Histopathology 2016 DOI: 10.1111/his.12943

Histological spectrum of angiofibroma of soft tissue: histological and genetic analysis of 13 cases Yuichi Yamada, Hidetaka Yamamoto, Kenichi Kohashi, Takeaki Ishii, Kunio Iura, Akira Maekawa, Hirofumi Bekki, Hiroshi Otsuka, Kyoko Yamashita,1 Hiroyuki Tanaka,2 Tsubasa Hiraki,3 Munenori Mukai,4 Atsuko Shirakawa,5 Yoko Shinnou,6 Mari Jinno,7 Hiroyuki Yanai,8 Kenichi Taguchi,9 Yoshihiko Maehara,10 Yukihide Iwamoto11 & Yosinao Oda Department of Anatomic Pathology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, 1Department of Pathology and Biological Responses Graduate School of Medicine, Nagoya University, Nagoya, 2Section of Oncopathology and Regenerative Biology, Department of Pathology, Faculty of Medicine, University of Miyazaki, Miyazaki, 3Department of Human Pathology, Field of Oncology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, 4Department of Pathology, Kouseiren Takaoka Hospital, Takaoka, 5Department of Pathology, Sumitomo Besshi Hospital, Niihama, 6Department of Clinical Pathology, National Hospital Organization Okayama Medical Centre, Okayama, 7Department of Diagnostic Pathology, Faculty of Medicine, University Hospital, Kagawa University, Kagawa, 8Department of Pathology, Okayama University Hospital, Okayama, 9Department of Pathology, National Kyushu Cancer Centre, Fukuoka, 10Department of Surgery and Science, Graduate School of Medical Science, Kyushu University, Fukuoka, and 11Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan Date of submission 9 December 2015 Accepted for publication 30 January 2016 Published online Article Accepted 4 February 2016

Yamada Y, Yamamoto H, Kohashi K, Ishii T, Iura K, Maekawa A, Bekki H, Otsuka H, Yamashita K, Tanaka H, Hiraki T, Mukai M, Shirakawa A, Shinnou Y, Jinno M, Yanai H, Taguchi K, Maehara Y, Iwamoto Y & Oda Y. (2016) Histopathology. DOI: 10.1111/his.12943

Histological spectrum of angiofibroma of soft tissue: histological and genetic analysis of 13 cases Aims: Angiofibroma of soft tissue (AFST) is a rare soft tissue neoplasm characterized by a fibroblastic cytomorphology and a prominent vascular structure. AFSTs possess a novel fusion gene, i.e. NCOA2–AHRR/ AHRR–NCOA2 or GTF2I–NCOA2, providing a useful approach to diagnosing AFST. Morphologically, AFSTs span a wide spectrum, making diagnosis a challenge. The aim of this study was to review AFST cases and to report previously unknown histological features, which we confirmed by genetic analysis. Methods and results: We reviewed 276 cases diagnosed as solitary fibrous tumours/haemangiopericytomas (232 cases), unclassified tumours of fibroblastic differentiation (36 cases), and recently diagnosed AFSTs (eight cases), and retrieved 13 cases compati-

ble with AFST. Immunohistochemical staining was performed for these cases, all 13 of which were analysed by reverse transcription polymerase chain reaction and fluorescence in-situ hybridization. The histological findings were as follows: amianthoid fibres, extravasation of red blood cells, haemosiderin deposition, aggregates of foamy histiocytes, cystic change, necrosis, and haemorrhage. Immunohistochemically, the tumour cells were positive for epithelial membrane antigen (four of 13 cases), desmin (six of 13 cases), CD163 (13 of 13 cases), CD68 (seven of 13 cases), oestrogen receptor (13 of 13 cases), progesterone receptor (three of 13 cases), and STAT6 (one of 13 cases, weak nuclear staining), but they were negative for CD34, a-smooth muscle actin,

Address for correspondence: Y Oda, Department of Anatomic Pathology, Pathological Sciences, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka-shi, Fukuoka-ken 812-8582, Japan. e-mail: [email protected] © 2016 John Wiley & Sons Ltd.

