LETTER

doi:10.1038/nature13380

Histone H4 tail mediates allosteric regulation of nucleosome remodelling by linker DNA William L. Hwang1,2,3*, Sebastian Deindl1,4*, Bryan T. Harada1,2 & Xiaowei Zhuang1,4,5

Imitation switch (ISWI)-family remodelling enzymes regulate access to genomic DNA by mobilizing nucleosomes1. These ATP-dependent chromatin remodellers promote heterochromatin formation and transcriptional silencing1 by generating regularly spaced nucleosome arrays2–5. The nucleosome-spacing activity arises from the dependence of nucleosome translocation on the length of extranucleosomal linker DNA6–10, but the underlying mechanism remains unclear. Here we study nucleosome remodelling by human ATP-dependent chromatin assembly and remodelling factor (ACF), an ISWI enzyme comprising a catalytic subunit, Snf2h, and an accessory subunit, Acf1 (refs 2, 11–13). We find that ACF senses linker DNA length through an interplay between its accessory and catalytic subunits mediated by the histone H4 tail of the nucleosome. Mutation of AutoN, an auto-inhibitory domain within Snf2h that bears sequence homology to the H4 tail14, abolishes the linker-length sensitivity in remodelling. Addition of exogenous H4-tail peptide or deletion of the nucleosomal H4 tail also diminishes the linker-length sensitivity. Moreover, Acf1 binds both the H4-tail peptide and DNA in an amino (N)-terminal domain dependent manner, and in the ACF-bound nucleosome, lengthening the linker DNA reduces the Acf1-H4 tail proximity. Deletion of the N-terminal portion of Acf1 (or its homologue in yeast) abolishes linker-length sensitivity in remodelling and leads to severe growth defects in vivo. Taken together, our results suggest a mechanism for nucleosome spacing where linker DNA sensing by Acf1 is allosterically transmitted to Snf2h through the H4 tail of the nucleosome. For nucleosomes with short linker DNA, Acf1 preferentially binds to the H4 tail, allowing AutoN to inhibit the ATPase activity of Snf2h. As the linker DNA lengthens, Acf1 shifts its binding preference to the linker DNA, freeing the H4 tail to compete AutoN off the ATPase and thereby activating ACF. The packaging of DNA into nucleosomes presents a substantial energy barrier that restricts access to the genomic DNA15. ISWI-family remodellers use the energy from ATP hydrolysis to disrupt histone–DNA contacts and reposition nucleosomes1. The catalytic subunits of ISWI enzymes possess an SF2-like ATPase that translocates DNA across the nucleosome1. The nucleosome translocation activity is further regulated by the accessory subunits of ISWI complexes6,10,16. Many ISWI remodellers exhibit a nucleosome-spacing activity2–5. Critical to this spacing activity are two features of the nucleosome that modulate the activity of ISWI remodellers: (1) the N-terminal tail of histone H4 (refs 8, 17–20) and (2) the length of the extranucleosomal linker DNA6–10. The unmodified H4 tail stimulates ISWI activity by relieving the autoinhibitory effect of the AutoN domain within the catalytic subunit14. H4 tail acetylation associated with transcriptionally active chromatin is thought to help prevent ISWI-induced nucleosome spacing at actively transcribed genes17–19. Regulation by the extranucleosomal linker DNA is responsible for generating the regularly spaced nucleosome arrays important for heterochromatin formation. Shortening the linker DNA reduces the remodelling activity of nucleosome-spacing ISWI enzymes6–10. As a result,

nucleosomes are preferentially moved towards longer linkers to promote uniform spacing on nucleosome arrays. Interestingly, the catalytic activity of many ISWI-family enzymes is sensitive to linker DNA lengths up to approximately 60–70 base pairs (bp)6–10, consistent with the inter-nucleosome spacing of heterochromatin observed in human cells21. This linker-length sensing range substantially exceeds the binding footprint (20–30 bp) of the catalytic subunit22,23, whereas the accessory subunits of ISWI complexes can bind linker DNA as far as ,60 bp from the nucleosome edge22. However, it is unknown how accessory subunits communicate linker length information to the catalytic subunit to regulate remodelling activity. In this work, we investigate the mechanism underlying DNA linker-length sensing by a prototypical ISWI-family enzyme, human ACF. To examine how linker DNA regulates nucleosome translocation by ACF, we reconstituted mononucleosomes with varying linker lengths (n 5 20–78 bp) on the entry side but a constant exit-side linker length of 3 bp (Fig. 1a). We also constructed mononucleosomes with wild-type (WT) histone H4 and two H4 mutants: (1) H4 tail deletion (H4D1–19) and (2) H4 with K16A mutation (H4K16A). We refer to nucleosome constructs with the following nomenclature: [WT H4/H4D1–19/H4K16A, n bp] for nucleosomes with n bp of DNA on the entry side and an octamer containing WT H4, H4D1–19 or H4K16A. We detected ACF-catalysed nucleosome translocation using fluorescence resonance energy transfer (FRET) by labelling the end of the exit-side linker DNA with the FRET acceptor Cy5, and the histone H2A with the FRET donor Cy3 (Fig. 1a)24. We first compared the remodelling kinetics of [WT H4, 78 bp], [WT H4, 40 bp], [WT H4, 20 bp] and [H4D1–19, 78 bp] nucleosomes using an ensemble FRET assay6. Upon addition of ACF and ATP, the FRET efficiency decreased as DNA was translocated towards the exit side (Fig. 1b and Extended Data Fig. 1a). As expected, the remodelling rate decreased as the linker DNA was shortened and deletion of the H4 tail drastically reduced the remodelling activity (Fig. 1b). To identify which step(s) of the remodelling process are regulated, we monitored the remodelling of individual nucleosomes using singlemolecule FRET24,25. Single-nucleosome remodelling traces featured incremental translocation of DNA to the exit side interrupted by kinetic pauses (Fig. 1c). The first pause occurred after ,7 bp of DNA translocation and the second pause occurred after an additional ,3 bp of translocation (Extended Data Fig. 2a, b), consistent with previous findings24,26. Moreover, the step sizes did not change with linker DNA length or histone H4 modification (Extended Data Fig. 2a, b). We divided the remodelling time trace into two translocation phases (T1, T2), during which the FRET efficiency decreased, and two pause phases (P1, P2), during which the FRET value remained constant (Fig. 1c). Notably, the DNA translocation rates between pauses did not change, whereas the pausephase exit rates decreased dramatically when the linker DNA was shortened (Fig. 1d and Extended Data Fig. 2c). Moreover, the dependence of remodelling kinetics on entry-side linker lengths of mononucleosomes was quantitatively similar to the dependence on inter-nucleosome linker

1

Howard Hughes Medical Institute, Harvard University, Cambridge, Massachusetts 02138, USA. 2Graduate Program in Biophysics, Harvard University, Cambridge, Massachusetts 02138, USA. 3Harvard/ MIT MD-PhD Program, Harvard Medical School, Boston, Massachusetts 02115, USA. 4Department of Chemistry and Chemical Biology, Harvard University, Cambridge, Massachusetts 02138, USA. 5 Department of Physics, Harvard University, Cambridge, Massachusetts 02138, USA. *These authors contributed equally to this work. 0 0 M O N T H 2 0 1 4 | VO L 0 0 0 | N AT U R E | 1

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER

+ACF Cy3

+ATP

Entry side High FRET

Biotin Low FRET

Normalized Cy5 intensity

Cy5

Exit side

WT ACF

[WT H4, 78 bp] [WT H4, 40 bp] [WT H4, 20 bp] [H4Δ1–19, 78 bp]

1.2 0.8 0.4

Donor (Cy3) Acceptor (Cy5) 12 8 4 0 1.0

T2 P2

0.5 T1

P1

0.0

0.0 0

10 20 Time (min)

0

30

10

20 30 Time (s)

40

20

10

0

40 50 60 70 80 Linker DNA length (bp)

1.0 0.8

30 P1 phase P2 phase

0.6 0.4 0.2 0.0

40 50 60 70 80 Linker DNA length (bp)

Translocation rate (bp s–1)

T1 phase T2 phase

Pause-phase exit rate (s–1)

30

T1 phase T2 phase

20

10

0

WT H4 H4K16A H4Δ1–19 Histone H4 variant

Pause-phase exit rate (s–1)

e

d Translocation rate (bp s–1)

c Cy3 or Cy5 intensity (a.u.)

