Honey dilution impact on in vitro wound healing: Normoxic and hypoxic condition.

Title of the article Honey dilution impact on in vitro wound healing: Normoxic and hypoxic condition Corresponding author Full Name: Amrita Chaudhary Highest academic degree(s): M.Sc. Institutional affiliation: Doctoral Research Scholar Postal Address: School of Medical Science and Technology, Indian Institute of Technology, Kharagpur, Kharagpur-721302, West Bengal, India. E-mail:[email protected] Telephone number: (+91) 9475355875 Fax: 91-32222 82221 Co-authors

Full name

Highest academic degree(s)

Institutional affiliation

Swarnendu Bag

M.Tech.

Doctoral Research Scholar

Ananya Barui

Ph.D.

Assistant Professor

Provas Banerjee

Ph.D.

Director

-------------

Jyotirmoy Chatterjee

Ph.D.

Associate Professor

School of Medical Science and Technology

Department

Institution

City

School of Medical Science and Technology Centre for Healthcare Science and Technology

Indian Institute of Technology- Kharagpur Kharagpur Indian Institute of Engineering Science Howrah and TechnologyShibpur Banerjees’ Biomedical Research FoundationBirbhum Sainthia Indian Institute of Technology- Kharagpur Kharagpur

Country

India

India

India

India

Short running title: Honey dilution in hypoxic wound healing Key Words- Honey dilution; Antioxidant; Normoxia; Hypoxia; Wound healing; Migration; Proliferation Source of Funding: Science and Engineering Research Board (Sanction order No. SR/SO/HS/-006/2011) Department of Science & Technonolgy, New Delhi, Government of India and University Grant Commission, New Delhi, India (Ref: F. No. 19-6/2011(i) EU-IV, dated, 30.11.2011). This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1111/wrr.12297 This article is protected by copyright. All rights reserved.

Manuscript under review - CONFIDENTIAL

Page 2 of 32

ABSTRACT Honey is known as a popular healing agent against tropical infections and wounds. However, the effects of honey dilutions on keratinocyte (HaCaT) wound healing under hypoxic condition is still not explored. In this study, we examined whether honey dilution have wound healing potential under hypoxic stress. The anti-oxidant potential and healing efficacy of honey dilution on in vitro wound of human epidermal keratinocyte (HaCaT cells) under hypoxia (3 % O2) and normoxia is explored by NBT assay. The cell survival % quantified by MTT assay to select 4 honey dilutions like 10, 1, 0.1 and 0.01 v/v % and the changes in cellular function was observed microscopically. Further, the cell proliferation, migration, cell-cell adhesion and relevant gene expression were studied by flow-cytometry, migration / scratch assay, immuno- cytochemistry and RT-PCR respectively. The expression pattern of cardinal molecular features viz. E-cadherin, cytoskeletal protein F-actin, p63 and hypoxia marker Hif 1 α were examined. Honey dilution in 0.1% v/v combat wound healing limitations in vitro under normoxia and hypoxia (3%). Its wound healing potential was quantified by immuno-cytochemistry and real-time PCR for the associated molecular features that were responsible for cell proliferation and migration. Our data showed that honey dilution can be effective in hypoxic wound healing. Additionally, it reduced superoxide generation and supplied favorable bio-ambience for cell proliferation, migration and differentiation during hypoxic wound healing. These findings may reveal the importance of honey as an alternative and cost effective therapeutic natural product for wound healing in hypoxic condition.

2 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 3 of 32


INTRODUCTION Wound healing is a complex biological process in human body, involving four major steps like homeostasis, inflammation, proliferation and remodeling. During inflammatory phase of wound healing, vasodilatation occurs which allocate different types of cell as well as oxygen to the wound site for continuing the healing process.1In wounded tissues or organs, hypoxia arises due to vascular damage which leads to decrease in blood supply and more oxygen intake by proliferative and migratory cells.2 The skin is slightly hypoxic in nature3 but more hypoxic microenvironment occurs after injury leading to high oxygen demand by marginal cells of wound area and granulation tissue.4In addition, hypoxic environment generates free radicals, such as reactive oxygen species which affect the normal wound healing process.5Predominantly, mitochondrial oxidative stress of mammalian cells arises under hypoxic condition and the mechanism is still not well identified. Moreover, not only oxygen free radical (O2·) but reactive nitrogen species (NO· and ONOO-) are also responsible generating free radical under hypoxic stress condition.6,7 In chronic wounds inflammatory state is prolonged which embeds ample infiltration of neutrophils causing production of reactive oxygen species (ROS) having detrimental effects on regenerating cells.8 Under hypoxia, in vitro wound model reports deterministic importance of NADPH oxidases (Nox) in ROS formation which is additive on cellular migration and related molecular expression, a developing area to explore.9 Presently, researchers are trying to search complementary, alternative and cost efficient medicine to persuade appropriate conditions for natural healing process. In this regard healing efficacy of honey against tropical infections and wounds mentioned by some researchers in last few years10 but observations of honey dilutions are scanty. Being hygroscopic in nature, honey gets diluted by absorbing bio-fluids along with systemic assimilation of relevant bioactive components.11 Honey is a potential source of natural anti-oxidants which becomes more active in dilutions. Wound healing progression supported by low concentration of H2O212 and honey in dilution with low concentration of H2O2 showed least cytotoxic effect on mammalian cells.13,14 Further, it’s antioxidant and anti-inflammatory activity provide a favorable bio-ambience for wound healing.15 3 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.