2 Y. Yamada et al.

muscle-specific actin, S100, pan-cytokeratin, MDM2, and CDK4. The AHRR–NCOA2 fusion gene was detected in eight cases, and NCOA2 gene rearrangement in nine cases. Conclusion: We revealed the previously unreported histological variation and immunohistochemical find-

ings of AFST, and confirmed them by using genetic methods. The results suggested that AFST should be considered in the diagnosis of fibrous or fibrohistiocytic tumours with the above histological features.

Keywords: AFST, angiofibroma of soft tissue, fusion gene

Introduction Angiofibroma of soft tissue (AFST) is a rare soft tissue neoplasm with fibroblastic/myofibroblastic differentiation, and is characterized by fibroblastic cytomorphology and a prominent vascular pattern. AFST was first reported in 2012 by Mari~ no-Enrıquez et al. as a morphologically distinctive benign soft tissue tumour with a simple karyotype and a balanced t(5;8) chromosomal translocation.1 In the same year, novel fusion genes, i.e. NCOA2–AHRR/AHRR–NCOA2 and GTF2I–NCOA2, were discovered by Jin et al. and Arbajian et al., respectively, providing a useful diagnostic approach to AFST.2,3 In addition, the availability of fluorescence in-situ hybridization (FISH) analysis, as examined by Sugita et al., simplified confirmation of a histopathological diagnosis.4 Thus, this morphologically definite soft tissue tumour category was confirmed from a genetic standpoint. On the other hand, the morphological profile of AFST remained to be sufficiently examined. We thus reviewed previous specimens and investigated the morphological spectrum of AFST.

Materials and methods MATERIALS

This study was conducted according to the principles embodied in the Declaration of Helsinki. The study was also approved by the Ethics Committee of Kyushu University (Nos. 25-111 and 25-143). Thirteen previously diagnosed AFSTs were retrieved from the soft tissue tumours registered in the files of the Department of Anatomic Pathology, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan. AFSTs were diagnosed according to their architecture, in particular the characteristic features such as spindle-shaped or stellate-shaped bland tumour cells, a fibromyxoid background, and a delicate vascular network.1 Thirty-six unclassified benign fibrous tumours and 232 solitary fibrous tumours (SFTs)/ haemangiopericytomas (HPCs) were reviewed; none

of the unclassified fibrous tumours and six of the SFTs/HPCs were picked up as AFST-suspicious cases. One of the six cases was ruled out by strong STAT6 positivity. Finally, five AFSTs were retrieved, and they were added to eight recently diagnosed AFSTs. As a result, 13 cases were rediagnosed as ASFTs. IMMUNOHISTOCHEMISTRY

Immunohistochemical staining was performed for the available cases. Formalin-fixed, paraffin-embedded tissue was sectioned at a thickness of 3 lm. The primary antibodies, their dilutions and the antigen retrieval methods are summarized in Table 1. The immune complex was detected with the Dako (Glostrup, Denmark) EnVision Detection System. The intensity of STAT6 staining was evaluated in comparison with that of NAB2–STAT6-positive conventional SFT. REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION (RT-PCR) AND DIRECT SEQUENCING

RT-PCR was performed for all 13 cases. Total RNA was extracted from frozen or paraffin samples with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and was reverse-transcribed with Superscript III reverse transcriptase (Invitrogen) to prepare the first-strand complementary DNA. AHRR–NCOA2, NCOA2–AHRR and GFT2I–NCOA2 fusion assays were performed with newly designed primers (Table 2) that specifically amplify the fusion gene transcripts. Each polymerase chain reaction (PCR) product (5 ll) was loaded onto 2% agarose gel with ethidium bromide, and visualized under ultraviolet illumination. The PCR products were also evaluated by direct sequence analysis with the Big-Dye terminator method (version 1.1; Applied Biosystems, Foster City, CA, USA) to confirm the breakpoints of the fusion transcripts. FISH

To assay the rearrangement of NCOA2, split dualcolour FISH was performed for all 13 cases with © 2016 John Wiley & Sons Ltd, Histopathology