b

FRET

a

1.0

P1 phase P2 phase

0.8 0.6 0.4 0.2 0.0

WT H4 H4K16A H4Δ1–19 Histone H4 variant

Figure 1 | The linker DNA length and histone H4 tail regulate the remodelling pause phases but not the translocation phases. a, Schematic of a FRET-labelled mononucleosome undergoing remodelling by ACF. b, Ensemble remodelling time courses of [WT H4, 78 bp], [WT H4, 40 bp], [WT H4, 20 bp] and [H4D1–19, 78 bp] nucleosomes by 40 nM ACF at 5 mM ATP. Nucleosome translocation is monitored by the emission intensity of the FRET acceptor Cy5 under excitation of the FRET donor Cy3. c, Cy3 and Cy5 fluorescence (top; a.u., arbitrary units) and FRET (bottom) time traces during the remodelling of a single [WT H4, 78 bp] nucleosome with the

translocation (T1, T2) and pause (P1, P2) phases indicated. d, Linker DNA length dependence of the translocation rates between pauses (left, defined as the average number of base pairs moved per second) and pause-phase exit rates (right, defined as the inverse of the average pause durations). e, Dependence of the translocation rates between pauses (left) and pause-phase exit rates (right) on the H4 variants. In d and e, [ACF] 5 10 nM and [ATP] 5 2 mM. Data are mean 6 s.e.m. derived from at least 100 (d) or at least 50 (e) individual nucleosome remodelling traces from three independent experiments.

lengths of dinucleosomes (Extended Data Fig. 3), validating the use of mononucleosomes as a model system to study linker-length sensitivity. Interestingly, the H4 tail appeared to regulate the same phase of the remodelling process as the linker DNA (Fig. 1e). The H4K16A mutation and H4 tail deletion (H4D1–19) decreased the pause-phase exit rate by approximately 2- and 20-fold, respectively (Fig. 1e). In contrast, neither modification had any appreciable effect on the translocation rates between pauses (Fig. 1e). The above results indicate that both linker DNA and the H4 tail regulate the remodelling rate by changing the duration of pause phases, suggesting that these nucleosome features may impinge on an inhibitory mechanism that prevents the initiation of the DNA translocation phases. It has been shown that although the ISWI ATPase domain can translocate nucleosomes autonomously27, the catalytic subunit contains two well-conserved autoregulatory domains, AutoN and NegC, which inhibit ATP hydrolysis and its coupling to DNA translocation, respectively14. The AutoN inhibition can be relieved by the H4 tail whereas the NegC inhibition can be relieved by binding of the HAND-SANT-SLIDE module to linker DNA14. Could the regulation of remodelling by linker DNA length occur through these inhibitory domains? To address this question, we first examined the role of the NegC domain. Surprisingly, deletion of the NegC domain in the ACF complex (DNegC ACF) did not substantially affect the dependence of remodelling kinetics on linker DNA lengths ranging from 20 to 78 bp (Fig. 2a–c and Extended Data Fig. 4a). Removing the H4 tail dramatically reduced the remodelling rates of both WT and DNegC ACF (Fig. 2b). These results suggest that the NegC domain does not play a substantial role in linker length sensing by the ACF complex. In contrast, the isolated Snf2h catalytic subunit exhibited a short-range (20–40 bp) linker length sensitivity that depended on NegC (Extended Data Fig. 5), in a manner similar to the Drosophila ISWI, which lacks any accessory subunit14. Next, we mutated the AutoN domain with two point substitutions (R142A and R144A) in the ACF complex (AutoN-2RA ACF; Fig. 3a and Extended Data Fig. 4a). AutoN bears sequence homology to the H4 tail, which can compete the inhibitory AutoN domain off the ATPase, and the 2RA mutation in AutoN is expected to diminish the H4 tail dependence of remodelling by ISWI enzymes14. Remarkably, this mutation not only

increased the remodelling rate of nucleosomes lacking the H4 tail, but also completely abolished the linker-length dependence of remodelling by specifically increasing the remodelling rate of short-linker nucleosomes (Fig. 3b, c and Extended Data Fig. 6). These results suggest an essential role for AutoN in linker length sensing by the ACF complex. Since AutoN competes with the H4 tail for binding to the ATPase14, we considered the possibility that this competition is involved in sensing linker DNA length and hypothesized that the H4 tail is only available to compete AutoN off the ATPase when the linker DNA is sufficiently a

AutoN

ATPase

NegC

HAND-SANT-SLIDE

WT Snf2h ΔNegC Snf2h WT ACF

c

[WT H4, 78 bp] [WT H4, 40 bp] [WT H4, 20 bp] [H4Δ1–19, 78 bp]

1.2 Normalized Cy5 intensity

ΔNegC ACF

Pause-phase exit rate (s–1)

b

0.8

0.4

0.0 0

10 20 Time (min)

30

[WT H4, 78 bp] [WT H4, 40 bp]

0.4 0.3 0.2 0.1 0.0

ΔNegC

WT ACF

Figure 2 | Deletion of the NegC domain of the Snf2h catalytic subunit does not substantially affect linker DNA length sensing by the ACF complex. a, Domain architecture of WT and DNegC Snf2h (residues 669–700 replaced with a SGSGS linker). b, Ensemble remodelling time courses of [WT H4, 78 bp], [WT H4, 40 bp], [WT H4, 20 bp] and [H4D1–19, 78 bp] nucleosomes by 40 nM WT ACF (black/grey lines, duplicated from Fig. 1b) and DNegC ACF (red/pink symbols) at 5 mM ATP. c, Linker DNA length dependence of the pause-phase exit rate (P1 phase) measured for WT ACF (black) and DNegC ACF (red). [ACF] 5 10 nM and [ATP] 5 20 mM. Data are mean 6 s.e.m. derived from at least 100 individual nucleosome remodelling traces from three independent experiments.

2 | N AT U R E | VO L 0 0 0 | 0 0 M O N T H 2 0 1 4

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH a

AutoN

ATPase

NegC HAND-SANT-SLIDE

WT Snf2h AutoN-2RA Snf2h WT ACF

c

AutoN-2RA ACF

Pause-phase exit rate (s–1)

[WT H4, 78 bp] [WT H4, 40 bp] [H4Δ1–19, 78 bp]

1.2

Normalized Cy5 intensity

2RA

0.8

0.4

0.0 0

10 20 Time (min)

30

Pause-phase exit rate

(s–1)

0.4

0.2

*

0.0

WT

0.3 0.2 0.1

0 20 [H4-tail peptide] (nM)

AutoN-2RA

ACF WT ACF

[WT H4, 78 bp] [WT H4, 40 bp]

0.0

*

e

WT ACF

d

[WT H4, 78 bp] [WT H4, 40 bp] [H4Δ1–19, 78 bp]

0.4

Pause-phase exit rate (s–1)

b

H4Δ1–19 0.04

0.02

0.00

40 78 Linker DNA length (bp)

Figure 3 | The AutoN domain of Snf2h and the nucleosomal H4 tail are important for linker DNA length sensing by the ACF complex. a, Domain architecture of WT and AutoN-2RA (R142A and R144A) Snf2h. b, Ensemble remodelling time courses of [WT H4, 78 bp], [WT H4, 40 bp] and [H4D1–19, 78 bp] nucleosomes by 40 nM WT ACF (black/grey lines, duplicated from Fig. 1b) and AutoN-2RA ACF (blue/cyan symbols) at 5 mM ATP. c, Dependence of the pause-phase exit rate on the linker DNA length and H4 tail for WT (black) or AutoN-2RA ACF (blue/cyan). *Too slow to be measured. d, Effect of the exogenously added H4-tail peptide on the pause-phase exit rates during remodelling by WT ACF. e, Pause-phase exit rates of nucleosomes lacking the H4 tail during remodelling by WT ACF. In c–f, [ACF] 5 10 nM and [ATP] 5 20 mM, except that 2 mM of ATP was used in e to make the pause exit rates measurable for nucleosomes lacking the H4 tail. Data are mean 6 s.e.m. from at least 100 (c, d) or at least 50 (e) individual nucleosome remodelling traces from three independent experiments.

