aminopeptidase; CTLs, cytotoxic T lymphocytes; C/EBPα, CCAAT/enhancer-binding protein α; MAPKs, mitogenactivated protein kinase; mTOR, mammalian target of rapamycin. ⁎ Corresponding author at: Department of the Laboratory Medicine, The Second Hospital, Wenzhou Medical University, Wenzhou, Zhejiang, China. E-mail address: [email protected] (X. Zheng). 1 Current address: University of Missouri—Columbia, MO.
U
47
N C O
R
R
E
11 12 13 14 16 15 17 18 19 20 21 22 23
F
3Q1
O
2
Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA
R O
1
24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 45 44
1. Introduction
48
MicroRNAs (miRNAs) are short (about 22 nucleotides (nt)) RNAs that are involved in the posttranscriptional regulation of their target messenger RNAs (mRNAs). Generally, miRNAs bind to complimentary sequences in the 3′ untranslated regions (3′ UTR) of the mRNAs resulting in inhibiting translation and/or promoting mRNA degradation (Bartel and Chen, 2004). More than 200 viral miRNAs including from the herpesvirus have been identified by bioinformatic, sequencing, and direct cloning approaches (see review (Skalsky and Cullen, 2010)). Human cytomegalovirus (HCMV) is a member of the herpesvirus family, and it can maintain a persistent or latent infection during the lifetime of the virus in its host. Patients who are immunocompromised as a result of either AIDS or organ transplant-associated immunosuppression are extremely susceptible to HCMV infection (Khoshnevis and Tyring, 2002), and this observation has further energized HCMV studies. An understanding of the molecular basis of HCMV latency
49 50
0378-1119/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.gene.2013.12.012
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
51 52 53 54 55 56 57 58 59 60 61 62 63
118 119
Human embryonic lung (HEL) fibroblasts cells were obtained from the Kunming Institute of Zoology, Chinese Academy of Sciences, and THP-1 cells were obtained from the Cell Bank of Shanghai Institute. Both cell types were cultured at 37 °C with 5% CO2. HEL cells were cultured in Dulbecco's modified Eagle's medium (Gibco), while the THP-1 cells were maintained in RPMI 1640 medium (Gibco). Both media were supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 units/ml penicillin, and 100 μg/ml streptomycin.
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113
120 121 122 123 124 125
C
87 88
E
85 86
R
83 84
R
81 82
O
79 80
C
77 78
N
75 76
U
73 74
2.2. Isolation of RNA
134
The total RNA was extracted from cells using Trizol (Invitrogen) according to the manufacturer's instructions. Aliquots of total RNA were either used directly to analyze the expression of HCMV latencyassociated transcripts by reverse transcriptase PCR (RT-PCR), or subjected to smRNA library construction, or used for miRNA quantification by quantitative real-time PCR (qPCR).
135 136
2.3. RT-PCR and quantification of viral DNA
141
An RT-PCR kit (TaKaRa) was used according to the manufacturer's recommendations to analyze the expression of HCMV latencyassociated transcripts. The primers that were used to amplify the cDNA are listed in Table S1. Total DNAs were isolated from the cells using the QIAamp DNA mini kit (Qiagen). The DNA was then subjected to a qPCR assay using the primers of immediate early (IE) genes (Table S1).
142
F
2.1. Cells culture and virus infections
71 72
O
117
70
R O
2. Materials and methods
68 69
126 127
P
116
66 67
The HEL cells were infected with a low-passage-number clinical isolate of HCMV (strain Toledo), at a multiplicity of infection (MOI) of 1, whereas THP-1 cells were infected at an MOI of 5. Viral titers were determined used standard plaque assays as previously described (Prichard et al., 1999), and the virus stock was stored at − 80 °C. The cells were infected as previously described (Reeves et al., 2005). Mock-infected cells were incubated with equal volumes of the culture media.
2.4. Small RNA library construction and deep-sequencing data analysis
128 129 130 131 132 133
137 138 139 140
143 144 145 146 147 148 149
The isolated total RNA was size-fractionated on a 15% tris–borateEDTA (TBE) urea polyacrylamide gel to isolate RNA with 18–30-nucleotide (nt) in size. These small RNAs were then ligated with 3′ and 5′ adapters and were reversely transcribed to cDNA. The cDNA were used templates for PCR amplification using the Solexa's small RNA primer set and sequenced using an Illumina GA IIx according to the manufacturer's protocols. Contaminant reads were removed and the final cleaned reads were refined. Data analysis of the smRNA transcriptome was performed using the mirTools program (Zhu et al., 2010). In brief, the filtered data sets containing smRNAs 18 to 30 nt long were then aligned to an index composed of both the human (University of California, Santa Cruz [UCSC] hg19 [http://genome.ucsc.edu]) and HCMV strain Toledo complete genome (GU937742.1) using the SOAP 2.0 program and allowing, at most, two mismatches. SmRNA annotations were obtained from miRBase, version v.18.0 (http://www.mirbase.org), and the UCSC Table Browser. To compare differentially expressed human miRNAs between HCMV-infected and mock-infected THP-1 cells, HCMV miRNA counts were removed from the data sets and the read counts of each identified miRNAs was normalized to the total number of miRNA reads. The target genes for each differentially expressed miRNA were predicted using miRanda (http://www.microrna.org/), and RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/rnahybrid/). The predicted target genes were annotated with KEGG pathways using the DAVID gene annotation tool (http://david.abcc.ncifcrf.gov/UTH) as described previously (Xu et al., 2010).