Page 4 of 32

The wound healing process become challenging when chronic hypoxia or ischemia arises.16 Further, hypoxic condition regulates the gene responsible for migration of cells, angiogenesis, tissue repair and remodeling via various signaling pathways and a key transcription factor, hypoxia-inducible factors (HIFs).17 Hypoxia inducible factor 1 (Hif 1), a heterodimeric transcription factor which is present upstream of Vegf and other genes responsible for hypoxic condition, plays a crucial role in oxygen homeostasis.18 It comprises of two subunits, hypoxia-stabilized-α subunit (Hif 1α) and constitutively expressed β subunit also called aryl hydrocarbon receptor nuclear translocator (ARNT).19 Under normoxic condition Hif 1 α degrades by ubiquitilization however, under hypoxia Hif 1 α stabilizes and accumulates to increase the transcription of its target genes.3 p63, a prime regulator gene for epithelial cell proliferation and maturation20 associated with Hif 1 α via VEGF21 whereas hypoxia also modulates expression pattern of E-cadherin.22 E- cadherin is a cell-cell adhesion protein which plays a crucial role in maintaining cell-cell and cell- extra-cellular interactions. These interactions strengthen by bridges between E-cadherin and actin cytoskeleton via catenins (cytoskeletal proteins).23 The migration of cell depends on the extra-cellular matrix which influenced actin cytoskeleton.21The differential interaction between E-cadherin-catenin and actin stabilizes the junction and also persuade the trafficking.24The adjacent cells of wound margin release their columnar polarity and have tendency to migrate by altering the arrangement and organization of actin-cytoskeleton. The migratory cells show more expression of F-actin (lamellopodia).25 In case of wound healing there is transitory or permanent down regulation of E-cadherin because of endo-cytosed E-cadherin24 but the effect of hypoxia on intercellular junctions is not clearly defined.26 Previously, it was reported that topical application of honey is very effective in wound healing. However, the responsive activity of hypoxia during in vitro epithelial (HaCaT cells) wound healing and relevant cardinal gene expressions under honey dilutions need to be explored. Our study presents a characteristic prospect to temporally analyze the supportive role of honey dilution under hypoxic condition on HaCaT cell population by assessing the prime epithelial marker E-cadherin, cytoskeletal protein F-actin, p63 and hypoxia marker Hif 1 4 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 5 of 32


α. Firstly, we prepared honey dilutions in Delbecco’s Modified Eagle Media (DMEM/F12) (v/v %). Further, the honey sample tested on HaCaT cells for antioxidant activity, cell survival % and cell cycle under hypoxia (3 % O2) and normoxia. Based on these results 4 honey dilutions: 10, 1, 0.1 and 0.01 v/v % were identified to observe the changes in cellular functionality by immuno-cytochemistry and RT-PCR during wound healing. Immuno-cytochemistry of the expression pattern of Hif 1 α with effect to those of E-cadherin, F-actin and p63 along with RT-PCR of Hif 1 α, E-cadherin, and p63 in normoxia and hypoxia were performed. MATERIALS AND METHODS Honey sample Monofloral jamun honey (Societe naturelle) less than 1-year old, were purchased from reputed Indian company (Societé Naturelle, S-18 E Shakarpur, Delhi 110092, India). Prior to apply it in dilutions on HaCaT cells, we physico-chemically characterized it earlier and certain parameters viz. pH, conductivity, moisture and solid content, color, total sugar and protein content were found in optimum range as mentioned by Codex Alimentarius, 200127 and should be present in any medical grade honey sample Supplementary Table (ST) 1. Further, antioxidant properties like total phenol and flavonoid content, DPPH free radical scavenging and catalase activity were also evaluated ST 2. Materials HaCaT cells were obtained from NCCS Pune, Maharastra, India. Antimycotic antibiotic, DMEM/F12 media, Fetal bovine serum (FBS), L-glutamine and 0.05% trypsin-EDTA solution, phosphate buffered saline (PBS) and MTT reagent {(3-(4,5-dimethylthiazol2yl)-2,5-diphenyl tetrazolium bromide} TC191-1G, were obtained from Himedia, India. Propidium iodide AnaSpec, Inc. CA, USA, TRIzol reagent was purchased from Ambion, Life Technologies, CA, USA, High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA), iQTM Sybr® Green Supermix (BioRad, CA, USA), goat serum, Primary antibodies (Anti-E-Cadherin, clone EP700Y, Cat. No. ab40772, Abcam Cambridge, UK, Anti-Hif-1 α clone EP1215Y, Cat. No. ab51608, Abcam Cambridge, 5 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.


Page 6 of 32

UK and Rhodamine Phalloidin, Cat. No. R415, Invitrogen Molecular Probes®, Eugene, USA) DAPI (Sigma-Aldrich, USA). All other reagents were of analytical grade. Cell Culture HaCaT cells (immortal keratinocytes) were grown at concentration of 105 cells/ml on lysine coated coverslips in 35mm petridish under honey (Physico-chemically characterized) dilutions (10%, 1%, 0.1%, 0.01%) in DMEM/F12 media and incubated in CO2 incubator (Heracell i150, Thermo, USA, at 37 °C temperature with 5 % CO2). For hypoxic treatment, cells were exposed to hypoxia in hypoxia incubator (Galaxy R Series 48 R CO2 Incubator, New Jersey, U.S.A.) supplied by 5% carbon dioxide, 3% oxygen, balance nitrogen and humidity. Nitro Blue Tetrazolium (NBT) Assay NBT assay was performed to estimate intracellular superoxide anions production. Briefly, after each honey dilution treatment, cells were incubated with 0.1 mg of NBT per ml of media for 3 hrs. Further cells washed three times with methanol and NBT-formazan crystals solubilized by KOH 2M/DMSO solution. Absorbances were taken out at 630 nm. with KOH 2M/DMSO as a blank. Keratinocyte Survival (MTT) Assay Cell survival was quantified by MTT Assay. In hypoxic and normoxic condition, 3000 cells per well were seeded in 96 micro-titre well plate containing 200 µl. of honey dilutions in media and media only as control. After 18 hrs. in normoxia, cells were exposed to hypoxia for next 18 hrs. Cells were treated with freshly prepared MTT reagent for 2 hrs and same amount of DMSO was added. Absorbances were taken out at 595 nm. with DMSO as a blank. Cell survival rate was calculated in triplicates. Cell survival rate was calculated by using the formula: Survival Rate (%) = (Asample– Ab) / (Ac – Ab) x 100 Where, Asample– The absorbance of test sample Ab – The absorbance of blank 6 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 7 of 32