long. Consistent with this hypothesis, adding exogenous H4-tail peptide, which should help compete AutoN off the ATPase when the nucleosomal H4 tail is unavailable, specifically increased the remodelling rate of short-linker nucleosome ([WT H4, 40 bp]) by WT ACF (Fig. 3d). Furthermore, deletion of the nucleosomal H4 tail, in addition to slowing down remodelling, abolished the dependence of remodelling rate on linker DNA length (Fig. 3e). These results indicate that the H4 tail is indeed involved in linker DNA sensing. Because the catalytic subunits of ISWI-family enzymes only interact with ,20–30 bp of extranucleosomal DNA, the linker-length sensitivity of ACF cannot be accounted for by the catalytic subunit alone. Our findings raise the intriguing possibility of a linker-length sensing mechanism where the accessory subunit Acf1 interacts with the H4 tail in a linker-length-dependent manner, which modulates the H4 tail availability for competing with AutoN. To test this possibility, we generated two Acf1 mutants, DC-term Acf1 and DN-term Acf1, in which 134 residues at the carboxy (C) terminus or 371 residues at the N terminus were deleted, respectively (Extended Data Fig. 7a and Fig. 4a). Because the central region of Acf1 required for Snf2h binding16,28 was not deleted, both mutants were able to form complexes with Snf2h, which are referred to as DC-term and DN-term ACF (Extended Data Fig. 4b). We first probed which region of Acf1 interacts with the H4 tail by comparing the binding affinities of WT, DC-term and DN-term Acf1 for the H4-tail peptide using a fluorescence anisotropy assay. Interestingly, WT Acf1 exhibited specific, nanomolar affinity for the H4-tail peptide (Fig. 4b and Extended Data Fig. 7b) that was not substantially altered

upon deletion of the C-terminal region (Extended Data Fig. 7c), but was completely lost upon deletion of the N-terminal portion (Fig. 4b). These results indicate that Acf1 interacts with the H4 tail probably through its N-terminal region. Acf1 also bound double-stranded DNA and deletion of the N-terminal region abolished this interaction too (Extended Data Fig. 8), consistent with the previous finding that the WAC motif within the N-terminal region is important for binding of ACF to the linker DNA28. Given the distinct properties of DNA and the H4 tail, their specific binding interfaces within Acf1 N-term are probably distinct. Next, we investigated nucleosome remodelling by the DC-term and DN-term ACF complexes. Notably, the DC-term mutation did not substantially alter the dependence of remodelling kinetics on linker DNA length (Extended Data Fig. 7d), whereas the linker-length sensitivity was eliminated in the DN-term ACF complex (Fig. 4c, d). This finding is consistent with the specific affinity of Acf1 N-term for the H4 tail (Fig. 4b). Furthermore, if the loss of linker-length sensitivity was simply a result of losing the linker DNA binding affinity of Acf1, DN-term ACF should demonstrate inefficient remodelling for all linker DNA lengths. Instead, DN-term ACF remodelled both short- and long-linker nucleosomes at rates close to the rate with which WT ACF remodelled long-linker nucleosomes (Fig. 4c, d), suggesting that deletion of Acf1 N-term disabled a mechanism that inhibits remodelling at short linker lengths. DN-term ACF also maintained the H4-tail requirement in remodelling (Fig. 4c). Since Acf1 has affinity to both DNA and the H4 tail, a plausible interpretation of the above observations is that the nucleosomal linker DNA and H4 tail are in competition for binding to the N-terminal region of Acf1 and that this competition is modulated by the length of the linker DNA. Only when the linker is sufficiently short does Acf1 preferentially bind to the H4 tail, making it unavailable to compete with the inhibitory AutoN. Deletion of Acf1 N-term diminishes the Acf1-H4 tail interaction such that the H4 tail is equally available to activate the ATPase at both short and long linker DNA lengths. We therefore probed the linker-length dependence of the Acf1-H4 tail proximity in ACF-bound nucleosomes featuring a cysteine-reactive crosslinker on the H4 tail. Specific H4-Acf1 crosslinking product was clearly observed as a band with reduced electrophoretic mobility compared with non-crosslinked Acf1 (Fig. 4e and Extended Data Fig. 9). Remarkably, the Acf1-H4 crosslinking efficiency decreased substantially with increasing linker DNA length (Fig. 4e), supporting our hypothesis that the Acf1-H4 tail interaction is modulated by the linker DNA length. In contrast, the H4-Snf2h crosslinking efficiency did not change substantially with linker DNA length, probably because Snf2h remains sufficiently close to the H4 tail regardless of the linker DNA length, which allows crosslinking even when the H4 tail was not specifically bound to its binding pocket on Snf2h. Finally, we tested the physiological importance of the N-terminal region of Acf1 by studying the role of its homologue in yeast29. Yeast ISW2 is functionally similar to ACF. It is composed of a catalytic subunit (Isw2) that is homologous to Snf2h and three accessory subunits (Itc1, Dpb4 and Dls1), among which Itc1 is homologous to Acf1. We generated three mutant yeast strains: (1) deletion of the entire itc1 gene (Ditc1), (2) deletion of only the portion of itc1 that encodes the N-terminal region of Itc1 equivalent to Acf1 N-term (Ditc1-Nterm) and (3) a rescue strain that was derived from the Ditc1-Nterm strain by deleting the remainder of itc1 (rescue-Ditc1). Both Ditc1 and rescue-Ditc1 showed growth rates similar to that of the WT strain (Fig. 4f), consistent with previous observations29. In contrast, the Ditc1-Nterm strain displayed dramatically slower growth (Fig. 4f), consistent with an aberrant chromatinmisregulation phenotype. Taken together, our results suggest a nucleosome-spacing mechanism for ACF in which the linker DNA length is sensed by the Acf1 accessory subunit and allosterically transmitted to the Snf2h catalytic subunit through the H4 tail of the nucleosome (Fig. 4g). Acf1 and the AutoN domain of Snf2h function collectively in DNA linker-length sensing. When the linker DNA is short, Acf1 preferentially binds to and sequesters the H4 tail, making it unavailable to compete its sequence homologue, AutoN, off the ATPase. Hence, the ATPase activity is inhibited by AutoN. As 0 0 M O N T H 2 0 1 4 | VO L 0 0 0 | N AT U R E | 3

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER a

WAC

DDT

PHD

BRD

WT Acf1

0.20 0.15 0.10 0

e kDa 250

WT ACF ΔN-term ACF [WT H4, 78 bp] [WT H4, 40 bp] 1.2 [H4Δ1–19, 78 bp]

c Normalized Cy5 intensity

Fluorescence anisotropy

0.25 K = 3 nM d

Acf1 ΔN-term Acf1

0.4 0.0

20 40 60 80 [Titrated protein] (nM)

ACF Ladder – nucleosomes

0.8

0

10 20 Time (min)

30

40 bp linker

78 bp linker

Acf1-H4 Acf1

150

Snf2h-H4 Snf2h

100

g

f WT

Translocation phase (i)

0.4 0.2 0.0

0.20

Acf1-H4 Snf2h-H4

0.15 0.10 0.05 0.00

0

20 40 60 80 Linker DNA length (bp)

Pause phase (i )

Off Acf1 Snf2h

Translocation phase (i + 1)

On Acf1 Snf2h On Acf1 Snf2h

On Acf1 Snf2h

Rescue- itc1

ΔN-term

WT

Long linker

itc1 itc1-Nterm

[WT H4, 78 bp] [WT H4, 40 bp] 0.6

ACF

ACF + nucleosomes 20 bp linker

d

Crosslinked fraction

b

Pause-phase exit rate (s–1)

ΔN-term Acf1

Off Acf1 Snf2h

H4 tail AutoN

On Acf1 Snf2h

Short linker

Figure 4 | The N-terminal region of the Acf1 accessory subunit is important for linker DNA length sensing by the ACF complex. a, Domain architecture of WT and DN-term (residues 1–371 deleted) Acf1. b, Fluorescence anisotropy of dye-labelled H4-tail peptide in the presence of varying amounts of WT (black symbols) or DN-term (green symbols) Acf1. Data are mean 6 s.e.m. (n 5 3 independent experiments). The dissociation constant (Kd) for WT Acf1 is 3 6 9 nM (error bars, 95% confidence intervals). c, Ensemble remodelling time courses of [WT H4, 78 bp], [WT H4, 40 bp] and [H4D1–19, 78 bp] nucleosomes by 40 nM WT ACF (black/grey lines, duplicated from Fig. 1b) and DN-term ACF (green/light green symbols) at 5 mM ATP. d, Dependence of the pause-phase exit rate on the linker DNA length for WT ACF (black) or DN-term ACF (green). [ACF] 5 10 nM and [ATP] 5 20 mM. Data are mean 6 s.e.m. derived from at least 100 individual nucleosome remodelling traces from three independent experiments. e, Crosslinking of the H4 tail to

Acf1 depends on the linker DNA length. The crosslinking products were analysed by SDS–PAGE (left). The Acf1-H4 crosslinking band was absent for ACF without nucleosomes (lane ‘ACF2nucleosomes’). Right: quantification of the H4-crosslinked fractions of Acf1 and Snf2h as a function of linker DNA length. Data are mean 6 s.e.m. (n 5 3 independent crosslinking experiments). f, Effects of deletion of Itc1 (Acf1 homologue) and its N-terminal region on the growth of yeast cells. Top row: WT. Second row: the itc1 gene is deleted (Ditc1). Third row: the coding sequence of the N-terminal region of Itc1 is deleted (Ditc1-Nterm). Bottom row: the remaining portion of itc1 is deleted from Ditc1-Nterm (rescue-Ditc1). One representative of three independent growth experiments is shown. g, Model for linker DNA length sensing by the ACF complex. DNA: grey lines; histone octamer: beige cylinders; Snf2h: blue/cyan; Acf1: green. The ATPase domain of Snf2h is depicted as a cyan sphere and labelled ‘On’ when active and ‘Off’ when inactive.