150 151
2.5. Real-time RT-PCR analysis of the miRNAs
176
miRNA cDNA was generated from the total RNA using an RT-PCR kit (TaKaRa) in 20-μl reaction mixtures containing 1 pmol of the miRNAspecific RT primer and 800 ng of total RNA, at 42 °C for 30 min with a final incubation at 95 °C for 5 min. The miRNA real-time RT-PCR was carried out using a miScript SYBR Green PCR kit (TaKaRa) on an Applied Biosystems 7900 real-time PCR machine (ABI). The PCR reaction was conducted at 95 °C for 30 s, followed by 40 cycles of incubation at
177 178
T
114 115
may help shed light on possible treatment strategies for HCMV infection. Whereas the limited protein-coding genes are expressed, many miRNAs are known to be transcribed during latency. For example, the herpes simplex virus 1 (HSV-1) miRNAs lie within the latencyassociated transcripts (LATs) and a fifth HSV-1 miRNA was identified in latently infected trigeminal ganglia (Umbach et al., 2008). The Kaposi's sarcoma-associated herpesvirus (KSHV) and Epstein–Barr virus (EBV) miRNAs are also transcribed and available to function during latent infection (Cai et al., 2005, 2006). In addition to encoding their own miRNAs, viruses are known to modulate the levels and functions of cellular miRNAs and vice versa. It has been reported that the HIV-1 down regulates many cellular miRNAs including the polycistronic cluster miR17/92, which has been implicated in many roles including cellular differentiation and proliferation (Triboulet et al., 2007). HCMV miR-UL112-1 can suppress the expression of MICB, which is a ligand of NKG2D, the natural killer cell activating receptor (Stern-Ginossar et al., 2007). To date, 17 HCMV miRNAs have been identified in cells undergoing lytic infection (see review (Tuddenham and Pfeffer, 2011)), but whether or not HCMV miRNAs are expressed during latent infection is still an open question. Deep-sequencing technologies have been used to discover new miRNAs. These technologies support a quantitative and in-depth investigation of small RNA (smRNA) transcriptomes. Deep-sequencing of the HCMV genome has revealed two novel HCMV miRNAs, miR-US22 and miRUS33as during lytic infection (Stark et al., 2012). However, the deep-sequencing technology has not been extended to analyze the smRNAs of HCMV latent-infected cells. Previous microarray-based studies have been limited to the assessment of cellular miRNAs levels (Wang et al., 2008). Recent studies suggest that miRNAs may play an important role in regulating HCMV gene expression and latency (Grey et al., 2007). The aim of the present study is to identify the miRNAs that are encoded by the HCMV genome and to determine their expression levels in latent-infected human monocytic leukemia cell line, THP-1, as well as cellular miRNA expression after HCMV infection. Firstly, we performed a comprehensive analysis by deep-sequencing of all smRNAs from HCMV infected THP-1 cells and fully characterized both the viral and human miRNA profiles. This led to the discovery of eight miRNAs that are expressed by the HCMV genome during latent infection and including miR-US25-1, miR-US25-2-5p and miR-UL112. Moreover, we found that a large number of cellular miRNAs are altered during latent carriage of HCMV and identified 49 miRNAs that are differentially expressed; hsa-miR-124-3p, for example, was increased in HCMV-infected THP-1 cell. Finally, the function annotation of the target genes of the differentially expressed miRNAs suggested that the majority of the genes are involved in melanogenesis, pathways in cancer, endocytosis and wnt signaling pathway. Identification of the HCMV miRNAs that are expressed during latency is crucial for us to understand their roles in HCMV persistence, pathogenesis, and disease. Similarly, knowledge of the host miRNAs that are expressed during latent infection will contribute to a more complete picture of HCMV pathogenesis and aid researchers in developing tools to combat the virus.
D
64 65
M. Fu et al. / Gene xxx (2013) xxx–xxx
E
2
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175
179 180 181 182 183
M. Fu et al. / Gene xxx (2013) xxx–xxx
3. Results
189
3.1. The establishment of a HCMV latent infection cell model
190 191
THP-1 cells were infected at the high MOI of 5 with HCMV, and the intracellular viral DNA was measured by three independent real-time PCR experiments with primers specific for the IE gene. Viral DNA was maintained but failed to accumulate (Fig. 1A). The levels of viral DNA loads are likely consistent with previous study reflecting these experimentally infected cells as a robust model of latency (Jayarama et al., 2006). Three HCMV latency-associated transcripts have been described previously. Latency unique nuclear antigen (LUNA) RNA is coded
201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216
We prepared short cDNA libraries corresponding to 18 to 30 nt long sequences from HCMV-infected and mock-infected THP-1 cells at 10 d post-infection. High-throughput sequencing of the two smRNA libraries using the Illumina deep sequencing platform generated 11,372,154 and 10,894,624 clean reads for HCMV-infected and mock-infected THP-1 cells, respectively. An average of 43% of the smRNA reads were mapped uniquely to the human and viral genomes, allowing for, at most, two mismatches. From the length distributions of the smRNAs from both libraries, we found that the majorities were 22 nt in length (Fig. 2). This is consistent with the typical size of mature miRNAs. These results indicate that miRNAs have been enriched successively from both libraries.