Ac – The absorbance of control Cell cycle analysis in wound healing Cell cycle was analyzed by using propidium iodide. Briefly 5 × 106 cells were seeded in 6-well plates 60-mm culture dishes to reach confluency and multiple artificial wounds created by 200 µl. pipette tip. After this de-attached cells were washed by PBS and treated by honey dilutions in DMEM F12 media. Further cell culture maintained in hypoxic (5% carbon dioxide, 3% oxygen, balanced nitrogen and humidity) and normoxic (5% carbon dioxide, 21% oxygen, balanced nitrogen and humidity) conditions. After 18 hrs. treatment and incubation, cells were harvested and fixed with ice-cold 70% ethanol overnight. The fixed cells were centrifuged, washed with PBS twice and resuspended in 1 ml. of PBS containing 100 µg/mL RNase incubated at 37◦C for 15 min. Thereafter, they were incubated with 40 µg/mL PI in the dark for 30 min at room temperature. Cell cycle distribution were analyzed from DNA histogram by flow-cytometry on BD Accuri c6 Flowcytometer (Becton Dickinson, Franklin Lakes, NJ). Transmembrane Migration Assay Cell migration was performed by InnoCyte™ Cell Migration Assay (EMD Millipore, Germany). The HaCaT cells are seeded in upper side of the membrane (8 µm. pore size) whereas honey dilutions positioned on the opposing side of the well. After incubation in normoxic and hypoxic conditions for 18 hrs., the migrated cells on the lower part of the chamber were detached and stained by Calcein-AM as per manufacture’s protocol. For each dilution, experiment was repeated thrice. The fluorescence measured by GloMaxRMulti Jr, Madison, USA using blue fluorescence optical filters. Scratch Assay HaCaT cells were cultured on lysine coated coverslips to attain confluency. Honey dilutions in media were applied after creating an artificial wound by 200 µl sterile pipette tip on HaCaT confluent monolayer. Further, cells were cultured both in normoxia and hypoxia (3%). The phase contrast images were taken after 18 hrs. and wound area determined by Axiovision Rel. 4.7 software for The wound closure % was quantified by formula.



Page 8 of 32

wound closure %= (pre wound area-post wound area)/pre wound area x 100 (For each dilution, experiment was repeated thrice.) Immuno-cytochemical analysis for Hif 1 α, E-cadherin, F-actin, p63 For immuno-cytochemical assay cells grown on lysine coated cover-slips

were

fixed with 4% paraformaldehyde in PBS for 10 min at 25 ºC. Serum block (10% goat serum in PBST) were applied to block non-specific binding of the antibodies and incubated with diluted primary antibodies (E-cadherin, p63, Hif 1 α). HRP conjugated secondary antibody used for chromogenic and FITC conjugated secondary antibody for fluorescence detection. Further the cells were counter stained by Meyers Hematoxylin (for enzymatic detection) or DAPI (for fluorescence detection). All the antibody reactions were performed in dark at room temperature (25 ºC). For F-actin molecule diluted fluorescent phallodoin were used according to manufacturer’s instruction. Gene expression analysis during wound healing The confluent monolayer of HaCaT cells were grown in 35 mm. petri-dish and multiple artificial wound were created by using 10 µl. pipette tip. After wound formation cells were subjected to hypoxic exposure (3% O2) in computerized hypoxia incubator for 4 and 18 hrs. under different honey dilutions including DMEM/F12 media as control. RNA extraction and cDNA synthesis For gene expression analysis m-RNA was extracted by TRIzol reagent according to manufacturer’s protocol. The extracted RNA was checked in nanodrop (Nano Vue, GE Health Care) .c-DNA synthesis was performed by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) in a GeneAmp® PCR System 2720 Thermal Cycler (Applied Biosystems) according to the manufacturer's protocol. Real time-PCR The real time-PCR reactions were performed in triplicates on Light Cycler® 480 II (Roche Diagnostics GmbH, Mannheim, Germany), using Light Cycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany). 18S rRNA were used 8 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 9 of 32


as reference gene. Negative controls without template were incorporated in each set of PCR assays. Sequence primers used for the various genes and their cycling conditions are mentioned in ST 3. Further, fold change derived from ∆Ct value (conversely proportional to gene expression) was calculated by normalizing Ct value of target gene through Ct value of reference gene. Statistical analysis For ICC, grey scale intensity value of immuno-cytochemical protein expression for p63 and Hif 1α were computed by Axiovision Rel.4.7 software further, notch box plots were drawn by using Matlab R 2012 b software. Statistical significance was evaluated by Micosoft Office Excel 2007.

RESULTS Effect of honey dilutions (normoxic vs hypoxic) on anti-oxidant properties and cell survival NBT reduction assay was used to find out the production intracellular ROS primarily O-2. Lower the absorption at 630 nm. higher the anti-oxidant activity (superoxide scavenging activity).We examined the effects honey dilution on antioxidant properties like superoxide scavenging activity of HaCaT cell under normoxia and hypoxia. 10 % and 5 % have higher anti-oxidant activity both in normoxia and hypoxia but not supportive for cell survival. 0.01 % and 0.1% showed maximum antioxidant activity in normoxia and hypoxia (Fig.1A). The cell survival rate % of HaCaT cells under different honey dilutions were determined by MTT assay and it was observed that at higher honey concentration, cell viability was reduced. The survival rate (%) of HaCaT cells in hypoxia was maximum in 0.1% dilution as compared to control (Fig.1B). Figure 1. Figure 2.