Morphology and immunohistochemistry of AFST 3

Table 1. Immunohistochemical antibodies Antibody

Antigen

Source

Clone

Dilution

CD34

CD34

Leica, Newcastle upon Tyne, UK

QBEnd/10

1:50

STAT6

STAT6

Santa Cruz, Delaware, CA, USA

Polyclonal

1:1000

AE1/AE3

Pan-keratin

Thermo Scientific, San Jose, CA, USA

AE1/AE3

1:1000

MIB-1

Ki67

Dako, Glostrup, Denmark

MIB-1

1:100

Desmin

Desmin

Dako, Glostrup, Denmark

D33

1:100

a-Smooth muscle antibody

a-Smooth muscle actin

Sigma-Aldrich, Louis, MO, USA

1A4

1:5000

S100

S100

Dako, Glostrup, Denmark

Polyclonal

1:400

HHF35

Muscle-specific actin

Enzo, Farmingdale, NY, USA

HHF35

1:50

D2-40

Podoplanin

Nichirei, Hiroshima, Japan

D2-40

Prediluted

EMA

EMA

Dako, Glostrup, Denmark

E29

1:400

ER

ERa

Dako, Glostrup, Denmark

EP1

Prediluted

PgR

PgR

Dako, Glostrup, Denmark

PgR 636

Prediluted

CD68

CD68

Dako, Glostrup, Denmark

KP1

1:300

CD163

CD163

Leica, Newcastle upon Tyne, UK

10D6

1:100

CDK4

CDK4

Invitrogen, Carlsbad, CA, USA

DCS-31

1:100

MDM2

MDM2

Leica, Newcastle upon Tyne, UK

1B10

1:10

EMA, epithelial membrane antigen; ER, oestrogen receptor; PgR, progesterone receptor.

Table 2. Primer list

Results

Gene

Forward/ reverse Exon Primer

AHRR

Forward

9

AHRR

Reverse

10

gttccgattcgcacagactg

NM_020731.4

AHRR

Reverse

11

tctgttccctgagcaccaaa

NM_020731.4

NCOA2 Forward

13

gtccctactcagtgatacct

NM_006540.2

NCOA2 Forward

15

tccaaatcagactgccccat

NM_006540.2

NCOA2 Reverse

14

aacagtgcttctcggcctac

NM_006540.2

NCOA2 Reverse

16

gctgagtctccgagtgatga

NM_006540.2

Source

caaaacccagagcagacacc NM_020731.4

ready-made FISH probes (GSP Laboratories, Kawasaki, Japan). Paraffin-embedded tissue was sectioned at a thickness of 3 lm. Fifty nuclei were counted to estimate the proportion of tumour cells with NCOA2 rearrangement. A split signal was defined as one in which the distance between the orange and green signals was at least twice the estimated signal diameter, according to a previous report.4 © 2016 John Wiley & Sons Ltd, Histopathology

CLINICOPATHOLOGICAL AND HISTOPATHOLOGICAL FINDINGS

The clinicopathological data of the presented cases are shown in Table 3. Ten of the 13 cases were from the lower extremities, two were from the trunk, and one was from the upper extremity. Grossly, all of the tumours showed well-demarcated nodular lesions and a white to grey glittering cut surface. Two cases showed a multinodular structure and a nodule-innodule structure (Figure 1). Representative histological findings are shown in Figure 2. Histopathologically, all 13 tumours contained typical AFST areas, at least focally. The typical AFST areas were composed of spindle-shaped, stellate-shaped or ovalshaped tumour cells with bland nuclei embedded in fibromyxoid stroma (Figure 2A) accompanied by branching and slit-like blood vessels (Figure 2B), focal lymphocytic infiltration, and scattered mast cells. Other histological findings were as follows: as previously known findings, staghorn-like branching vessels

4 Y. Yamada et al.

Table 3. Clinicopathological data Case no.