218 219
3.3. Identification of HCMV miRNAs during latency
229
HCMV has been reported to encode 17 known mature miRNAs from 11 precursors (Tuddenham and Pfeffer, 2011). In this study, we found that eight of these miRNAs are expressed in the latent-infected THP-1 cells. Sequence information and read counts for these miRNAs are summarized in Table 1 and the relative abundances of the miRNAs are shown in (Fig. 3). Our data reveal that HCMV miR-US25-1 has the highest read count (176) followed by miR-US25-2-5p (45) and miRUL112 (13), constituting 65.2%, 10.7% and 5.6%, respectively, out of all reads mapped to HCMV miRNAs. Reads for the other known HCMV mature miRNAs, miR-UL70-3P, miR-UL70-5p, miR-US33-5p, miR-UL22A,
230
P
217
D
Fig. 1. Establishment of HCMV latent infection cell model (A) The THP-1 cells(1 × 106/ml, MOI = 5) was infected by HCMV as described in the Materials and methods section. Viral DNA was extracted from 1, 2, 3, 7, and 10 d p.i. and was quantified by qPCR. Viral genomes per cell were calculated by dividing the number of genomes (normalized to actin) by the cell number, and samples were run in three separate experiments. ANOVA was performed to test for variation in DNA content over time and yielded a P value of 0.54, supporting the interpretation that the means do not differ. (B) Latency-associated RNAs are present in HCMV infected THP-1 cells over a 10 d time course. Control assays were performed without reverse transcriptase (RT−) to monitor for DNA contamination. Glyceraldehyde 3phosphate dehydrogenase (GAPDH) as a loading control and mock-infected cells are indicated in lanes labeled M.
199 200
3.2. Global analysis of smRNA transcriptomes
E T C E R
198
R
196 197
N C O
194 195
U
192 193
F
188
antisense to the UL81–82 coding region, and it accumulates during latency in bone marrow and monocytes cells (Bego et al., 2005). Infected THP-1 monocyte cells express RNA that encodes US28 chemokine receptor (Beisser et al., 2001), and bone marrow cells express latencyassociated cmvIL-10 (LAcmvIL-10) RNA that encodes a variant of the HCMV IL-10 (vIL-10) (Jenkins et al., 2004). These three RNAs were detected on days 1–10 after infection of THP-1 cells (Fig. 1B). A subset of lytic HCMV RNAs is transiently expressed after infection of CD34 + HSCs (Goodrum et al., 2002) or granulocyte–macrophage progenitor cells with HCMV (Cheung et al., 2006). We infected THP-1 cell with HCMV and monitored the accumulation of UL123 IE RNAs that encode IE1 protein products that are essential for lytic replication (Nevels et al., 2004). Importantly, UL123 RNA was reduced at day 7 and disappeared on day 10 (Fig. 1B). We concluded that the virus enters a quiescent state with sustained expression of a limited set of RNAs after infection of THP-1 cell. Based on the observations described above, we believe that we have successfully established an in vitro cell model of HCMV latent infection.
R O
186 187
95 °C for 5 s, and 60 °C for 60 s. Each PCR reaction was repeated more than three times. The relative expression level of each miRNA was normalized to the level of U6 small nuclear RNA (snRNA) levels. Foldchange was calculated according to the 2−ΔΔCt method.
O
184 185
3
Fig. 2. Size distribution and annotation of smRNAs from the libraries of latent-infected and mock-infected THP-1 cells. Length distribution of sequenced reads. Both libraries accumulated 22-nucleotide smRNAs, which is consistent with the typical size of miRNAs.
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
220 221 222 223 224 225 226 227 228
231 232 233 234 235 236 237 238 239
4 t1:1 t1:2
M. Fu et al. / Gene xxx (2013) xxx–xxx
Table 1 HCMV miRNA sequence detected in latent-infected and mock-infected THP-1 cell libraries.