the linker DNA length increases, Acf1 shifts its binding preference to the linker DNA and releases the H4 tail, allowing it to compete AutoN off the ATPase and activate ACF. This competition between the H4 tail and linker DNA for Acf1 binding probably involves the N-terminal region of Acf1. It is interesting to note that linker DNA sensing occurs during the pause phases when the ATPase domain is not actively translocating DNA, suggesting that AutoN engages the ATPase domain during the pauses. To exit the pauses, the H4 tail is required to relieve the inhibitory effect of AutoN. The re-engagement of AutoN with the ATPase domain after each translocation phase would give ACF an opportunity to periodically sense the linker DNA length. Such frequent sensing may allow a more efficient nucleosome spacing, as previously hypothesized30. The linker DNA and the H4 tail are two important substrate features that regulate nucleosome remodelling by ISWI-family enzymes, the former enabling uniform nucleosome spacing for heterochromatin formation and the latter specifying regions of chromatin for silencing. Our results now reveal an unexpected convergence of the regulatory pathways defined by these two distinct nucleosome features.

moiety for surface anchoring. DNA was generated by PCR or by annealing and ligating a set of overlapping, complementary oligonucleotides (Extended Data Fig. 10). Histone octamer, nucleosomes, Acf1, Snf2h and ACF complexes were reconstituted and purified as described previously6,7,24. Mutant yeast strains were generated in the BY4741 background. Single-molecule FRET measurements were performed with a custom-built microscope setup. Ensemble FRET used a Cary Eclipse fluorescence spectrophotometer. Fluorescence anisotropy measurements used a SpectraMax microplate reader. Crosslinking experiments used nucleosomes with a cysteine-reactive crosslinker BM(PEG)3 at the H4 tail N terminus and reaction products were analysed by SDS–polyacrylamide gel electrophoresis (SDS–PAGE).

METHODS SUMMARY Detailed descriptions of nucleosome and ACF preparation, as well as single-molecule and ensemble FRET, fluorescence anisotropy, protein crosslinking and yeast experiments, are described in Methods. Briefly, various nucleosome constructs were reconstituted using Cy3-labelled histone octamers and Cy5-labelled DNA with a biotin

Online Content Methods, along with any additional Extended Data display items and Source Data, are available in the online version of the paper; references unique to these sections appear only in the online paper. Received 9 August 2013; accepted 14 April 2014. Published online 29 June 2014. 1. 2.

3. 4.

Clapier, C. R. & Cairns, B. R. The biology of chromatin remodeling complexes. Annu. Rev. Biochem. 78, 273–304 (2009). Ito, T., Bulger, M., Pazin, M. J., Kobayashi, R. & Kadonaga, J. T. ACF, an ISWI-containing and ATP-utilizing chromatin assembly and remodeling factor. Cell 90, 145–155 (1997). Varga-Weisz, P. D. et al. Chromatin-remodelling factor CHRAC contains the ATPases ISWI and topoisomerase II. Nature 388, 598–602 (1997). Tsukiyama, T., Palmer, J., Landel, C. C., Shiloach, J. & Wu, C. Characterization of the imitation switch subfamily of ATP-dependent chromatin-remodeling factors in Saccharomyces cerevisiae. Genes Dev. 13, 686–697 (1999).

4 | N AT U R E | VO L 0 0 0 | 0 0 M O N T H 2 0 1 4

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.

Langst, G., Bonte, E. J., Corona, D. F. & Becker, P. B. Nucleosome movement by CHRAC and ISWI without disruption or trans-displacement of the histone octamer. Cell 97, 843–852 (1999). Yang, J. G., Madrid, T. S., Sevastopoulos, E. & Narlikar, G. J. The chromatinremodeling enzyme ACF is an ATP-dependent DNA length sensor that regulates nucleosome spacing. Nature Struct. Mol. Biol. 13, 1078–1083 (2006). He, X., Fan, H. Y., Narlikar, G. J. & Kingston, R. E. Human ACF1 alters the remodeling strategy of SNF2h. J. Biol. Chem. 281, 28636–28647 (2006). Dang, W., Kagalwala, M. N. & Bartholomew, B. Regulation of ISW2 by concerted action of histone H4 tail and extranucleosomal DNA. Mol. Cell. Biol. 26, 7388–7396 (2006). Stockdale, C., Flaus, A., Ferreira, H. & Owen-Hughes, T. Analysis of nucleosome repositioning by yeast ISWI and Chd1 chromatin remodeling complexes. J. Biol. Chem. 281, 16279–16288 (2006). He, X., Fan, H. Y., Garlick, J. D. & Kingston, R. E. Diverse regulation of SNF2h chromatin remodeling by noncatalytic subunits. Biochemistry 47, 7025–7033 (2008). Ito, T. et al. ACF consists of two subunits, Acf1 and ISWI, that function cooperatively in the ATP-dependent catalysis of chromatin assembly. Genes Dev. 13, 1529–1539 (1999). LeRoy, G., Loyola, A., Lane, W. S. & Reinberg, D. Purification and characterization of a human factor that assembles and remodels chromatin. J. Biol. Chem. 275, 14787–14790 (2000). Poot, R. A. et al. HuCHRAC, a human ISWI chromatin remodelling complex contains hACF1 and two novel histone-fold proteins. EMBO J. 19, 3377–3387 (2000). Clapier, C. R. & Cairns, B. R. Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes. Nature 492, 280–284 (2012). Killian, J. L., Li, M., Sheinin, M. Y. & Wang, M. D. Recent advances in single molecule studies of nucleosomes. Curr. Opin. Struct. Biol. 22, 80–87 (2012). Eberharter, A., Vetter, I., Ferreira, R. & Becker, P. B. ACF1 improves the effectiveness of nucleosome mobilization by ISWI through PHD-histone contacts. EMBO J. 23, 4029–4039 (2004). Clapier, C. R., Langst, G., Corona, D. F., Becker, P. B. & Nightingale, K. P. Critical role for the histone H4 N terminus in nucleosome remodeling by ISWI. Mol. Cell. Biol. 21, 875–883 (2001). Hamiche, A., Kang, J. G., Dennis, C., Xiao, H. & Wu, C. Histone tails modulate nucleosome mobility and regulate ATP-dependent nucleosome sliding by NURF. Proc. Natl Acad. Sci. USA 98, 14316–14321 (2001). Shogren-Knaak, M. et al. Histone H4–K16 acetylation controls chromatin structure and protein interactions. Science 311, 844–847 (2006). Ferreira, H., Flaus, A. & Owen-Hughes, T. Histone modifications influence the action of Snf2 family remodelling enzymes by different mechanisms. J. Mol. Biol. 374, 563–579 (2007). Valouev, A. et al. Determinants of nucleosome organization in primary human cells. Nature 474, 516–520 (2011).

22. Kagalwala, M. N., Glaus, B. J., Dang, W., Zofall, M. & Bartholomew, B. Topography of the ISW2-nucleosome complex: insights into nucleosome spacing and chromatin remodeling. EMBO J. 23, 2092–2104 (2004). 23. Yamada, K. et al. Structure and mechanism of the chromatin remodelling factor ISW1a. Nature 472, 448–453 (2011). 24. Blosser, T. R., Yang, J. G., Stone, M. D., Narlikar, G. J. & Zhuang, X. Dynamics of nucleosome remodelling by individual ACF complexes. Nature 462, 1022–1027 (2009). 25. Ha, T. et al. Probing the interaction between two single molecules: fluorescence resonance energy transfer between a single donor and a single acceptor. Proc. Natl Acad. Sci. USA 93, 6264–6268 (1996). 26. Deindl, S. et al. ISWI remodelers slide nucleosomes with coordinated multi-basepair entry steps and single-base-pair exit steps. Cell 152, 442–452 (2013). 27. Mueller-Planitz, F., Klinker, H., Ludwigsen, J. & Becker, P. B. The ATPase domain of ISWI is an autonomous nucleosome remodeling machine. Nature Struct. Mol. Biol. 20, 82–89 (2013). 28. Fyodorov, D. V. & Kadonaga, J. T. Binding of Acf1 to DNA involves a WAC motif and is important for ACF-mediated chromatin assembly. Mol. Cell. Biol. 22, 6344–6353 (2002). 29. Gelbart, M. E., Rechsteiner, T., Richmond, T. J. & Tsukiyama, T. Interactions of Isw2 chromatin remodeling complex with nucleosomal arrays: analyses using recombinant yeast histones and immobilized templates. Mol. Cell. Biol. 21, 2098–2106 (2001). 30. Narlikar, G. J. A proposal for kinetic proof reading by ISWI family chromatin remodeling motors. Curr. Opin. Chem. Biol. 14, 660–665 (2010). Acknowledgements We thank G. Narlikar, T. Tsukiyama, J. Vaughan, J. Moffitt and E. Sun for discussions, S. Mukherji for assistance in designing the yeast experiments, S. Trauger, K. L. Hwang, R. Magnusson, G. Hilinski and J. McGee for assistance with protein characterization and biochemistry, and G. Narlikar for providing Snf2h and Acf1 expression vectors and purification protocols. This work was supported in part by the National Institutes of Health (GM105637 to X.Z.). W.L.H. acknowledges support from the National Institutes of Health T32G007753 Training Grant. S.D. was a Merck Fellow of the Jane Coffin Childs Foundation. X.Z. is a Howard Hughes Medical Investigator. Author Contributions W.L.H., S.D. and X.Z. designed the experiments, with input from B.T.H. W.L.H. and S.D. performed the experiments and data analysis. B.T.H. helped prepare the histones and nucleosomes. S.D., W.L.H. and X.Z. wrote the paper, with input from B.T.H. X.Z. oversaw the project. Author Information Reprints and permissions information is available at www.nature.com/reprints. The authors declare no competing financial interests. Readers are welcome to comment on the online version of the paper. Correspondence and requests for materials should be addressed to X.Z. ([email protected]).