Age (years)/sex

Site

Size (mm)

Initial diagnosis

Course

Unreported findings

1

38/F

Thigh, right



Haemangiopericytoma

Unknown

Typical area only

2

28/M

Lower leg, left

60

Haemangiopericytoma, suggestive

Incomplete resection, recurrence after 8 years

Typical area only

3

60/M

Knee, left

30

Solitary fibrous tumour, suggestive

Unknown

Aggregate of foamy histiocytes

4

54/F

Thigh, left

100

Solitary fibrous tumour, suggestive

NED 18 months

Amianthoid fibres and osteoid-like collagen

5

63/F

Thigh, right

90

Angiofibroma of soft tissue

Unknown

Nodule-in-nodule structure, cystic degeneration

6

58/M

Thigh, left

20

Angiofibroma of soft tissue

Unknown

Typical area only

7

46/F

Knee, right

36

Angiofibroma of soft tissue

Unknown

Prominently fibrous stroma

8

30/M

Back, right

66

Angiofibroma of soft tissue

No follow-up

Prominently fibrous stroma

9

70/F

Abdominal wall, right

55

Angiofibroma of soft tissue

NED 4 months

Nodule-in-nodule structure, cystic degeneration

10

52/F

Knee, right

70

Haemangiopericytoma

Unknown

Typical area only

11

60/M

Thigh, right

36

Angiofibroma of soft tissue

Unknown

Typical area only

12

38/M

Lower leg, right

80

Angiofibroma of soft tissue, compatible

Unknown

Typical area only

13

54/M

Lower leg

Angiofibroma of soft tissue

Unknown

Typical area only



F, female; M, male; NED, no evidence of disease.

(11 of 13 cases) (Figure 2C), fibrous septa (two of 13 cases) (Figure 2D), multinodular structure (two of 13 cases) (Figure 2E), haemorrhage (eight of 13 cases) (Figure 2F), fibrinous deposition in vascular walls (three of 13 cases) (Figure 2G), perivascular hyalinization (six of 13 cases), lymphoid follicles (one of 13 cases) (Figure 2H), lymphoid cuff (three of 13 cases), multinucleated tumour giant cells (eight of 13 cases) (Figure 2I), focal nuclear atypia (six of 13 cases) (Figure 2I), incomplete fibrous capsule (10 of 13 cases), haemosiderin deposition (three of 13 cases), stromal hyalinization (nine of 13 cases), and necrosis (one of 13 cases); as unreported findings, aggregates of foamy histiocytes (one of 13 cases) (Figure 2J), dense fibrous stroma (two of 13 cases) (Figure 2K), amianthoid fibres (one of 13 cases) (Figure 2L), osteoidlike collagenous tissue (one of 13 cases) (Figure 2M), cystic change (two of 13 cases), and extravasation of red blood cells (10 of 13 cases) (Figure 2N). Calcification, neutrophilic or eosinophilic infiltration, highgrade nuclear atypia, mitosis and vascular invasion were not observed in any of the cases. Two cases were wholly composed of spindle-shaped tumour cells

and dense collagenous stroma, which can be called a prominent fibrous variant of AFST. IMMUNOHISTOCHEMISTRY

Representative images of immunohistochemical staining are shown in Figure 3. The results were as follows: epithelial membrane antigen (EMA), four of 13 cases (30%); desmin, six of 13 cases (46%); oestrogen receptor (ER), 13 of 13 cases (100%); progesterone receptor, three of 13 cases (23%); CD68, seven of 13 cases (53%); CD163, 13 of 13 cases (100%); CDK4, none of 13 cases (0%); MDM2, none of 13 cases (0%); STAT6, one of 13 cases (7%); CD34, none of 13 cases (0%); a-smooth muscle actin, none of 12 cases (0%); muscle-specific actin, none of 10 cases (0%); D2-40, four of nine cases (44%); and AE1/AE3, none of 13 cases (0%). STAT6 positivity was focally and weakly observed in the tumour cell nuclei. The MIB-1 labelling index was 1–6% (average, 3%; median, 3%). Desmin, EMA, CD68 and CD163 highlighted the dendritic-shaped histiocytic cells. © 2016 John Wiley & Sons Ltd, Histopathology

Morphology and immunohistochemistry of AFST 5

examined, eight had AHRR–NCOA2 fusion genes (Figure 4A). NCOA2–AHRR was also detected in two cases. In case 4, the tumour showed an insertion of an intron sequence of NCOA2 (Figure 4B). GTF2I– NCOA2 fusion transcripts were not detected in any cases. As a result, eight cases had the specific fusion gene AHRR–NCOA2. FISH

A

The results of FISH analysis are shown in Table 4 and Figure 5. Nine of all 13 cases were NCOA2 rearrangement-positive, two were negative, and two failed to give results. In detail, split signals of NCOA2 FISH were observed in nine of the 11 cases, and the counts of split signals were 4–12 per 50 tumour cell nuclei. The split signals tended to be detected in relatively large spindle-shaped nuclei, probably representing nuclei of the genuine tumour cells. No split signal was detected in two cases, and no fluorescent probe signal was detected in another two cases.