t1:3
miRNA name hcmv-miRa Sequenceb
Read count % of total
t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10
US25-1-5p US25-2-5p UL112-3p US5-2-3p US4-5p US5-1-3p US25-2-3p
176 45 15 11 6 6 6
65.2 16.7 5.6 4.1 2.2 2.2 2.2
5
1.9
t1:11
UL36-5p
AACCGCTCAGTGGCTCGGACC AGCGGTCTGTTCAGGTGGATGA AAGTGACGGTGAGATCCAGGCT TTATGATAGGTGTGACGATGT TGGACGTGCAGGGGGATGTCT TGACAAGCCTGACGAGAGCGT ATCCACTTGGAGAGCTCCCGCG GT TCGTTGAAGACACCTGGAAAGA
a
253 254 255 256 257 258 259 260 261 262 263 264 265
To explore the potential impact of HCMV latent infection on the miRNA expression profile of the host cells, we identified the human miRNAs that were differentially expressed in the latent-infected and mock-infected cells. The expression of the miRNAs in the two samples was visualized in a scatter plot (Fig. 4). We found that the distinct miRNAs had significantly different expression levels as measured by the frequency of read counts, indicating an excellent functional divergence of these miRNAs. For example, the hsa-let-7 family (hsa-let-7a5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, hsa-let-7f-5p, hsa-let7g-5p and hsa-let-7i-5p) was the most highly expressed miRNAs in the two samples. Virus latent infections can be expected to result in changes in cellular miRNA expression, biogenesis and/or activity. The relative counts of the sequencing reads were used to quantify the miRNA expression levels between latent-infected and mock-infected cells. Based on a normalized
F O R O
P
D
E
251 252
3.4. Differentially expressed cellular miRNAs between latent-infected and mock- infected THP-1 cells
Fig. 4. The miRNA expression level of latent-infected and mock-infected THP-1 cells. The count of each miRNA was plotted after normalization. Red color points show upexpressed miRNAs in latent-infected compare with mock-infected THP-1 cells with at least a 2-fold change and P-value below 0.001; Green color points show downexpressed miRNAs in latent-infected compare with mock-infected THP-1 cells; Blue color points show equally-expressed miRNAs between the two libraries. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
number of reads in the two samples, 49 of the cellular miRNAs showed a significantly greater (P-value ≤ 0.001) than two-fold change during latency (Table 2 and Table S2). Of these 49 miRNAs, 39 were up-regulated and 10 were down-regulated. To further validate these differentially expressed miRNAs, 13 were selected to perform quantitative RT-PCR assay from independent biological replicates. The 13 selected miRNAs comprised both highly expressed (e.g. hsa-miR-340-5p, hsa-miR-215p, hsa-miR-223-5p and hsa-miR-92b-3p) and poorly expressed miRNAs (e.g. hsa-miR-151a-3p, hsa-miR-320c and hsa-miR-451a) (see Table 3). As shown in (Fig. 5), a strong correlation (Pearson's correlation = 0.94) was revealed between the quantitative RT-PCR measurements and the deep sequencing data, indicating the robustness of deep sequencing-based expression analysis Previously, Poole et al. (2011) investigated the miRNA activity during virus latent infection and found that HCMV infection of CD34+ progenitor cells led to decreased expression of hsa-miR-92a, which resulted in the increased expression of GATA-2 expression and a subsequent increase in the expression of cellular IL-10. The virus may interact with cellular miRNAs differently in different cell types or in different human tissues. Intriguingly, among the miRNAs that were highly up-
T
250
C
249
E
248
R
246 247 Q4
R
244 245
O
242 243
miR-UL22A-3P, miR-UL148D, miR-UL36-3P, miR-US33-5p, and miRUS25-1-3P, were not detected in our deep sequencing libraries. Compared with the expression levels of virus miRNA in productive infections that were reported previously (Stark et al., 2012), the expression levels of the miRNAs in the latent infections in our libraries were much lower. This finding indicates that the expression level of miRNA is different in latent-infected and productive-infected cells. Among the viral miRNAs, four of them exhibited sequence counts large than 10. These four miRNAs were validated by real-time RT-PCR (see Table 3).
C
240 241
N
t1:13
We added “-5p” and “-3p” to indicate the miRNA origin on the corresponding precursor hairpin. b We picked as representative sequence the one with highest reads in the deepsequencing (given from 5′ to 3′).
U
t1:12
268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285
Table 2 t2:1 Top 10 miRNAs differentially expressed between the latent-infected and mock-infected li- t2:2 braries. t2:3 miRNA name
Fig. 3. HCMV miRNAs read counts in the deep-sequencing from HCMV-infected THP-1 cells. Read counts of all known HCMV miRNAs detected by deep-sequencing from HCMV-infected THP-1 cells.