Page 10 of 32

The regulation of cell cycle under honey dilution treated wound both in normoxia and hypoxia were examined which demonstrated that the G0/G1 cell population remained effectively unchanged in control and 1 % under normoxia but in case of 0.1% honey dilution, G2/M phase showed highest percentage of cells (14.9). Meanwhile, 0.1 % dilution in hypoxia showed maximum population of cells in G2/M phase after control (Fig.2). The cell population in 0.1 and 0.01 % dilutions remained same in hypoxia. This increase of cell number in G2/M phase accompanied by decrease of cell number in G0/G1 phase. However, 0.1% dilution of honey induced the cell cycle toward more G2/M (proliferative) phase in normoxia and up to some extent in hypoxia. Impact of honey dilutions on HaCaT cells migration and cyto-skeletal arrangement in normoxia and hypoxia (3% Oxygen) In respect to evaluate impact of honey dilutions on in vitro (HaCaT cell) scratch wound healing, the wound healing rate [wound fraction (wt/w0)] calculated. Fig.3A & B showed that the overall wound closure rate was highest under 0.1 % and lowest in 1 % dilution as compared to control both in normoxia and hypoxia. Further, migration assay of HaCaT cells, the FSU (Fluorescence Standard Units) value calculated for selected honey dilutions (viz. 1, 0.1, 0.01, v/v %) indicated that the cell migration increases as dilution increases in both normoxia and hypoxia however, the migration is more in hypoxic 0.1% as compared to normoxia (Fig. 3C). Figure 3. Figure 4. We demonstrated that under hypoxic stress, the cytoplasmic expression of E-cadherin increases. In control under normoxic culturing condition, the trans-membrane adherens junction proteins E-cadherin confined to the cell membrane. However, membranous E-cadherin expression levels were markedly decreased in 0.01 and 0.1% dilution (Fig.4A; a1-d1). Hypoxic exposure (18 hrs.) on HaCaT cells under honey dilutions was compared and it was observed that there was delocalization of the expression pattern of E-cadherin from membranous to cytoplasmic (Fig.4A; a2-d2). 10 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 11 of 32


Further, under 0.1 % dilution cells were more elongated compared to 0.01% dilution. (Fig.4C) and the gene expression findings of E-cadherin also demonstrated remarkable up-regulation in 0.1% v/v dilution (Fig. 4B). Figure 5. In normoxic and untreated HaCaT cells, actin mainly localized to the peripheral fiber bundles, (Fig. 5, a1-d1), whereas under hypoxia (3% O2) transition of peripheral fiber of actin to stress fibers (filamentous structure) observed (Fig. 5, a2-d2). The stress fiber formation in 0.1 % dilution was less compared to other dilutions in hypoxia (Fig. 5, c2). Impact of honey dilutions on cell proliferation (normoxic vs hypoxic) Semi-quantification of nuclear expression for p63 analyzed immunocyto-chemically by chromogenic method. Mean grey scale intensity of nucleus evaluated by Image J software and notch box plotted using MATLAB R2012b. ICC data showed a significant elevation in p63 expression in 0.1% honey dilution both under normoxic (p= 0.003) as well as hypoxic (p= 0.004) condition as compared to control; while in 1 and 0.01 % dilution, p63 expression was considerably suppressed compared to control (Fig. 6A & B). Fig. 5C represented the enlarged view of marginal cells for p63 expression. The ICC findings for p63 were supported by mRNA, verifying noticeable up-regulation under 0.1% honey dilution and down-regulation under 0.01% dilution both in normoxic and hypoxic conditions (Fig. 6D). Figure 6. Inhibition of Hif 1 α expression under honey dilutions in hypoxia (3% Oxygen) on HaCaT cells Regarding Hif 1 α expression mean gray scale intensity of nucleus was calculated by image J software and notch box plotted using MATLAB R2012b. The Hif 1 α expression was significantly less (p=1.06577E-21) in 0.1 and (p= 8.25393E-20) 0.01 % dilution under 18 hrs. normoxia as compared to control and 1% dilution, whereas in hypoxic 0.1 % dilution significant (p=9.61947E-19) decrease reported by comparing control and other dilutions (1 & 0.01%) (Fig. 7A & B). The ICC findings for p63 were supported by 11 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.


Page 12 of 32

mRNA, verifying noticeable down-regulation under 0.1% honey dilution and upregulation under 0.01% dilution both in normoxic and hypoxic conditions (Fig. 7C). Figure 7. DISCUSSION High oxygen demand is a vital aspect in the process of wound healing 2,4,5,1 Further, Giaccia et al. anticipated a model for ROS generation at complex III which amplifies under hypoxic condition.11 Majmundar et al. also found an inconsistency in mitochondrial ROS generation under hypoxia and it’s superoxide formation.7,28 In the context of antioxidant defense against ROS honey shows relevant potential having unique ingredients viz. phenolics, flavonoids, glucose oxidase, catalase and organic acids etc.30 The present finding on antioxidant properties of characteristic honey (Jamun), selected as per the criteria of Codex Alimentarius, 200127 (ST1 & ST2), is thus corroborative with the previous studies. To reveal the efficacy of honey dilution, we investigated the survival rate % and anti-oxidant (intracellular ROS primarily O-2) properties of HaCaT cells under normoxia and hypoxia (3% Oxygen) by MTT and NBT assays (Fig. 1). Based on the result obtained from both the experiments, we identified 3 honey dilutions (1, 0.1 and 0.01 v/v %) for further molecular level studies. The wound healing potential of honey is well known but underlying mechanism at molecular levels, especially under hypoxia is still not defined clearly. The selected honey dilutions were analyzed for cell cycle distribution during wound healing both in normoxia and hypoxia. In normoxic condition, 0.1% honey dilution showed highest percentage of cells (14.9) in G2/M phase along with hypoxic condition in which this dilution (0.1 % v/v) showed maximum population of cells in G2/M phase after control (Fig. 2). Therefore, from this observation it can be inferred that more number of cells in G2/M manifested more proliferation of cells in normoxia and up to some extent in hypoxia (Fig. 2).31 As lower amount of polyphenols were reported to provoke proliferation and migration in epidermal keratinocytes32 and this finding again supportive to justify the efficacy of honey in dilutions as recorded in this study. Further, H2O2 content of honey, produced by glucose oxidation catalyzed by glucose oxidase (originates from hypopharyngeal gland of honey bees and remains inactive in undiluted honey)33,34 though 12 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 13 of 32