Discussion

B

C Figure 1. The gross appearance of a cut surface. The tumours showed the following features: A, a white to yellowish fibrous cut surface with a well-demarcated border in case 8; B, multinodular and myxomatous features in case 9; C, a nodule-in-nodule structure in case 5.

RT-PCR AND DIRECT SEQUENCING

The results of RT-PCR and direct sequencing are shown in Figure 4 and Table 4. Of the 13 tumours © 2016 John Wiley & Sons Ltd, Histopathology

Recent genetic information on soft tissue tumours has resulted in multiple examples of the integration of two or more different histological tumour categories, such as low-grade fibromyxoid sarcoma and sclerosing epithelioid fibrosarcoma,5 SFT and HPC,6 spindle cell/pleomorphic lipoma, cellular angiofibroma and mammary-type myofibroblastoma,7 and haemosiderotic fibrolipomatous tumour and myxoinflammatory fibroblastic sarcoma.8 Moreover, inflammatory or degenerative findings, e.g. chronic inflammatory infiltration, aggregates of histiocytes, fibrinous deposition, and fibrosis, are recognized as characteristic histological features in certain types of soft tissue tumour, such as nodular fasciitis, inflammatory myofibroblastic tumour, myxoinflammatory fibroblastic sarcoma, and schwannoma; however, they are not generally common features in benign soft tissue tumours, except for those resulting from external factors. In this study, we have revealed some unknown pathological features of AFSTs, such as osteoid-like collagen, aggregates of foamy histiocytes, prominent fibrous stroma, and nodule-innodule structure. In particular, the predominant fibrous variant of AFST may have been classified previously among other fibrous tumours, if genetic testing was not performed. AFST has been reported to possess the NCOA2– AHRR/AHRR–NCOA2 and GTF2I–NCOA2 fusion

6 Y. Yamada et al.

A

B

C

D

E

F

genes, and both AHRR–NCOA2 and NCOA2–AHRR were detected in our cases as well as in a previous report.2,3 Probably, the driver gene is NCOA2, and NCOA2–AHRR can merely be detected secondarily, owing to an adequate amount of the transcript product of the gene. In this study, NCOA2 rearrangement was detected in almost all cases by FISH, but in only a small population of tumour cells. The proportion of tumour cells with NCOA2 split signals was previously reported to be 16–36%.4 However, the smaller number of NCOA2 rearrangement-positive cells in this study suggests that the proportion of true neoplastic cells in AFST is lower than in the previous report. In contrast, RT-PCR and direct sequencing can clearly demonstrate the existence of fusion genes, but only in approximately two-thirds of cases. NCOA2 FISH would be a sensitive method for detecting AFST, and RT-PCR/direct sequencing could be a specific one. Thus, these complementary methods should be used in the diagnosis of AFST. The detectability of AHRR–NCOA2 in RT-PCR was apparently not associ-

Figure 2. The variety of histological findings were as follows: spindle or stellateshaped cells (A, case 1), slitlike branching vessels (B, case 1), haemangiopericytomatous vessels (C, case 9), fibrous septa (D, case 1), multinodular structure (E, case 9), haemorrhage (F, case 9), fibrinous deposition (G, case 5), lymphoid follicle (H, case 4), nuclear atypia/ multinucleated tumour giant cells (I, case 6), foamy histiocytes (J, case 3), dense fibrous stroma (K, case 8), amianthoid fibres (L, case 4), osteoid-like collagenous tissue (M, case 4), and extravasation of red blood cells (N, case 1).