266 267
hsa-miR-124-3p hsa-miR-1307-5p hsa-miR-33a-5p hsa-miR-378c hsa-miR-331-3p hsa-miR-185-3p hsa-miR-27a-3p hsa-miR-223-5p hsa-miR-4521 hsa-miR-642a-5p
Relative count Mock-infected
Latent-infected
1.6522 0.5507 2.0193 1.2850 0.5507 0.5507 10.3721 529.2519 30.2902 1.5604
95.7602 23.3905 33.2391 18.4662 6.8589 6.4192 84.5926 29.6338 5.5398 0.3517
Fold change
P-value
57.9592 42.4741 16.4607 14.3706 12.4549 11.6564 8.1558 17.8597 5.4677 4.4367
3.78E−285 1.86E−68 7.31E−82 1.67E−44 1.15E−16 2.29E−15 7.21E−161 0.00 1.54E−47 0.0032
t2:4 t2:5
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
t2:6 t2:7 t2:8 t2:9 t2:10 t2:11 t2:12 t2:13 t2:14 t2:15
M. Fu et al. / Gene xxx (2013) xxx–xxx
qRT-PCR Sequence confirmed
√
AACCGCTCAGTGGCTCGGACC
√
AGCGGTCTGTTCAGGTGGAT 0.00 45.00 GA AAGTGACGGTGAGATCCAGG 0.00 15.00 CT TTATGATAGGTGTGACGATG 0.00 11.00 TC UAAGGCACGCGGUGAAUGCC 1.65 95.76 CUAGACUGAAGCUCCUUG 3.21 7.83 AGG AACUGGCCUACAAAGUCCCA 3.03 17.76 GU CUGUGCGUGUGACAGCGGCU 10.19 23.57 GA UAGCUUAUCAGACUGAUGUU 2349.69 4678.36 GA 10.37 84.59 UUCACAGUGGCUAAGUUC CGC AAAAGCUGGGUUGAGAGGGU 2.94 7.21 UUAUAAAGCAAUGAGACUGA 110.05 259.41 UU UAUUGCACUCGUCCCGGCCU 39.93 85.03 CC UGGCUCAGUUCAGCAGGAAC 50.21 121.70 AG GCUAAGGAAGUCCUGUGCUC 30.29 5.54 AG CGUGUAUUUGACAAGCUGAG 529.25 29.63 UU AAACCGUUACCAUUACUGAG 1.56 0.53 UU AAATGAATCATGTTGGGCCT 77.00 59.00 GT AGGGGCGCGGCCCAGGAGCT 28.00 0.00 CAGA GAGTTAGCGGGGAGTGATAT 37.00 14.00 ATT CAAAATGATGAGGTACCTGA 15.00 0.00 TA GGAGGAACCTTGGAGCTTCG 29.00 40.00 GCA TCGGGCGGGAGTGGTGGCTT 4075.00 3547.00 TT AGGGGCGCGGCCCAGGAGCT 0.00 16.00 CAG
hsa-miR-210
√
t3:13
hsa-miR-21-5p
√
t3:14
hsa-miR-27a-3p
√
t3:15 t3:16
hsa-miR-320c hsa-miR-340-5p
√ √
t3:17
hsa-miR-92b-3p
√
t3:18
hsa-miR-24-3p
√
t3:19
hsa-miR-4521
√
t3:20
hsa-miR-223-5p
√
t3:21
hsa-miR-451a
√
t3:22
novel-miR-01
√
t3:23
novel-miR-02
√
t3:24
novel-miR-03
√
t3:26
novel-miR-05
√
t3:27
novel-miR-06
√
t3:28
novel-miR-07
√
t3:29
a
286
N C O
novel-miR-04
Indicates that the miRNA has not been validated by qRT-PCR.
292
3.5. Identification of novel cellular miRNAs
293 294
One of the advantages for high-throughput sequencing of smRNA transcriptomes is the potential discovery of novel miRNAs. Since Illumina sequence reads were also detected outside annotated cellular miRNA regions, we subjected the data sets to the MIREAP, an exquisite tool commonly used to identify putative novel miRNAs from highthroughput sequencing data (Chen et al., 2009). We identified 14 putative novel miRNAs from both libraries (Table S3): 11 in the HCMVinfected THP-1 library and 11 in the mock-infected THP-1 library, and 8 of them were common to both libraries. To further validate these
289
295 296 297 298 299 300 301
U
290 291
regulated in latent infection, hsa-miR-124 (58-fold) was the highest. Our attention was drawn to hsa-miR-124, which has also been implicated in the modulator of monocyte and macrophage activation. It has been reported that the miR-124 deactivated bone marrow-derived macrophages in vitro (Ponomarev et al., 2011), and might be important for HCMV that stay latently in cells of myeloid lineage.
287 288
Fig. 5. Validation of the Solexa sequencing with qRT-PCR analysis. Sequencing vs. qRT-PCR of miRNA fold-changes.
potentially novel miRNAs, we performed real-time RT-PCR analysis on 7 miRNA candidates with a normalized sequencing frequency larger than 10 (the other miRNAs were excluded because their expression levels were too low to be detected by real-time RT-PCR). As a result, we have validated six of them (Table 3), indicating that 85% could be validated by a sequencing-independent method.
T
a
t3:25
F
t3:12
O
√
√
R O
hsa-miR-193a-3p
t3:8
√
P
t3:11
t3:7
176.00
D
√ √
t3:6
0.00
E
t3:9 t3:10
hcmv-miR-US251-5p hcmv-miR-US252-5p hcmv-miR-UL1123p hcmv-miR-US-23p hsa-miR-124-3p hsa-miR-151a-3p
C
t3:5
Relative count MockLatentinfected infected
E
miRNA ID
t3:4
R
t3:3
Table 3 The miRNAs validated by qRT-PCR.