illustrates disparity at different honey dilution points33 and it is known that low quantity of H2O2 possesses growth factor like properties which enhances DNA synthesis and proliferation related gene expressions viz. c-fos and c-myc in inactive cells35 along with antibacterial activity.36 Re-epithelialization is a crucial process toward repair progression after dermal wounding and achieved by migration and proliferation of keratinocytes.35 Although, in vitro model have some limitations toward translational validation however, monolayer scratch assay of keratinocytes is an elementary model to evaluate re-epithelialization and consequences of various soluble drug formulations.37 In this regard, present finding on higher (p ≤ 0.05) wound closure rate in 0.1 % honey dilution under hypoxia as compared to normoxia is remarkable. The migration of cells, in 0.1 % dilution under hypoxia depicted significantly higher (p < 0.01) migration as compared to normoxia whereas under 1% honey dilution there was insignificant change in cell migration (p> 0.1) as well as wound closure rate (p > 0.5). Thus through corroborating previous reports on H2O2 in honey dilutions and present findings on cytological impact of honey dilutions, we proposed in vitro wound healing efficacy of particular honey concentration. In respect to keratinocytes migration in wound healing, even in chronic wounds, expressional modulations in cardinal epithelial genes like p63 (a master regulator gene of epithelium)20, E-cadherin (principal component of junctionl adherence) and Hif 1 α (a gene linked to oxygen homeostasis) as well as F-actin (cytoskeletal protein) are important38,39 as demonstrated in the present work. Cellular migration is an essential attribute during re-epithelialization. The migratory cells show more expression of F-actin (lamellopodia) 24 and the migration of cell depends on the extra-cellular matrix which alters the arrangement and organization of actin-cytoskeleton.25In our study, honey dilutions in DMEM/F12 media used as extracellular matrix to evaluate in vitro HaCaT cells migration. Relevant cyto-skeletal protein (i.e. F-actin) arrangement in normoxia and hypoxia were also studied. In normoxic and untreated HaCaT cells, F-actin was mainly localized to the peripheral fiber bundles, which indicated switch of the cell body to the lamellar region (Fig. 5, a1-d1). In contrast, under hypoxia (3% O2) transition of peripheral fiber of F-actin to stress fibers (filamentous structure) which were localized on 13 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.


Page 14 of 32

cytoplasm (Fig. 5, a2-d2). The junctional stability provided by F-actin cytoskeleton was more in normoxic cells. However, the stress fiber formation in 0.1 % dilution was less compare to other dilutions in hypoxia (Fig. 5, c2). Hypoxia contributes alteration in anti-oxidant defense machinery, enzymatic activity, cytoskeletal organization and membrane structure.26 The junctional flexibilty to E-cadherin is associated by actin cytoskeleton which is present in cytoplasm and strengthen by catenins (cytoskeletal proteins). Here it is also relevant to mention that delocalization of E-cadherin from membranous to cytoplasmic is an important decisive factor for cell to migrate.24 Present immuno-cytochemical study for E-cadherin revealed more cytoplasmic expression as honey dilution increases (Fig. 4). This finding could be corroborated with the findings of I. R. Beavon23 as cytoplasmic expression of E-cadherin occured both in normoxia and hypoxia. In hypoxic 0.1 % and 0.01% dilutions change in cellular morphology in terms of cell shape also observed (Fig. 4C & 4D) and fold change for E-cadherin mRNA expression was elevated in 0.1% dilution both under normoxia and hypoxia (Fig. 4B). These cytoplasmic changes provided motivation to investigate changes in some nuclear protein also. Therefore, in our study we examined expression pattern of epithelial master regulator, p63 both at protein and gene levels (Fig. 6). The significant elevation in expression of nuclear protein p63 under 0.1% honey dilution both in normoxic (p= 0.002) and hypoxic (p= 0.004) conditions was observed. In addition, fold change of p63 mRNA expression was relatively very high in 0.1% as compared to control under normoxia and hypoxia (Fig. 6D). Fig. 6C illustrated expression of p63 in marginal migratory cells was more intense suggesting proliferative activity of migratory cells. Hypoxia stabilizes and accumulates Hif 1 α and increases transcription of its target genes.3 Our observation on hypoxia mediated expression of Hif 1 α at protein level was significantly less under 0.1 % dilution (p=0.003E-16) in comparison to control and other dilutions (1 & 0.01%) (Fig. 7A & B). Concerning fold change in mRNA expression of Hif 1 α, a down-regulation was observed under 0.1 % dilution in hypoxia (Fig. 7C). However, under normoxic condition Hif 1 α degraded3 and less expression of Hif 1 α observed both at protein (Fig.7A & B) and gene level (Fig. 7C). One possible reason 14 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 15 of 32


behind mitigating the consequences of hypoxia and it’s related gene Hif1α is newly formed free oxygen, which is generated by decomposition of H2O2 into water and oxygen. The degradation of H2O2 is catalyzed by pollen source derived enzyme catalase33 and this enzyme activity reported to increase with honey dilution.10 Further, this process also produces superoxide anion radical which is again reduced by methyl syringate present in honey, this in turn induces wound healing process by decreasing oxidative stress both extra-cellularly and intra-cellularly.40 Hence, all these findings support improved in vitro wound healing in hypoxic under 0.1 % honey dilution. CONCLUSION This paper presents noteworthy bio-impacts of jamun honey dilutions under hypoxia and normoxia from the perspective of antioxidant property and improving cellular viability, functionality and in vitro wound healing including modulation of expressions in prime epithelial genes like E-cadherin, F-actin, p63 and hypoxia marker Hif 1 α. In conclusion, 0.1% dilution depicted more potential for hypoxic wound healing considering cell migration, proliferation and reduced Hif 1 α expression. These findings may have revealed the importance of honey as an alternative and cost effective therapeutic natural product toward hypoxic wound healing.

ACKNOWLEDGEMENTS The authors would like to thank Indian Institute of Technology, Kharagpur, India for research facilities. Source of Funding: Science and Engineering Research Board (Sanction order No. SR/SO/HS/-006/2011) Department of Science & Technonolgy, New Delhi, Government of India and University Grant Commission, New Delhi, India (Ref: F. No. 19-6/2011(i) EU-IV, dated, 30.11.2011). Conflict of Interest: None. REFERENCES 15 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.