0 0 M O N T H 2 0 1 4 | VO L 0 0 0 | N AT U R E | 5

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER METHODS DNA constructs. Double-stranded (ds)DNA constructs containing the 601 nucleosome positioning sequence31, varying DNA linker lengths on the entry side of the nucleosome, 3 bp linker DNA on the exit side of the nucleosome, a FRET acceptor Cy5 attached to the 59-end of the exit-side linker DNA and a biotin moiety attached to the 59-end of the entry-side linker DNA were generated by PCR and purified by PAGE. The dsDNA constructs with an additional 38 nucleotide (nt) single-stranded (ss) DNA spacer used for single-molecule mononucleosome remodelling experiments were created by annealing and ligating a set of overlapping, complementary oligonucleotides. The 38 nt ssDNA spacer was used to prevent surface perturbation in remodelling. These high-performance liquid chromatography (HPLC)purified oligonucleotides (Integrated DNA Technologies) were mixed at equimolar concentrations in 50 mM Tris pH 8.0, 100 mM KCl, 1 mM EDTA and annealed with a temperature ramp (95–3 uC), ligated with T4 DNA ligase (New England Biolabs) and purified by PAGE. Successful ligation was confirmed by denaturing PAGE. To make dinucleosomes, DNA constructs for each mononucleosome were first created using the above anneal-ligate approach. In this case, the 38 nt ssDNA spacer was not used since the nucleosome to be remodelled was the one distal to the surface anchoring site. To give a couple of example oligonucleotide sequences, the following oligonucleotides were used to assemble the dsDNA for the mononucleosome with 40 bp entry-side linker DNA. Top strand: 59-/5Cy5/GCCCTGGAGAATCCCGGTCTG CAGGCCGCTCAATTG-39; 59-/5Phos/GTCGTAGACAGCTCTAGCACCGCT TAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCG-39; 59-/5Phos/CC AAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATC-39; 59-/5Phos/CTGTGAGTGTTCCGAGCTCCCACTCTAGAGGATCCCCGGGTA CC-39. Bottom strand: 59-/5Bioteg/CCCGCCCGCCAAAAAAAAAAAAAAAAA AAAAAAAAAAAGGTACCCGGGGATCCTCTAGAGTGG-39; 59-/5Phos/GAG CTCGGAACACTCACAGGATGTATATATCTGACACGTGCCTG-39; 59-/5Phos/ GAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCG CGTACGTG-39; 59-/5Phos/CGTTTAAGCGGTGCTAGAGCTGTCTACGACC AATTGAGCGGCCTGCAGACCGGGATTCTCCAGGGC-39. The following oligonucleotides were used to assemble the dsDNA for the two nucleosomes that were subsequently ligated to obtain the dinucleosome with 40 bp internucleosome spacing. Nucleosome 1, top strand: 59-/5Cy5/GCCCTGGAGAA TCCCGGTCTGCAGGCCGCTCAATTG-39; 59-/5Phos/GTCGTAGACAGCTC TAGCACCGCTTAAACGCACGTACGCGCTGTCCCC-39; 59-/5Phos/CGCGT TTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCAC-39; 59-/5Phos/ GTGTCAGATATATACATCCTGTGCTTGTATTGCCCAGCGACCTTGCCCG TGC-39. Nucleosome 1, bottom strand: 59-/5Phos/CAATACAAGCACAGGAT GTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATC-39; 59-/5Phos/ CCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAG-39; 59-/5Phos/CGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTGCAGA CCGGGATTCTCCAGGGC-39. Nucleosome 2, top strand: 59-/5Phos/CAGTCG GATACTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAG CTCTAGCA-39; 59-GCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTA ACCGCCAAGGGGATTACTCCCTAGTCTCCAG-39; 59-/5Phos/GCACGTGT CAGATATATACATCCTGTGCATGTATTGAACAGCGAC-39; 59-/5Phos/CTT GCCGGTGCCAGTCGGATA/3alexf488n/-39. Nucleosome 2, bottom strand: 59-/ 5Bioteg/TATCCGACTGGCACCGGCAAGGTCGCTGTTCAATACATGCACA G-39; 59-/5Phos/GATGTATATATCTGACACGTGCCTGGAGACTAGGGAG TAATCCCCTTG-39; 59-GGTTAAAACGCGGGGGACAGCGCGTACGTGCG TTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGC-39; 59-/5Phos/ CTGCAGACCGGGATTCTCCAGTATCCGACTGGCACGGGCAAGGTCGCT GGG-39. At the ssDNA gaps on the unlabelled nucleosome proximal to the surfaceanchoring site, the corresponding oligonucleotides were not 59-phosphorylated. The final, ligated DNA sequences of the various nucleosome constructs are provided in Extended Data Fig. 10. Histone octamers. Recombinant Xenopus laevis H2A, H2AK120C, H2B, H3, H3C110A, H4, H4K16A, H4D1–19 and H4NCys (with an N-terminal cysteine residue inserted) histones were expressed in BL21 (DE3) pLysS competent cells (Stratagene) and purified from inclusion bodies by gel filtration (Sephacryl S-200 column, GE Healthcare) and ion exchange (Resource-S column, GE Healthcare) chromatography under denaturing conditions32,33. The H4K16A, H4D1–19 and H4NCys mutants were created by site-directed mutagenesis using the following primers. H4K16A: 59-CTTTAAGAAGGAGATATACATATGAAAGTTCTGCGTGACA ACATCCAG-39; 59-CTGGATGTTGTCACGCAGAACTTTCATATGTATATC TCCTTCTTAAAG-39. H4D1–19: 59-AAGGTCTGGGTAAAGGTGGTGCTGC ACGTCACCGTAAAG-39; 59-CTTTACGGTGACGTGCAGCACCACCTTTAC CCAGACCTT-39. H4NCys; 59-GAAGGAGATATACATATGTGCTCTGGTCG TGGTAAAGG-39; 59-CCTTTACCACGACCAGAGCACATATGTATATCTCC TTC-39.