R
t3:1 t3:2
5
302 303 304 305 306 307
3.6. Predicted targets of differentially expressed cellular miRNAs
308
To explore the biological function of the differentially expressed miRNAs identified in our analysis, we used two independent algorithms, miRanda and RNAhybrid, to predicted mRNA targets for each of the miRNAs that was differentially expressed significantly. Table S4 lists the targets that are predicted by both algorithms. Using this criterion, a total of 300 genes are predicted as the potential targets of these miRNAs. To analyze the role that the miRNAs might play in the regulatory networks, we assigned the putative miRNA targets to KEGG pathways, and found that 11 of the pathways are significantly enriched (P b 0.001 with Benjamini correction). It has been shown that most of the significant KEGG terms were involved in melanogenesis (ko04916), pathways in cancer (ko05200), endocytosis (ko04144) and wnt signaling pathway (ko04310). Some of these predicted targets are also associated with cellular pathways related to MAPK signaling and mTOR signaling, which were important during HCMV infection (Reeves et al., 2012; Wang et al., 2008).
309 310
4. Discussion
325
Previous studies of human herpesviruses and their miRNAs have focused on the virally encoded miRNAs during lytic infection and not during latent infections when virally encoded miRNAs can also play roles. During latency, some viral miRNAs contribute to maintaining the IE genes in an inactive state (Grey et al., 2007; Murphy et al., 2008; Umbach et al., 2008), which are expected to result in changes in cellular miRNA expression, biogenesis, or activity. Here we examined the connection between latent infection and virus–host interactions present within the HCMV-infected THP-1 cells. In this study, we found that eight HCMV-encoded mature miRNAs were expressed during latency. MiR-US25-1 and miR-US25-2 are constituted almost 82% of the total HCMV miRNAs reads. The extremely high expression of these two miRNAs suggests that these miRNAs may contribute to the establishment of latency. These two miRNAs have been shown to inhibit viral DNA synthesis and viral replication of both
326 327
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
311 312 313 314 315 316 317 318 319 320 321 322 323 324
328 329 330 331 332 333 334 335 336 337 338 339 340
364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406
415
We declare that there is no conflict of interests.
F
Acknowledgments
409 410 411 412 413 414
416 417 418 419
References
424
O
We thank Jinyu Wu for technical assistance with in-depth data analysis and manuscript organization. This work was supported by the grants from the National Science Foundation of China (No. 81071365), Zhejiang Provincial Natural Science Foundation of China (LY13H190006) and Key Science and Technology Innovation Team of Zhejiang Province (2012R10048-11).
R O
362 363
Conflict of interests
P
360 361
407 408
Bartel, D.P., Chen, C.Z., 2004. Micromanagers of gene expression: the potentially widespread influence of metazoan microRNAs. Nat. Rev. Genet. 5 (5), 396–400. Skalsky, R.L., Cullen, B.R., 2010. Viruses, microRNAs, and host interactions. Annu. Rev. Microbiol. 64, 123–141. Khoshnevis, M., Tyring, S.K., 2002. Cytomegalovirus infections. Dermatol. Clin. 20 (2), 291–299. Umbach, J.L., Kramer, M.F., Jurak, I., Karnowski, H.W., Coen, D.M., Cullen, B.R., 2008. MicroRNAs expressed by herpes simplex virus 1 during latent infection regulate viral mRNAs. Nature 454 (7205), 780–783. Cai, X., Lu, S., Zhang, Z., Gonzalez, C.M., Damania, B., Cullen, B.R., 2005. Kaposi's sarcomaassociated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc. Natl. Acad. Sci. U. S. A. 102 (15), 5570–5575. Cai, X., et al., 2006. Epstein–Barr virus microRNAs are evolutionarily conserved and differentially expressed. PLoS Pathog. 2 (3), e23. Triboulet, R., et al., 2007. Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Science 315 (5818), 1579–1582. Stern-Ginossar, N., et al., 2007. Host immune system gene targeting by a viral miRNA. Science 317 (5836), 376–381. Tuddenham, L., Pfeffer, S., 2011. Roles and regulation of microRNAs in cytomegalovirus infection. Biochim. Biophys. Acta 1809 (11–12), 613–622. Stark, T.J., Arnold, J.D., Spector, D.H., Yeo, G.M., 2012. High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection. J. Virol. 86 (1), 226–235. Wang, F.Z., Weber, F., Croce, C., Liu, C.G., Liao, X., Pellett, P.E., 2008. Human cytomegalovirus infection alters the expression of cellular microRNA species that affect its replication. J. Virol. 82 (18), 9065–9074. Grey, F., Meyers, H., White, E.A., Spector, D.H., Nelson, J., 2007. A human cytomegalovirusencoded microRNA regulates expression of multiple viral genes involved in replication. PLoS Pathog. 3 (11), e163. Prichard, M.N., Gao, N., Jairath, S., Mulamba, G., Krosky, P., Coen, D.M., et al., 1999. A recombinant human cytomegalovirus with a large deletion in UL97 has a severe replication deficiency. J. Virol. 73 (7), 5663–5670. Reeves, M.B., MacAry, P.A., Lehner, P.J., Sissons, J.G., Sinclair, J.H., 2005. Latency, chromatin remodeling, and reactivation of human cytomegalovirus in the dendritic cells of healthy carriers. Proc. Natl. Acad. Sci. U. S. A. 102 (11), 4140–4145. Zhu, E., et al., 2010. mirTools: microRNA profiling and discovery based on highthroughput sequencing. Nucleic Acids Res. 38, W392–397 (Web Server issue). Xu, G., et al., 2010. Characterization of the small RNA transcriptomes of androgen dependent and Independent prostate cancer cell line by deep sequencing. PLoS ONE 5 (11), e15519. Jayarama, V., et al., 2006. Development of models and detection methods for different forms of cytomegalovirus for the evaluation of viral inactivation agents. Transfusion 46 (9), 1580–1588. Bego, M., Maciejewski, J., Khaiboullina, S., Pari, G., St Jeor, S., 2005. Characterization of an antisense transcript spanning the UL81–82 locus of human cytomegalovirus. J. Virol. 79 (17), 11022–11034. Beisser, P.S., Laurent, L., Virelizier, J.L., Michelson, S., 2001. Human cytomegalovirus chemokine receptor gene US28 is transcribed in latently infected THP-1 monocytes. J. Virol. 75 (13), 5949–5957. Jenkins, C., Abendroth, A., Slobedman, B., 2004. A novel viral transcript with homology to human interleukin-10 is expressed during latent human cytomegalovirus infection. J. Virol. 78 (3), 1440–1447. Goodrum, F.D., Jordan, C.T., High, K., Shenk, T., 2002. Human cytomegalovirus gene expression during infection of primary hematopoietic progenitor cells: a model for latency. Proc. Natl. Acad. Sci. U. S. A. 99 (25), 16255–16260.