Page 16 of 32

REFERENCES 1. Guo S, DiPietro LA. Factors affecting wound healing. J Dent Res 2010; 89: 219229. 2. Peng J, Ramesh G, Sun L, Dong Z. Impaired Wound Healing in Hypoxic Renal Tubular Cells: Roles of Hypoxia-Inducible Factor-1 and Glycogen Synthase Kinase 3β/β-Catenin Signaling. J Pharmacol Exp Ther 2012; 3401: 176-184.

3. Rezvani HR, Ali N, Serrano-Sanchez M, Dubus P, Varon C, Ged C et al. Loss of epidermal hypoxia-inducible factor-1α accelerates epidermal aging and affects reepithelialization in human and mouse. J Cell Sci 2011; 124: 4172-4183.

4. Varghese MC, Balin AK, Carter DM, Caldwell D. Local environment of chronic wounds under synthetic dressings. Arch Dermatol 1986; 122: 52.

5. Dewhirst MW, Cao Y, Moeller B. Cycling hypoxia and free radicals regulate angiogenesis and radiotherapy response. Nat Rev Cancer 2008; 8: 425-437.

6. Poyton RO, Castello PR, Ball KA, Woo DK, Pan N. Mitochondria and hypoxic signaling. Ann NY Acad Sci 2009; 1177: 48-56.

7. Majmundar AJ, Wong WJ, Simon MC. Hypoxia-inducible factors and the response to hypoxic stress. Mol Cell 2010; 40: 294–309.

8. Menke NB, Ward KR, Witten TM, Bonchev DG, Diegelmann RF. Impaired wound healing. Clin Dermatol 2007; 25: 19-25.

9. Kim JS, Huang TY, Bokoch GM. Reactive oxygen species regulate a slingshotcofilin activation pathway. Mol Biol Cell 2009; 20:2650–2660.


Page 17 of 32


10. Barui A, Banerjee P, Chaudhary A, Conjeti S, Mondal B, Dey S, et al. Evaluation of angiogenesis in diabetic lower limb wound healing using a natural medicine: A quantitative approach. Wound Med 2014; 6: 26-33.

11. Molan PC. Evidence supporting the use of honey as a wound dressing. Int J Low Extrem Wounds 2006; 5: 40–54.

12. Roy S, Khanna S, Nallu K, Hunt TK, Sen CK. Dermal wound healing is subject to redox control, Mol Ther 2006;13: 211–20.

13. Henriques A, Jackson S, Cooper R, Burton N. Free radical production and quenching in honeys with wound healing potential. J Antimicrob Chemother 2006; 58: 773-777.

14. Beretta G, Orioli M, Facino RM. Antioxidant and radical scavenging activity of honey in 22. endothelial cell cultures (EA.hy926). Planta Med 2007; 73:11821189.

15. Mason BN, Califano JP, Reinhart-King CA. Matrix Stiffness: A Regulator of Cellular Behavior and Tissue Formation, S.K. Bhatia (ed.), Engineering biomaterials for regenerative medicine: novel technologies for clinical applications. Springer Science + Business Media. 2012; 19-37.

16. Straseski, JA, Gibson AL, Thomas‐Virnig CL, Allen‐Hoffmann BL. Oxygen deprivation inhibits basal keratinocyte proliferation in a model of human skin and induces regio‐specific changes in the distribution of epidermal adherens junction proteins, aquaporin‐3, and glycogen. Wound Repair Regen 2009; 17: 606-616.

17. Tandara AA, Mustoe TA. Oxygen in wound healing—more than a nutrient. World J Surg 2004; 28: 294-300.



Page 18 of 32

18. Forsythe JA, Jiang BH, Iyer NV, Agani F, Leung SW, Koos RD et al. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Bio 1996; 16: 4604-4613.

19. Huang LE, Gu J, Schau M, Bunn HF. Regulation of hypoxia-inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitinproteasome pathway. Proc Natl Acad Sci 1998; 95: 7987–92.

20. Pellegrini G, Dellambra E, Golisano O, Martinelli E, Fantozzi I, Bondanza S et al. p63 identifies keratinocyte stem cells. Proc Natl Acad Sci 2001; 98: 3156–3161.

21. Welch MP, Odland GF, Clark RA. Temporal relationships of F-actin bundle formation, collagen and fibronectin matrix assembly, and fibronectin receptor expression to wound contraction. J Cell Biol 1990; 110:133-145.

22. Park JE, Tan HS, Datta A, Lai RC, Zhang H, Meng W et al. Hypoxic tumor cell modulates its microenvironment to enhance angiogenic and metastatic potential by secretion of proteins and exosomes. Mol Cell Proteom 2010; 9: 1085-1099.

23. Beavon IR. Regulation of E-cadherin: does hypoxia initiate the metastatic cascade? Mol Pathol 1999; 52: 179-188.

24. Bryant DM, Stow JL. The ins and outs of E-cadherin trafficking, Trends Cell Biol 2004; 14: 427-434.

25. Kirfel G, Herzog V. Migration of epidermal keratinocytes: mechanisms, regulation, and biological significance. Protoplasma. 2004; 223: 67-78.

26. Solodushko V, Parker JC, Fouty B. Pulmonary microvascular endothelial cells form a tighter monolayer when grown in chronic hypoxia. Am J Respir Cell Mol Biol 2008; 38: 491. 18 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 19 of 32


27. Codex Alimentarius, 2001. Commission Standards, Codex Standards for Honey. FAO– Rome,1-7.

28. Boveris A. Mitochondrial production of superoxide radical and hydrogen peroxide. Adv Exp Med Biol 1977; 78: 67-82.

29. Majtan J. Honey: an immunomodulator in wound healing. Wound Repair Regen 2014; 22: 187-192.

30. Habib HM, Al Meqbali FT, Kamal H, Souka UD, Ibrahim WH. Bioactive components, antioxidant and DNA damage inhibitory activities of honeys from arid regions. Food Chem 2014; 153: 28-34.