For site-specific labelling of histone H2A, a cysteine substitution was introduced at residue 120 (K120C) as described previously6. Lyophilized H2A was dissolved in labelling buffer (7 M guanidine-HCl, 20 mM Tris pH 7.0, 5 mM Na-EDTA, 1.25 mM TCEP) and incubated for 2 h in the dark. Cy3-maleimide was dissolved in DMSO and added to the reaction to a final concentration of 2.5 mM. After incubating for 3 h in the dark, the reaction was quenched by adding 80 mM b-mercaptoethanol. The labelled H2A was dialysed three times against dialysis buffer (7 M guanidine HCl, 20 mM Tris pH 7.0, 1 mM DTT) in a 7K MWCO dialysis cassette (Pierce) and quantified. To reconstitute histone octamer, each lyophilized core histone was dissolved in unfolding buffer (7 M guanidine-HCl, 20 mM Tris-HCl pH 7.5, 10 mM DTT), mixed in a molar ratio of 1.2:1.2:1:1 H2A:H2B:H3:H4, dialysed against refolding buffer (2 M NaCl, 10 mM Tris-HCl pH 7.5, 1 mM Na-EDTA, 5 mM b-mercaptoethanol) and purified by gel filtration chromatography (Superdex 200 10/100 GL column, GE Healthcare) as previously described32. For making FRET-labelled nucleosomes, a ratio of approximately 1:1 of Cy3-labelled and unlabelled H2A mixture was used. Because each histone octamer contained two H2A subunits, this reconstitution yielded three distinct populations of Cy3-labelled nucleosomes: (1) with Cy3 attached only to the H2A subunit proximal to the FRET acceptor Cy5 on the DNA, (2) with Cy3 attached only to the H2A subunit distal to the Cy5 on the DNA and (3) with both H2A labelled by Cy3. These three labelling configurations yielded distinct FRET levels that could be clearly distinguished at the single-molecule level, as shown previously24. To maximize the dynamic range for single-molecule FRET measurements, we selected the population with the highest FRET value, which corresponded to nucleosomes with a single Cy3 on the proximal H2A, for further analysis. For ensemble FRET measurements, because the overall remodelling rate was derived from the decay curve of the acceptor signal, distinguishing the three populations was unnecessary. For crosslinking experiments, only unlabelled H2A was used. Nucleosomes. Mononucleosomes were reconstituted from DNA and histone octamers at 4 uC (ref. 32). The nucleosome reconstitution reaction consisted of 2 M KCl, 20 mM Tris-HCl pH 7.5, 1 mM Na-EDTA, 1.2 mM histone octamer, 1 mM DNA construct, 10 mM DTT and 0.5 mM benzamidine. The sample was injected into a pre-hydrated 7K MWCO dialysis cassette (Pierce) and subjected to salt gradient dialysis (2 M KCl to 250 mM KCl over 60 h) followed by incubation in TCS buffer (20 mM Tris-HCl pH 7.5, 1 mM EDTA, 1 mM DTT) for 8 h at 4 uC. Assembled nucleosomes were purified on a 10–30% glycerol gradient in 20 mM Tris-HCl pH 7.5, 1 mM EDTA, 0.1% Igepal CA-630. Fractions were analysed by PAGE (5% 0.53 TBE) and fractions containing pure and correctly assembled nucleosomes were pooled and concentrated with a 100K MWCO Amicon Ultra-0.5 mL centrifugal filter (Millipore) to ,30 ml final volume and stored at 4 uC. For the assembly of nucleosomes used in crosslinking experiments, reducing agent was omitted. Dinucleosomes were prepared by assembling each mononucleosome separately and then ligating these mononucleosomes (Extended Data Fig. 3a). The distal nucleosome further away from the surface-anchoring site was FRET-labelled in the same way as the mononucleosome constructs. The proximal unlabelled nucleosome closer to the surface-anchoring site featured 2 nt gaps at the super-helical location 6 2 (SHL 6 2) sites to prevent translocation and biotin at the DNA end for surfaceanchoring. Each ligation reaction contained approximately 1 pmol of total nucleosomes with an excess of the distal FRET-labelled nucleosome over the proximal unlabelled nucleosome, 13 T4 DNA ligase buffer (New England Biolabs) supplemented with 10 mM KCl, 0.1% Igepal CA-630 and 2000 units of T4 DNA ligase (New England Biolabs) in a final volume of 20 ml. Ligation was allowed to proceed at room temperature for 1 h followed by the addition of EDTA and glycerol to final concentrations of 1 mM and 20%, respectively, and storage at 4 uC. Purification was unnecessary because only the constructs that contained both distal FRET-labelled and proximal nucleosomes with a biotin moiety could be anchored to the surface and generate a FRET signal. ACF. To produce isolated Snf2h-Flag or isolated Acf1-Flag, these proteins were overexpressed in Sf9 cells using a baculovirus expression system (Kinnakeet Biotechnology). To produce ACF complexes, Snf2h and Acf1-Flag were co-expressed in Sf9 cells. Nuclear extraction was performed as described previously6,7. Nuclear extract was fortified with 0.5 mM benzamidine, 60 mg ml21 TLCK, and 13 Roche Complete Protease Inhibitor Cocktail and then purified by M2-affinity chromatography (Anti-Flag M2 beads and Flag peptide, Sigma-Aldrich), as described previously6,7. Specifically, the Flag-tagged subunit or complex was bound to M2 beads, and the beads were washed several times with wash buffer containing 20 mM HEPES, pH 7.9, 20% glycerol, 0.2 mM EDTA, 1 mM benzamidine, 1 mM DTT, Roche EDTAfree complete protease inhibitor and various concentrations of KCl (300, 150 and 100 mM sequentially). Protein was subsequently eluted with a 1 mg ml21 Flag peptide solution in wash buffer with 100 mM KCl. Elution fractions were analysed by PAGE and fractions containing the isolated subunits or the intact ACF complex were pooled and concentrated with a 50K MWCO Amicon Ultra-15 mL centrifugal filter (Millipore). Concentrated ACF complexes, Snf2h subunit and Acf1 subunit

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH were then aliquoted, flash frozen and stored at 280 uC in 20 mM HEPES, pH 7.9, 20% glycerol, 0.2 mM EDTA, 100 mM KCl and 1 mM DTT. To purify enzyme for crosslinking experiments, the complete protease inhibitor pills and DTT were omitted from the buffers during the affinity purification steps. Typical yields were ,50–100, 20–40 and 1–2 mg of ACF complexes, Snf2h subunit and Acf1 subunit, respectively, per litre of insect cell culture. Quantification was by SYPRO-red staining and comparison with BSA standards. The Snf2h and Acf1 mutants were created by site-directed mutagenesis using the following primers. AutoN-2RA Snf2h (R142A, R144A): 59-ACTATCCGTTGGCGATTACGCACACGCTAGAACAGAGCAAG AGGAG-39; 59-CTCCTCTTGCTCTGTTCTAGCGTGTGCGTAATCGCCAAC GGATAGT-39. DNegC Snf2h (D669–700, insert SGSGS): 59-GTGTTTGCTTCA AAGGAAAGTGAGTCTGGATCTGGATCTAGAAACTTTACAATGGATACA GAG-39; 59-CTCTGTATCCATTGTAAAGTTTCTAGATCCAGATCCAGACT CACTTTCCTTTGAAGCAAACAC-39. DC-term Acf1 (D1423–1556): 59-GCCT GTGACACTGGGTGACTACAAGGACGATG-39; 59-CATCGTCCTTGTAGTC ACCCAGTGTCACAGGC-39. DN-term Acf1 (D1–371): 59-GCAGGGTACCGG AGATGGTAGAAAGAGAAAAGGAAAG-39; 59-CTTTCCTTTTCTCTTTCTA CCATCTCCGGTACCCTGC-39. Ensemble FRET assay for nucleosome remodelling. The ensemble remodelling kinetics of nucleosomes were measured by monitoring the total acceptor (Cy5) signal (under a constant 532 nm illumination that excited the donor Cy3) of a solution of FRET-labelled nucleosomes after addition of ACF and ATP to initiate remodelling. As nucleosomes were translocated towards the centre of the DNA, the FRET efficiency decreased, which resulted in a decrease in the Cy5 signal. The ensemble nucleosome remodelling assay was performed by diluting nucleosomes in remodelling buffer (40 mM Tris pH 7.5, 12 mM HEPES pH 7.9, 60 mM KCl, 0.32 mM EDTA, 3 mM MgCl2, 100 mg ml21 acetylated BSA, 10% (v/v) glycerol, 0.02% (v/v) Igepal CA-630, 10% glucose, 2 mM Trolox and 2.5 mM protocatechuic acid) in a cuvette fitted for a Cary Eclipse Fluorescence Spectrophotometer (Varian). Immediately before starting a kinetic scan (ex 5 532 6 10 nm, em 5 670 6 20 nm, 1 Hz acquisition frequency, 20 uC), ACF, ATP and additional MgCl2 equimolar to ATP were mixed in the remodelling buffer and added to the nucleosomes, achieving a final concentration of 2.5 nM nucleosomes and varying concentrations of enzyme and ATP, as reported. For remodelling experiments in the presence of the H4-tail peptide, synthetic peptide containing the H4-tail sequence (residues 1–21 of histone H4, SignalChem) was mixed together with ACF, ATP and MgCl2 in the remodelling buffer before being added to the nucleosomes. The final concentration of the H4-tail peptide was 20 nM. Single-molecule FRET assay for nucleosome remodelling. Quartz slides were cleaned, functionalized with poly(ethylene glycol) (PEG, Laysan Bio) and assembled into flow chambers as previously described24. Reconstituted nucleosomes were anchored to coated quartz slides via a streptavidin-biotin linkage. To eliminate potential perturbation of remodelling by surface anchoring, especially for mononucleosomes with relatively short entry-side linker DNA, we inserted a 38 nt ssDNA spacer between the biotin and dsDNA. With the ssDNA spacer, the remodelling kinetics of surface-anchored nucleosomes with 40 bp or longer entry-side linker DNA were indistinguishable from those of freely diffusing nucleosomes measured using the ensemble FRET assay (Extended Data Fig. 1b). We performed our singlemolecule FRET studies on nucleosomes with at least 40 bp of entry-side linker DNA. The FRET donor Cy3 was directly excited with a 532 nm Nd:YAG laser (CrystaLaser) in a total internal reflection (TIRF) configuration and fluorescence emission from Cy3 and Cy5 was captured with a 360 water immersion objective (Olympus), filtered with a 550 nm long-pass filter (Chroma Technology), spectrally split by a 630 nm dichroic mirror (Chroma Technology), and imaged onto two halves of a CCD (charge-coupled device) camera (Andor iXonEM1888). The imaging conditions were 30 uC in the imaging buffer (40 mM Tris pH 7.5, 12 mM HEPES pH 7.9, 60 mM KCl, 0.32 mM EDTA, 3 mM MgCl2, 100 mg ml21 acetylated BSA, 10% (v/v) glycerol, 0.02% (v/v) Igepal CA-630), 10% (w/v) glucose, 800 mg ml21 glucose oxidase, 50 mg ml21 catalase, 2 mM Trolox and 2.5 mM protocatechuic acid). In certain experiments, 20 nM H4-tail peptide was included. The enzymatic oxygen scavenging system and antioxidants (10% glucose, 800 mg ml21 glucose oxidase, 50 mg ml21 catalase, 2 mM Trolox and 2.5 mM protocatechuic acid) were used to reduce fluorophore photobleaching and blinking34,35. Remodelling was initiated by infusing the flow chamber with a solution containing ACF and ATP in imaging buffer using a syringe pump (KD Scientific). Fluorescence anisotropy binding assay. For binding studies, we used a synthetic peptide (SignalChem) that contained residues 1–21 of human histone H4 as well as an additional C-terminal cysteine to enable thiol-based labelling. Tetramethylrhodamine5-iodoacetamide (TMRIA) was coupled to the C terminus of the synthetic H4-tail peptide to yield TMR-labelled H4 peptide (H4-tail-TMR). The coupling reaction was performed by shaking 0.2 mM peptide, approximately 2-fold molar excess of TMRIA, and 10-fold molar excess of TCEP in 1 ml of 20 mM Tris (pH 7.5) in the