D
358 359
In summary, we used a miRNA sequencing approach to study the HCMV-host transcriptomes in latently infected THP-1 cells and found several HCMV miRNAs and differentially expressed cellular miRNAs. This approach could lead to the development of a miRNA-based therapeutic approach that could reduce the severity of viral infection in immunocompromised individuals. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2013.12.012.
T
356 357
C
354 355
E
352 353
R
350 351
R
348 349
O
347
C
345 346
N
343 344
HCMV and other DNA viruses (HSV-1 and adenovirus) (Stern-Ginossar et al., 2009). Thus, we hypothesized that targets of miR-US25-1 and miR-US25-2 are essential for viral growth. Recently, Grey et al. (2010) demonstrated that miR-US25-1 targets many of the cellular genes associated with cell cycle control. They found that miR-US25-1 could bind to regions within the 5′ UTR of different mRNA transcripts, including cyclin BRCC3, EID1, E2, MAPRE2 and CD147 (Grey et al., 2010). Similar to these discoveries for HCMV, HSV-1 also expresses at least two miRNAs in latently infected neurons that target the ICP4 and ICP0, and it has been suggested that these miRNAs may contribute to the establishment and maintenance of latency by inhibiting IE and early gene expression (Umbach et al., 2008). The less highly expressed miR-UL112 in our study is predicted to target UL114, reducing its activity as a uracil DNA glycosylase (Stern-Ginossar et al., 2009). MiR-UL112 has also been shown to target the IE genes (including the major IE gene, IE72) (Grey et al., 2007; Murphy et al., 2008). Interestingly, miR-UL-112 also averts natural killer cell recognition by targeting the cellular stress-inducible MICB ligand for the NKG2D activating receptor (Nachmani et al., 2010; Stern-Ginossar et al., 2007). Thus, these studies begin to define an elegant mechanism by which miR-UL112 coordinately down-modulates the immune response and viral replication for viral persistence. Taken together, it seems that the expression of viral miRNAs provides herpesviruses with a nonimmunogenic strategy to stably alter the cellular environment during persistence. Furthermore, we were able to find the expression of other HCMV miRNAs, including miR-US5-2, miR-US5-1, miR-US4-5p, miR-US25-23P, and miR-UL-36-5p. The recent studies demonstrated that the miRNAs miR-US5-1 and miR-US5-2 encoded by HCMV synergistically regulate US7, even at a very low concentration (Tirabassi et al., 2011). MiR-US4-1 specifically represses the expression of endoplasmic reticulum (ER)-associated aminopeptidase (ERAP)1, an inhibitor of cytotoxic T lymphocytes (CTLs) response (Kim et al., 2011). We hypothesized that an additional tactics of immune evasion may be mediated by these miRNAs, especially during latent infection. Given the limited viral gene expression during HCMV latency, it is likely that the virus would use multiple methods to modulate and fine tune cellular gene expression in order to optimize carriage and reactivation of the latent virus. In this study, we have generated a large data set of cellular miRNAs that are differentially expressed between latentinfected and mock-infected THP-1 cells. One interesting observation is the 50-fold over-expression of has-miR-124 in the latent-infected THP-1 cells. Several studies have demonstrated that non-differentiated THP-1 cells do not support HCMV lytic infection unless they are differentiated into macrophage-like cells (Khaiboullina et al., 2004; Turtinen and Seufzer, 1994). In addition, another study reported that miR-124 modulated monocyte and macrophage activation by direct inhibition of C/EBP-α and its downstream transcription factor PU.1 (Ponomarev et al., 2011). In the present study, has-miR-124 was highly up-regulated during HCMV latency, suggesting that it could have a major role in inhibiting macrophage activation to create an environment suitable for establishing latency. We also identified a set of differentially expressed human miRNAs including miR-340-5p, miR-21-5p, miR-92b-3p, miR-151a-3p, hsamiR-320c, hsa-miR-451a; miR-24 and miR-27 that have been reported to have a global antiviral role against all viruses (Santhakumar et al., 2010). Interestingly, we found that miR-223-5p was one of the most dramatically down-regulated miRNAs following HCMV infection and miR-223-5p has been reported to target the 3′ UTR of HIV-1 mRNA. MiRNA-mediated regulation of HIV-1 transcripts has been shown to play a role in the maintenance of viral latency (Huang et al., 2007). Functional annotation of the miRNA target genes indicated that most of the differentially expressed miRNA targeted genes were involved in signal transduction and cell communication, especially the melanogenesis, pathways in cancer endocytosis, wnt signaling, MAPK signaling and mTOR signaling. Cellular signaling events are important for creating a cellular environment that is permissive for latency.