31. Ruissen FV, Erp PEJv, de Jongh GJ, Boezeman JBM, van de Kerkhof PCM, Schalkwijk J. Cell kinetic characterization of growth arrest in cultured human keratinocytes. J Cell Sci 1994; 2219- 2228.

32. Hsu S, Bollag WB, Lewis J, Huang Q, Singh B, Sharawy, M, et al. Green tea polyphenols induce differentiation and proliferation in epidermal keratinocytes. J Pharm Exp Ther 2003; 306: 29-34.

33. White JW, Subers MH. Studies on Honey Inhibine. 2. A Chemical Assay. J Apic Res 1963: 2; 93-100.

34. Mahmoud AA, Owayss AA. A modified method to determine hydrogen peroxide activity as a quality criterion of bee honey. Annals of Agric Sci 2006; 44: 16291639.



Page 20 of 32

35. Loo AEK, Halliwell B. Effects of hydrogen peroxide in a keratinocyte-fibroblast co-culture model of wound healing. Biochem Biophys Res Comm 2012; 423: 253-258.

36. Molan, P. C. The antibacterial activity of honey: 1. The nature of the antibacterial activity. 2006

37. Anadón A, Martínez MA, Castellano V, Martínez-Larrañaga, MR. The role of in vitro methods as alternatives to animals in toxicity testing. Expert Opin Drug Met Toxicol 2014; 10: 67-79.

38. Peng KW, Liou YM, Differential role of actin-binding proteins in controlling the adipogenic

differentiation

of

human

CD105-positive

Wharton's

Jelly

cells. Biochim Biophys Acta Gen Sub 2012; 1820: 469-481.

39. Liu, YJ, Le Berre, M Lautenschlaeger, F Maiuri, P Callan-Jones, A. Heuzé, M et al. Confinement and low adhesion induce fast amoeboid migration of slow mesenchymal cells. Cell 2015; 160: 659-672.

40. Jubri Z, Rahim NBA, Aan GJ. Manuka honey protects middle-aged rats from oxidative damage. Clinics. 2013; 68: 1446-1454.

Figure/Table Legends: Figure Legends: Figure 1. (A) Change in antioxidant property of cells under honey dilutions: NBT Assay; (B) Cell survival rate % (MTT) under honey dilutions in DMEMF/12 media Figure 2. Histogram of HaCaT cells treated with honey dilutions in DMEM/F12 media in normoxia and hypoxia (3% O2) by flow cytometery 20 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.

Page 21 of 32


Figure 3. Cell migration assay under honey dilutions in DMEMF/12 media (v/v %); (A). Representative phase contrast (10x) image of three independent wound healing experiments is shown. Control at T= 0 hr. (a0); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B). Graph represents the % wound closure [(pre wound area-post wound area)/pre wound area x 100] of HaCaT population within 18 hrs. normoxia and hypoxia(3% O2). For each sample 3 field were counted. (**p ≤ 0.05 and *p > 0.5 ); (C). Graph represents the cell migration of HaCaT population within 18 hrs. normoxia and hypoxia (3% O2) (**p> 0.1 and *p < 0.01 ) Figure 4. (A). Microphotographs for immuno-fluoresence expression of E-cadherin (20x) ) in HaCaT cell population; Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B) mRNA expression (in terms of fold change) for E-cadherin during HaCaT wound healing under honey dilutions [0.1 and 0.01(v/v %)] in DMEM/F12 media and control; both in 18 hrs. normoxia and hypoxia; (C) & (D) Enlarge view of E-cadherin expression in 0.1 and 0.01 dilution respectively. Figure 5. Microphotographs for immuno-fluoresence expression of F-actin (20x) in HaCaT cell population; Control and honey dilutions viz. 1, 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs. (a2-d2). Figure 6. (A). Microphotographs for chromogenic expression of p63 (20x) in HaCaT cell population; Control and honey dilutions viz. 1, 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B). Notch-box plots depicting expressions of p63; (C). Enlarge view of wound margin (40x). (D). mRNA expression (in terms of fold change) for p63 during HaCaT wound healing under honey dilutions [0.1 and 0.01(v/v %)] in DMEM/F12 media and control; both in 18 hrs. normoxia and hypoxia. Figure 7. (A). Microphotographs for immuno-fluoresence expression of Hif 1 α (20x) in HaCaT cell population; Control and honey dilutions viz. 1, 0.1 and 0.01 (v/v %) in 21 Wound Repair and Regeneration This article is protected by copyright. All rights reserved.


Page 22 of 32

normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B). Notch-box plots depicting expressions of Hif 1 α; (C). mRNA expression (in terms of fold change) for Hif 1 α during HaCaT wound healing under honey dilutions [1, 0.1 and 0.01(v/v %)] in DMEM/F12 media and control; both in 18 hrs. normoxia and hypoxia.

Supportive Table Legends: ST 1: Physical properties of selected honey ST 2: Bio-chemical properties of selected honey ST 3: Primer sequences and cycling conditions for Real Time PCR


Page 23 of 32


Figure 1. (A) Change in antioxidant property of cells under honey dilutions: NBT Assay; (B) Cell survival rate % (MTT) under honey dilutions in DMEMF/12 media 42x13mm (300 x 300 DPI)

Wound Repair and Regeneration This article is protected by copyright. All rights reserved.