dark for 2 h at room temperature. The labelled peptide was purified by RP-HPLC and its identity confirmed by liquid chromatography–mass spectrometry analysis. Fluorescence anisotropy measurements were done at 25 uC using a Molecular Devices SpectraMax microplate reader. Binding curves were recorded in opaque low-volume 384-well assay plates. Individual wells contained 20 nM H4-tail-TMR and the indicated concentration of Acf1 in 20 mM Tris (pH 8.0), 100 mM KCl and 20% (v/v) glycerol. The anisotropy of fluorescence was measured as a function of the Acf1 concentration. Dissociation constants were determined by fitting the fluorescence anisotropy data to the solution of a quadratic equation derived from the binding isotherm, which took into account depletion of Acf1 protein: r 5 {a/(2[H4]t)} 3 {[P]t 1 [H4]t 1 Kd –(([P]t 1 [H4]t 1 Kd)2 2 4[P]t[H4]t)0.5} 1 r0, where r is the fluorescence anisotropy, r0 represents an offset value, a is a scaling factor, Kd is the dissociation constant, [H4]t represents the total concentration of the H4-tail-TMR peptide and [P]t is the total concentration of titrated Acf1 protein. Errors in the determination of Kd were estimated by calculating the 95% confidence intervals. Protein crosslinking. Homobifunctional maleimide crosslinker BM(PEG)3 (Pierce) was added to concentrated H4NCys nucleosomes (defined below) to achieve a final concentration of ,5 mM nucleosomes and 500 mM crosslinker. The H4NCys nucleosome contained a single labelling site in the form of a cysteine added to the N terminus of histone H4, immediately following the initial methionine. The other histone proteins used to prepare H4NCys nucleosomes were WT H2A, WT H2B and H3C110A, which did not contain additional cysteine residues. The crosslinker-labelling reaction was done at room temperature for 1.5 h. Buffer exchange with wash buffer (20 mM HEPES pH 7.0, 1 mM EDTA, 10% glycerol, 10 mM KCl, 0.1% Igepal CA630) used a 100K MWCO Amicon Ultra-0.5 mL centrifugal filter (Millipore) five times to remove unreacted crosslinker. ACF was then added to the BM(PEG)3derivatized nucleosomes to achieve a final enzyme concentration of 200–400 nM and nucleosome concentration of 5 mM, and incubated for 2 h. Symmetrical nucleosomes with equal linker DNA lengths on both sides were used to produce data shown in Fig. 4e and Extended Data Fig. 9. Similar results were obtained from asymmetric nucleosomes with 3 bp linker DNA on the exit side and varying linker lengths on the entry side. Crosslinking products were analysed by SDS–PAGE (4– 15%, 13 Tris/glycine/SDS) and SYPRO-red staining. Under each condition, the Acf1-H4 crosslinked fraction was calculated as IAcf1-H4/[(IAcf1-H4 1 IAcf1) 3 Irel,histones], where IAcf1-H4 and IAcf1 are the integrated intensities of the Acf1-H4 and Acf1 bands, respectively, and Irel,histones is the relative histone amount obtained by dividing the histone band intensity in a given lane by the maximum histone band intensity in the gel. The Snf2h-H4 crosslinked fraction was obtained analogously. Normalization by the relative histone intensity in each lane compensated for any small variation in the nucleosome concentration used, even though efforts were made to maintain identical nucleosome concentrations for all conditions. For validation of the H4-crosslinking product, immunoblotting used a primary rabbit polyclonal a-histone H4 antibody (Abcam ab10158, tested for Western Blotting applications by the ‘Abpromise’ guarantee) and a horseradish-peroxidase-conjugated secondary antibody, and H4 was detected by chemiluminescence (GE Healthcare ECL). Yeast genetics experiments. Mutant yeast strains were generated in the BY4741 background (ATCC 4006733, MATa; his3D1; leu2D0; met15D0; ura3D0). This strain lacks the ura3 gene that encodes an enzyme involved in uracil synthesis and can only grow in media supplemented with uracil (or uridine). The Ditc1 strain was derived from BY4741 by replacing (through yeast transformation and integration by homologous recombination) the itc1 coding sequence with a URA3 cassette that included the ura3 gene. Positive transformants were selected on media lacking uracil (uracil-dropout). The URA3 cassette was generated by PCR from the pRS306 plasmid (primers used: taacaataggaggaagtaaagaaag ccgttaataaacaatctgtgcggtatttcacaccg and atttggggcaggtgttactgttcttgaggtttggcccactagattgtactgagagtgcac). The Ditc1-Nterm strain was derived from the Ditc1 strain by replacing the URA3 cassette with the itc1 coding sequence lacking the portion that encoded residues 2–374 at the N terminus of Itc1. DNA for transformation was prepared by PCR from a plasmid encoding Itc1 lacking the N-terminal region (DN-term Itc1). Positive transformants were selected on uracil-containing media additionally supplemented with 5-fluoroorotic acid (5FOA) for counterselection against cells that still contained the URA3 cassette and could therefore convert 5-FOA into a toxic suicide inhibitor causing cell death. The rescue-Ditc1 strain was derived from the Ditc1-Nterm strain by replacing the inserted coding sequence for the DN-term Itc1 construct with a URA3 cassette and selecting on uracil-dropout media. All strains were confirmed by PCR screening and sequencing at the itc1 locus. For growth assays, liquid overnight cultures of the different strains were diluted to the same cell density, and tenfold serial dilutions of each strain were spotted onto yeast extract peptone dextrose (complete medium including uracil) plates and grown at 30 uC. Data analysis. We analysed single-molecule time traces using a custom-written Matlab code. Nucleosome translocation steps were identified manually or by fitting a staircase function to the FRET time traces using a step-finding algorithm36. Nonlinear curve fitting of the fluorescence anisotropy data used Matlab, and 95%

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER confidence intervals for fit parameters were obtained using the ‘confint’ routine. Experimental sample sizes as indicated in the figure captions gave the reported s.e.m. values that were sufficiently low to allow meaningful interpretation of the data. 31. 32.

Lowary, P. T. & Widom, J. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol. 276, 19–42 (1998). Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F. & Richmond, T. J. Crystal structure of the nucleosome core particle at 2.8 A˚ resolution. Nature 389, 251–260 (1997).

33.

34. 35.

36.

Luger, K., Rechsteiner, T. J. & Richmond, T. J. Preparation of nucleosome core particle from recombinant histones. Methods Enzymol. 304, 3–19 (1999). Rasnik, I., McKinney, S. A. & Ha, T. Nonblinking and long-lasting single-molecule fluorescence imaging. Nature Methods 3, 891–893 (2006). Aitken, C. E., Marshall, R. A. & Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophys. J. 94, 1826–1835 (2008). Kerssemakers, J. W. et al. Assembly dynamics of microtubules at molecular resolution. Nature 442, 709–712 (2006).