U
341 342
M. Fu et al. / Gene xxx (2013) xxx–xxx
E
6
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
420 421 422 423 Q5
425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479
M. Fu et al. / Gene xxx (2013) xxx–xxx
Grey, F., et al., 2010. A viral microRNA down-regulates multiple cell cycle genes through mRNA 5′ UTRs. PLoS Pathog. 6 (6), e1000967. Nachmani, D., Lankry, D., Wolf, D.G., Mandelboim, O., 2010. The human cytomegalovirus microRNA miR-UL112 acts synergistically with a cellular microRNA to escape immune elimination. Nat. Immunol. 11 (9), 806–813. Tirabassi, R., et al., 2011. Human cytomegalovirus US7 is regulated synergistically by two virally encoded microRNAs and by two distinct mechanisms. J. Virol. 85 (22), 11938–11944. Kim, S., et al., 2011. Human cytomegalovirus microRNA miR-US4-1 inhibits CD8(+) T cell responses by targeting the aminopeptidase ERAP1. Nat. Immunol. 12 (10), 984–991. Khaiboullina, S.F., et al., 2004. Human cytomegalovirus persists in myeloid progenitors and is passed to the myeloid progeny in a latent form. Br. J. Haematol. 126 (3), 410–417. Turtinen, L.W., Seufzer, B.J., 1994. Selective permissiveness of TPA differentiated THP-1 myelomonocytic cells for human cytomegalovirus strains AD169 and Towne. Microb. Pathog. 16 (5), 373–378. Santhakumar, D., et al., 2010. Combined agonist–antagonist genome-wide functional screening identifies broadly active antiviral microRNAs. Proc. Natl. Acad. Sci. U. S. A. 107 (31), 13830–13835. Huang, J., et al., 2007. Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat. Med. 13 (10), 1241–1247.
F
Cheung, A.K., Abendroth, A., Cunningham, A.L., Slobedman, B., 2006. Viral gene expression during the establishment of human cytomegalovirus latent infection in myeloid progenitor cells. Blood 108 (12), 3691–3699. Nevels, M., Paulus, C., Shenk, T., 2004. Human cytomegalovirus immediate-early 1 protein facilitates viral replication by antagonizing histone deacetylation. Proc. Natl. Acad. Sci. U. S. A. 101 (49), 17234–17239. Poole, E., McGregor Dallas, S.R., Colston, J., Joseph, R.S., Sinclair, J., 2011. Virally induced changes in cellular microRNAs maintain latency of human cytomegalovirus in CD34+ progenitors. J. Gen. Virol. 92 (pt 7), 1539–1549. Ponomarev, E.D., Veremeyko, T., Barteneva, N., Krichevskyam, A.M., Weiner, H.L., 2011. MicroRNA-124 promotes microglia quiescence and suppresses EAE by deactivating macrophages via the C/EBP-alpha-PU.1 pathway. Nat. Med. 17 (1), 64–70. Chen, X., et al., 2009. Identification and characterization of novel amphioxus microRNAs by Solexa sequencing. Genome Biol. 10 (7), R78. Reeves, M.B., Breidenstein, A., Compton, T., 2012. Human cytomegalovirus activation of ERK and myeloid cell leukemia-1 protein correlates with survival of latently infected cells. Proc. Natl. Acad. Sci. U. S. A. 109 (2), 588–593. Murphy, E., Vanicek, J., Robins, H., Shenk, T., Levine, A.J., 2008. Suppression of immediateearly viral gene expression by herpesvirus-coded microRNAs: implications for latency. Proc. Natl. Acad. Sci. U. S. A. 105 (14), 5453–5458. Stern-Ginossar, N., Saleh, N., Goldberg, M.D., Prichard, M., Wolf, D.G., Mandelboim, O., 2009. Analysis of human cytomegalovirus-encoded microRNA activity during infection. J. Virol. 83 (20), 10684–10693.
O
480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502
7
U
N C O
R
R
E
C
T
E
D
P
R O
526
Please cite this article as: Fu, M., et al., Human cytomegalovirus latent infection alters the expression of cellular and viral microRNA, Gene (2013), http://dx.doi.org/10.1016/j.gene.2013.12.012
503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525