Figure 2. Histogram of HaCaT cells treated with honey dilutions in DMEM/F12 media in normoxia and hypoxia (3% O2) by flow cytometery 57x26mm (300 x 300 DPI)


Page 24 of 32

Page 25 of 32


Figure 3. Cell migration assay under honey dilutions in DMEMF/12 media (v/v %); (A). Representative phase contrast (10x) image of three independent wound healing experiments is shown. Control at T= 0 hr. (a0); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B). Graph represents the % wound closure [(pre wound area-post wound area)/pre wound area x 100] of HaCaT population within 18 hrs. normoxia and hypoxia(3% O2). For each sample 3 field were counted. (**p ≤ 0.05 and *p > 0.5 ); (C). Graph represents the cell migration of HaCaT population within 18 hrs. normoxia and hypoxia (3% O2) (**p> 0.1 and *p < 0.01 ) 82x53mm (300 x 300 DPI)



Figure 4. (A). Microphotographs for immuno-fluoresence expression of E-cadherin (20x) ) in HaCaT cell population; Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B) mRNA expression (in terms of fold change) for E-cadherin during HaCaT wound healing under honey dilutions [0.1 and 0.01(v/v %)] in DMEM/F12 media and control; both in 18 hrs. normoxia and hypoxia; (C) & (D) Enlarge view of E-cadherin expression in 0.1 and 0.01 dilution respectively. 81x51mm (300 x 300 DPI)


Page 26 of 32

Page 27 of 32


Figure 5. Microphotographs for immuno-fluoresence expression of F-actin (20x) in HaCaT cell population; Control and honey dilutions viz. 1, 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs. (a2-d2). 49x19mm (300 x 300 DPI)



Figure 6. (A). Microphotographs for chromogenic expression of p63 (20x) in HaCaT cell population; Control and honey dilutions viz. 1, 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B). Notch-box plots depicting expressions of p63; (C). Enlarge view of wound margin (40x). (D). mRNA expression (in terms of fold change) for p63 during HaCaT wound healing under honey dilutions [0.1 and 0.01(v/v %)] in DMEM/F12 media and control; both in 18 hrs. normoxia and hypoxia. 120x114mm (300 x 300 DPI)


Page 28 of 32

Page 29 of 32


Figure 7. (A). Microphotographs for immuno-fluoresence expression of Hif 1 α (20x) in HaCaT cell population; Control and honey dilutions viz. 1, 0.1 and 0.01 (v/v %) in normoxia at T=18 hrs. (a1-d1); Control and honey dilutions viz. 1 , 0.1 and 0.01 (v/v %) in hypoxia (3%) T=18 hrs.(a2-d2); (B). Notch-box plots depicting expressions of Hif 1 α; (C). mRNA expression (in terms of fold change) for Hif 1 α during HaCaT wound healing under honey dilutions [1, 0.1 and 0.01(v/v %)] in DMEM/F12 media and control; both in 18 hrs. normoxia and hypoxia. 93x68mm (300 x 300 DPI)



Page 30 of 32

Supplementary Tables ST 1: Physical properties of selected honey pH ± SD at 25 0C

Conductivity µs/cm ± 0 SD at 25 C

Water content % (w/w) ± SD

Total solid content % (w/w) ± SD

Color on Pfund Scale

3.8

3.91±0.08

14.50±0.98

85.5±0.98

Amber

Mm Pfund= -38.70+371.39×absorbance


Page 31 of 32


ST 2: Bio-chemical properties of selected honey Total sugar content % (w/w)

93±0.3

Amount of protein % (w/w) ± SD

Phenol content (mg GAE/100g)

Flavonoid content (mg QE/100 g) ± SD

DPPH Free Radical Scavenging Activity (RSA) (% ± SD) in 20mg/ml. honey dilution

Catalase Activity (Absorbance at 620 nm.) (Mean ± SD)

2.6±1.33

444.8±1.4

674.8±3.5

93.6±2.7

0.02±0.01



ST 3: Primer sequences and cycling conditions for Real Time PCR Genes

Expression Primers

Product size

FP= Forward Primer

bp (base pairs)

RP=Reverse Primer E-cadherin

FP: CGGGAATGCAGTTGAGGATC

201

RP: AGGATGGTGTAAGCGATGGC p63

FP: AGTTTCGACGTGTCCTTCCAG

125

RP: GTCATCACCTTGATCTGGATG Hif 1 α

FP: GAACCAAATCCAGAGTCACTGG

114

RP: GGGACTATTAGGCTCAGGTG 18S rRNA

FP: GTAACCCGTTGAACCCCATT

151

RP: CCATCCAATCGGTAGTAGCG Cycling conditions: 95 °C for 5 min (1 cycle), 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s (40 cycles)


Page 32 of 32

Acacia honey accelerates in vitro corneal ulcer wound healing model.

Honey: an immunomodulator in wound healing.

Honey-based hydrogel: In vitro and comparative In vivo evaluation for burn wound healing.

Phagocyte-myocyte interactions and consequences during hypoxic wound healing.

Assessing the impact of engineered nanoparticles on wound healing using a novel in vitro bioassay.

The impact of virulence factors of Porphyromonas gingivalis on wound healing in vitro.

Impact of trastuzumab on wound healing in experimental glaucoma surgery.

Modulating prime molecular expressions and in vitro wound healing rate in keratinocyte (HaCaT) population under characteristic honey dilutions.

The Impact of Lipoproteins on Wound Healing: Topical HDL Therapy Corrects Delayed Wound Healing in Apolipoprotein E Deficient Mice.

Regulation of lipolysis in normoxic and hypoxic rat myocytes.

Honey and healing.

Honey and healing.

Effects of normoxic and hypoxic exercise regimens on monocyte-mediated thrombin generation in sedentary men.

Wound healing in tadpole tailfin pieces in vitro.

Dressings and healing with honey.

Evaluation of the effects of a combination of Japanese honey and hydrocolloid dressing on cutaneous wound healing in male mice.

Live time-lapse dataset of in vitro wound healing experiments.

Evaluation of the Effects of Local Application of Thyme Honey in Open Cutaneous Wound Healing.

Impact of Platelet-Rich Plasma on Viability and Proliferation in Wound Healing Processes after External Radiation.

Effect of Tualang honey on the anastomotic wound healing in large bowel anastomosis in rats-A randomized controlled trial.

Correction: Conditioned Medium from Hypoxic Bone Marrow-Derived Mesenchymal Stem Cells Enhances Wound Healing in Mice.

Conditioned medium from hypoxic bone marrow-derived mesenchymal stem cells enhances wound healing in mice.

The effect of honey gel on abdominal wound healing in cesarean section: a triple blind randomized clinical trial.

Stress and wound healing.