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH

Extended Data Figure 1 | Control experiments to test the effect of ATP and surface-anchoring on nucleosome remodelling. a, Ensemble remodelling time courses of [WT H4, 78 bp] nucleosomes by 10 nM ACF with 5 mM ATP (filled symbols) or without ATP (open symbols). Nucleosome translocation was monitored by the emission intensity of the FRET acceptor Cy5 under

constant 532 nm illumination that excited the FRET donor Cy3. b, Comparison of the average remodelling kinetics for surface-anchored [WT H4, 40 bp] nucleosomes (measured by the single-molecule assay, more than 250 nucleosomes) and freely diffusing [WT H4, 40 bp] nucleosomes in solution (measured by the ensemble assay). [ACF] 5 5 nM and [ATP] 5 20 mM.

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER

Extended Data Figure 2 | Translocation step sizes and dwell time distributions of translocation and pause phases during nucleosome remodelling. a, Histogram of FRET levels for the initial position and pause positions of [WT H4, 40 bp] nucleosomes upon remodelling by ACF. The histogram was fitted by multiple Gaussian peaks (black line) and the peak values were used to compute the average translocation distances between pauses. The translocation distances could be quantified using a calibration curve of FRET efficiency versus exit-side linker DNA length24,26, yielding a 7.0 bp step size between the initial position and the first pause and a 3.4 bp step size between the first pause and the second pause. b, Step sizes for various mononucleosomes and dinucleosomes. The dinucleosome constructs, [WT

H4, 40 bp, WT H4] and [WT H4, 78 bp, WT H4], are each composed of one FRET-labelled nucleosome and one unlabelled nucleosome, spaced by 40 bp and 78 bp of internucleosomal linker DNA, respectively. The flanking linker DNA is 3 bp on the side of the FRET-labelled nucleosome and 40 bp on the side of the unlabelled nucleosome. The unlabelled nucleosome contains 2-nt ssDNA gaps at the SHL 6 two sites to prevent translocation. Data are mean 6 s.e.m. derived from at least 100 remodelling traces from three independent experiments. c, Dwell-time distributions for the first translocation phase, tT1, and the first pause phase, tP1, for nucleosomes with different lengths of linker DNA. [ACF] 5 10 nM and [ATP] 5 20 mM.

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH

Extended Data Figure 3 | DNA linker-length sensing by ACF is quantitatively similar for mononucleosomes and dinucleosomes. a, The dinucleosomes contain a distal FRET-labelled nucleosome and a proximal unlabelled nucleosome connected by n bp of internucleosomal linker DNA. The flanking linker DNA is 3 bp and 40 bp on the side of the FRET-labelled and the unlabelled nucleosome, respectively. To facilitate the study of translocation of the FRET-labelled nucleosome, we placed 2-nt ssDNA gaps at the SHL 6 two

sites of the proximal nucleosome to prevent its repositioning. b, Comparison of translocation and pause-phase exit rates for mononucleosomes (filled bars) and dinucleosomes (hashed bars) with 40 bp and 78 bp linker lengths. [ACF] 5 10 nM and [ATP] 5 20 mM. Data are mean 6 s.e.m. derived from at least 100 individual nucleosome remodelling traces from three independent experiments.

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER

Extended Data Figure 4 | SDS–PAGE analysis of WT, DNegC, AutoN-2RA, DN-term and DC-term ACF complexes. a, WT Snf2h, DNegC Snf2h or AutoN-2RA Snf2h was co-expressed with Acf1-Flag in Sf9 insect cells and purified by affinity chromatography. b, DN-term Acf1 or DC-term Acf1 was

co-expressed with Snf2h-Flag and purified by affinity chromatography. The presence of both Acf1 and Snf2h in each case indicated that WT SNF2h, DNegC SNF2h and AutoN-2RA SNF2h can all form complexes with Acf1 and that DN-term Acf1 and DC-term Acf1 can both form complexes with Snf2h.

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH

Extended Data Figure 5 | Short-range linker-length sensing by the isolated Snf2h catalytic subunit requires the NegC domain. Ensemble remodelling

time courses of [WT H4, 78 bp], [WT H4, 40 bp] and [WT H4, 20 bp] nucleosomes by 130 nM WT (a) or DNegC Snf2h (b) at 2 mM ATP.

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER

Extended Data Figure 6 | Ensemble remodelling time courses of nucleosomes by WT and AutoN-2RA ACF at two different enzyme concentrations. a, Remodelling of [WT H4, 78 bp] and [WT H4, 40 bp]

nucleosomes by 40 nM (top) and 10 nM (bottom) WT ACF. b, Remodelling of [WT H4, 78 bp] and [WT H4, 40 bp] nucleosomes by 40 nM (top) and 10 nM (bottom) AutoN-2RA ACF.

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH

Extended Data Figure 7 | The C-terminal region of Acf1 is not required for specific binding to the H4 tail or for linker-length sensing by the ACF complex. a, Domain maps of WT and DC-term Acf1 (residues 1423–1556 deleted). b, Fluorescence anisotropy of TMR-labelled WT or 2RA H4-tail peptide in the presence of varying amounts of WT Acf1. In the 2RA H4-tail peptide, two charged arginines in the basic patch of the H4-tail peptide corresponding to the 2RA mutation in AutoN were replaced with alanines. Kd for the 2RA H4-tail peptide (41 6 29 nM) is substantially higher than that of the WT H4-tail peptide (3 6 9 nM). Data are presented as mean 6 s.e.m. (error bars, 95% confidence intervals, n 5 3 three independent titration experiments).

When excess unlabelled H4-tail peptide was added to compete the TMRlabelled peptide off Acf1, the fluorescence anisotropy was reduced to the background level observed in the absence of Acf1. c, Fluorescence anisotropy of TMR-labelled H4-tail peptide in the presence of varying amounts of WT or DC-term Acf1. The measured Kd for DC-term Acf1 is 2 6 7 nM, which is similar to that for WT Acf1 (3 6 9 nM). Data are presented as mean 6 s.e.m. (error bars, 95% confidence intervals, n 5 3 independent titration experiments). d, Ensemble remodelling time courses of [WT H4, 78 bp], [WT H4, 40 bp] and [H4D1–19, 78 bp] nucleosomes by 40 nM WT (black/grey lines) and DC-term ACF (purple/light purple symbols) at 5 mM ATP.

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER

Extended Data Figure 8 | Binding of dsDNA to Acf1 depends on its N-terminal region. Electrophoretic mobility of dsDNA (225 bp, 8 nM) in the presence or absence of 22 nM WT or DN-term Acf1. As a comparison, lanes 2 and 4 show Acf1 samples without the dsDNA.

©2014 Macmillan Publishers Limited. All rights reserved

LETTER RESEARCH

Extended Data Figure 9 | a-histone H4 immunoblot analysis validates the formation of the Acf1-H4 crosslinked product. a, Left: SDS–PAGE analysis of samples containing ACF alone or ACF with nucleosomes (20 bp linker DNA) that do not possess the cysteine-reactive crosslinker on the H4 tail. Both samples yield two distinct bands corresponding to the Acf1 and Snf2h subunits (180 kDa and 122 kDa, respectively). Additionally, histone bands at low molecular masses are present in the lane for the sample containing nucleosomes. Right: corresponding immunoblot using a-H4 antibody. In the presence of nucleosomes without crosslinker, a single H4 band is visible at

,11 kDa corresponding to the histone itself. b, Top: incubation of ACF and nucleosomes that contain a crosslinker at the H4 tail yield Acf1-H4 and Snf2h-H4 crosslinking bands. These bands are absent for ACF without addition of nucleosomes (‘2nucleosomes’) or upon addition of nucleosomes without a crosslinker (‘1nucleosomes (2crosslinker)’). Proteolytic degradation of Acf1 gave rise to a fainter band immediately below Acf1. Bottom: a-histone H4 immunoblotting reveals specific Acf1-H4 and Snf2h-H4 bands that are absent for ACF without addition of nucleosomes or upon addition of nucleosomes without a crosslinker.

©2014 Macmillan Publishers Limited. All rights reserved

RESEARCH LETTER

Extended Data Figure 10 | DNA constructs used for mononucleosomes and dinucleosomes. The 601 nucleosome positioning sequence is shown in green (601* represents the introduction of 2 nt gaps at nucleotides 53 and 54 in the top and bottom strands of the 601 positioning sequence, respectively). For mononucleosome DNA constructs, the ssDNA spacer used to circumvent surface effects in single-molecule FRET measurements is underlined. Constructs referred to as ‘mononucleosome [or dinucleosome] with n bp linker

DNA’ were used in single-molecule and bulk remodelling experiments. For ensemble remodelling experiments with mononucleosomes, the ssDNA spacer was omitted without any appreciable change in the overall remodelling kinetics. Constructs referred to as ‘symmetric mononucleosomes with n bp linker DNA’ were used in crosslinking experiments. Asymmetric constructs with the same linker length on one side of the nucleosome but only 3 bp of linker DNA on the other side displayed quantitatively similar crosslinking behaviour.

©2014 Macmillan Publishers Limited. All rights reserved