ated with a positive ratio of NCOA2 rearrangement in the tumours. Two cases without NCOA2 rearrangement possessed typical histopathological findings of AFST, suggesting a genetic aberration other than the NCOA2-associated fusion genes. AFSTs were only recently recognized, and thus must have historically been diagnosed as other entities, such as SFTs, HPCs, or unclassified benign fibrous tumours. We reviewed the registered cases and retrieved tumours that had AFST morphology and that were originally diagnosed as SFTs or HPCs. Our cases showed the previously reported morphological features such as spindle-shaped or stellate-shaped tumour cells, fibromyxoid stroma, slit-like vessels, a haemangiopericytomatous vascular pattern, fibrinous deposition in the vascular walls, and inflammatory infiltration in a majority of the cases.1 Moreover, extravasation of red blood cells, one of the characteristic histological features of AFST observed in a majority of the cases, can also be considered to be a new histological diagnostic clue. © 2016 John Wiley & Sons Ltd, Histopathology

Morphology and immunohistochemistry of AFST 7

G

H

I

J

K

L

M

N

Figure 2. continued

A majority of the cases had a myxoid background, and some cases showed fibrinous or fibrous change. From the standpoint of general pathology, fibrous change may follow inflammatory change and a fibrinous exudate, which could explain the morphological spectrum of AFST. Predominantly fibrous cases may be included in this spectrum. Extravasation of red blood cells may also be one of the results of an inflammatory course. The pattern of gene fusion had no definite effect on the above histology in this study. Various immunohistochemical markers have been previously reported, such as EMA, desmin, and histio© 2016 John Wiley & Sons Ltd, Histopathology

cytic markers,1,9 but thus far these have served as only a guide. Histiocytic markers (CD68 and CD163) and ER are expressed in various soft tissue tumours;10 however, the coexistence of histiocytic marker-positive cells and ER-positive cells in the same tumour is not a well-known finding. In this study, ER and CD163 were demonstrated to be useful markers of AFST, but it was unclear whether the histiocytic marker-positive cells were genuine neoplastic cells or not. The differentiation of AFST can be considered to be fibrohistiocytic. On the other hand, one case weakly positive for STAT6 would raise a diagnostic

8 Y. Yamada et al.

Figure 3. The immunohistochemical results were as follows: A, membranous epithelial membrane antigen positivity (case 6); B, cytoplasmic desmin positivity (case 8); C, membranous and cytoplasmic D2-40 positivity (case 4); D, nuclear STAT6 positivity (case 2); E, membranous and cytoplasmic CD68 positivity (case 5); F, membranous and cytoplasmic CD163 positivity (case 5); G, nuclear oestrogen receptor positivity (case 1).

pitfall. STAT6 immunostaining is a useful diagnostic marker of SFT, and SFT is one of the important histological mimics of AFST. Moreover, SFT occasionally shows weak positivity for STAT6.11 If SFT-like AFST showed weak positivity for STAT6, the differential diagnosis would be difficult with only histological and immunohistochemical examination. The differential diagnosis of AFST ranges from SFT to dedifferentiated liposarcoma to other angiofibromatous tumours, but the first two tumours constitute

the major consideration, because of their distinct histologies, excluding special variants. With this in mind, the review revealed that the frequency of AFSTs was approximately 1/20th that of SFT, although it was limited to typical cases of AFST. In conclusion, we have revealed the broad morphological spectrum of AFST and the expression of ER and CD163 immunostaining. AFST potentially features in the differential diagnosis of various tumours, and should be ruled out by genetic methods. © 2016 John Wiley & Sons Ltd, Histopathology

Morphology and immunohistochemistry of AFST 9

A

AHRRex10

NCOA2ex14

+16bp insertion

AHRRex9

B

NCOA2ex14 Figure 4. The results of reverse transcription polymerase chain reaction and direct sequencing. A, Case 2. B, Case 4. The conspicuous bands of the AHRR–NCOA2 transcript product are highlighted by ultraviolet illumination, and direct sequencing confirmed them. Insertion of an intron sequence was detected in case 4.

Table 4. The results of genetic analysis Case no.

AHRR–NCOA2



1 2

NCOA2–AHRR

AHRR exon 10–NCOA2 exon 14

3

NCOA2–GTF2I

PGK

NCOA2 FISH count

+

12/50

+

11/50

+

8/50

4

AHRR exon 9–insertion–NCOA2 exon 14

+

6/50

5

AHRR exon 10–NCOA2 exon 14

+

NA

6

AHRR exon 9–NCOA2 exon 16

+

7/50

7

AHRR exon 9–NCOA2 exon 16

+

6/50

8

AHRR exon 10–NCOA2 exon 14

+

6/50

© 2016 John Wiley & Sons Ltd, Histopathology

NCOA2 exon 15–AHRR exon 10

10

Y. Yamada et al.

Table 4. (Continued) AHRR–NCOA2

NCOA2–AHRR

NCOA2–GTF2I

PGK

NCOA2 FISH count

+

5/50

+

NA

+

4/50

12

+

0/50

13

+

0/50

Case no. 9

AHRR exon 10–NCOA2 exon 14

10 11

AHRR exon 9–NCOA2 exon 16

NCOA2 exon 15–AHRR exon 10

FISH, fluorescence in-situ hybridization; NA, not available; PGK, phosphoglycerate kinase.

gave final approval of the manuscript. All authors critically reviewed and approved the manuscript.

Conflicts of interest The authors state that they have no conflicts of interest.

References

Figure 5. The result of fluorescence in-situ hybridization (FISH) in case 1. FISH revealed the split signals of NCOA2 in approximately 10–20% of tumour cells.

Acknowledgements Technical support for the experimental trials was provided by the laboratory assistants N. Tateishi, M. Tomita, M. Nakamizo, K. Matsuda, H. Matsumoto, and N. Aoki. We also appreciate the technical assistance of the Research Support Centre, Kyushu University Graduate School of Medical Sciences.

Author contributions Y. Yamada performed the research and wrote the paper. K. Kohashi, T. Ishii, K. Iura, A. Maekawa, H. Bekki, H. Otsuka and K. Yamashita contributed to the research design and slide review. H. Tanaka, T. Hiraki, M. Mukai, A. Shirakawa, Y. Shinnou, M. Jinno, H. Yanai, K. Taguchi, Y. Maehara and Y. Iwamoto contributed to the sample collection and research design. Y. Oda designed the research and

1. Mari~ no-Enrıquez A, Fletcher CD. Angiofibroma of soft tissue: clinicopathologic characterization of a distinctive benign fibrovascular neoplasm in a series of 37 cases. Am. J. Surg. Pathol. 2012; 36; 500–508. 2. Jin Y, M€ oller E, Nord KH et al. Fusion of the AHRR and NCOA2 genes through a recurrent translocation t(5;8)(p15; q13) in soft tissue angiofibroma results in upregulation of aryl hydrocarbon receptor target genes. Genes Chromosom. Cancer 2012; 51; 510–520. 3. Arbajian E, Magnusson L, Mertens F, Domanski HA, Vult von Steyern F, Nord KH. A novel GTF2I/NCOA2 fusion gene emphasizes the role of NCOA2 in soft tissue angiofibroma development. Genes Chromosom. Cancer 2013; 52; 330–331. 4. Sugita S, Aoyama T, Kondo K et al. Diagnostic utility of NCOA2 fluorescence in situ hybridization and Stat6 immunohistochemistry staining for soft tissue angiofibroma and morphologically similar fibrovascular tumors. Hum. Pathol. 2014; 45; 1588–1596. 5. Prieto-Granada C, Zhang L, Chen HW et al. A genetic dichotomy between pure sclerosing epithelioid fibrosarcoma (SEF) and hybrid SEF/low-grade fibromyxoid sarcoma: a pathologic and molecular study of 18 cases. Genes Chromosom. Cancer 2015; 54; 28–38. 6. Barthelmeß S, Geddert H, Boltze C et al. Solitary fibrous tumors/hemangiopericytomas with different variants of the NAB2–STAT6 gene fusion are characterized by specific histomorphology and distinct clinicopathological features. Am. J. Pathol. 2014; 184; 1209–1218. 7. Flucke U, van Krieken JH, Mentzel T. Cellular angiofibroma: analysis of 25 cases emphasizing its relationship to spindle cell lipoma and mammary-type myofibroblastoma. Mod. Pathol. 2011; 24; 82–89. 8. Antonescu CR, Zhang L, Nielsen GP, Rosenberg AE, Dal Cin P, Fletcher CD. Consistent t(1;10) with rearrangements of © 2016 John Wiley & Sons Ltd, Histopathology

Morphology and immunohistochemistry of AFST

TGFBR3 and MGEA5 in both myxoinflammatory fibroblastic sarcoma and hemosiderotic fibrolipomatous tumor. Genes Chromosom. Cancer 2011; 50; 757–764. 9. Fukuda Y, Motoi T, Kato I et al. Angiofibroma of soft tissue with fibrohistiocytic features and intratumor genetic heterogeneity of NCOA2 gene rearrangement revealed by chromogenic in situ hybridization: a case report. Pathol. Int. 2014; 64; 237–242.

© 2016 John Wiley & Sons Ltd, Histopathology

11

10. Li XQ, Hisaoka M, Hashimoto H. Expression of estrogen receptors alpha and beta in soft tissue sarcomas: immunohistochemical and molecular analysis. Pathol. Int. 2003; 53; 671–679. 11. Doyle LA, Vivero M, Fletcher CD, Mertens F, Hornick JL. Nuclear expression of STAT6 distinguishes solitary fibrous tumor from histologic mimics. Mod. Pathol. 2014; 27; 390– 395.

Histological spectrum of angiofibroma of soft tissue: histological and genetic analysis of 13 cases.

Angiofibroma of soft tissue (AFST) is a rare soft tissue neoplasm characterized by a fibroblastic cytomorphology and a prominent vascular structure. A...
565B Sizes 0 Downloads 7 Views

Recommend Documents


Grading of soft tissue sarcomas: from histological to molecular assessment.
Several histological grading systems for soft tissue sarcomas have been described since the early 1980s. Their main objective is to select patients for adjuvant chemotherapy. Two histological grading systems are used in daily practice, the National C

Angiofibroma of soft tissue: clinicopathologic study of 2 cases of a recently characterized benign soft tissue tumor.
Angiofibroma of soft tissue is a very recently characterized, histologically distinctive benign mesenchymal neoplasm of unknown cellular origin composed of 2 principal components, the spindle cell component and very prominent stromal vasculatures. It

Histological and Mathematical Analysis of the Irreversibly Electroporated Liver Tissue.
Irreversible electroporation has clinically been used to treat various types of cancer. A plan on how to apply irreversible electroporation before practicing is very important to increase the ablation area and reduce the side effects. Several electri

Histological spectrum of cutaneous herpes infections.
Herpes simplex virus and varicella zoster virus are double-stranded DNA viruses that commonly infect humans, resulting in cutaneous manifestations. Diagnosis is generally made based on clinical findings; however, when the presentation is atypical, bi

Histological Features and Biocompatibility of Bone and Soft Tissue Substitutes in the Atrophic Alveolar Ridge Reconstruction.
The reconstruction of the atrophic alveolar ridges for implant placement is today a common procedure in dentistry daily practice. The surgical reconstruction provides for the optimization of the supporting bone for the implants and a restoration of t

Mitochondrial DNA Rearrangement Spectrum in Brain Tissue of Alzheimer's Disease: Analysis of 13 Cases.
Mitochondrial dysfunction may play a central role in the pathologic process of Alzheimer's disease (AD), but there is still a scarcity of data that directly links the pathology of AD with the alteration of mitochondrial DNA. This study aimed to provi

histological characteristics in diabetic and non-diabetic plantar soft tissue.
Diabetes, and the subsequent complication of lower limb ulcers leading to potential amputation, remains an important health care problem in United States, even with declining amputation rates. It has been well documented that diabetes can alter the m

[Histological and molecular analysis of brain metastases].
The first step in the diagnosis of a metastatic brain lesion is to exclude a primary central nervous sytem tumour, followed by verification or identification of the primary tumor site, in order to guide the clinician to specific therapy. In addition

Phosphaturic mesenchymal tumour mixed connective tissue variant: report of three cases with unusual histological findings.
Phosphaturic mesenchymal tumour mixed connective tissue variant (PMTMCT) is a rare tumour occurring in bone and soft tissue that usually behaves in a benign manner. Elaboration of biologically active substances by this tumour gives rise to a paraneop