Mol Neurobiol DOI 10.1007/s12035-015-9127-0
HIN-1: a New Epigenetic Biomarker Crucial for Therapy Selection in Glioblastoma Multiforme M. Herranz & M. E. Padín-Iruegas & Nieves Martínez-Lago & S. Aguín Losada & P. Raña-Díez & E. Brozos Vázquez & J. J. Carrera & J. R. Antúnez & A. Ruibal & R. López-López
Received: 19 May 2014 / Accepted: 22 February 2015 # Springer Science+Business Media New York 2015
Abstract Glioblastoma multiforme (GBM) is the most common brain tumor in adults. The role of high in normal-1 (HIN1) as a potential biomarker in combating this disease is being described for the first time in this study. A combination of O6methylguanine DNA methyltransferase (MGMT) and HIN-1 methylation could be a possible biomarker in therapy choice. Interestingly, survival data shows a similar trend for the methylation of MGMT and for unmethylation of HIN-1 and vice versa. Eighty-eight paraffin-embedded brain tumors were analyzed to screen methylation rates of different genes and evaluate the association between genes methylation and clinicopathologic variables. Our study is the first of its kind to indicate that MGMT and HIN-1 methylation status are inverted (97.7 % of methylated ones) and could be new markers in the study of GBM prognosis, especially in the therapy selection. Keywords Glioblastoma . Epigenetics . HIN1 . Outcome . Therapy M. Herranz and M. E. Padín-Iruegas contributed equally to this work. M. Herranz (*) : A. Ruibal Nuclear Medicine Department, Molecular Imaging Program, IDIS, USC, Hospital Clínico Universitario. Fundación Tejerina, Santiago de Compostela, Spain e-mail: [email protected] M. E. Padín-Iruegas Department of Functional Biology and Health Sciences, Human Anatomy and Embryology Section, University of Vigo, Vigo, Pontevedra, Spain N. Martínez-Lago : S. A. Losada : P. Raña-Díez : E. B. Vázquez : R. López-López Medical Oncology Department, Hospital Clínico Universitario, Santiago de Compostela, Spain J. J. Carrera : J. R. Antúnez Pathology Department, Hospital Clínico Universitario, Santiago de Compostela, Spain
Background Glioblastoma multiforme (GBM) is the most frequent and most aggressive malignant primary brain tumor in adults. GBM accounts for 12 to 15 % of all intracranial tumors and 50 to 60 % of astrocytic tumors. It primarily occurs in adults between the ages of 45 and 70 years. Classified as a grade IV astrocytoma, GBM develops from the lineage of star-shaped glial cells called astrocytes that support nerve cells. The number of new diagnoses made annually is 2 to 3 per 100,000 people in the USA and Europe. Median survival rate of ~15 monthsand 5 years means a survival rate of ~4 %. Standard treatment is surgery, combined with radio and chemotherapy. GBM’s capacity to wildly invade and infiltrate normal surrounding brain tissue makes complete resection impossible. After surgery, radiation therapy is used to kill leftover tumor cells and prevent recurrence of their growth. Gene promoter methylation is the best characterized epigenetic event of tumoral cells and is found virtually in all types of human neoplasm associated with inappropriate transcriptional silencing gene [1, 2]. This hypermethylation is, at least, as frequent as mutations or deletions in classical tumor suppressor genes. Genes involved, among others, in cell cycle regulation, DNA repair, drug resistance, differentiation, apoptosis, angiogenesis, metastasis, and invasion are pathologically silenced by methylation [3]. O6-Methylguanine DNA methyltransferase (MGMT) repairs the mutagenic and cytotoxic O6-alkylguanine lesions produced by environmental carcinogens and chemotherapeutic nitrosoureas. MGMT carries out direct repair of alkylated DNA by transferring the alkyl group from oxygen atoms within the DNA molecule to a cysteine residue on the enzyme. This reaction is irreversible. Tumors with inactivation of MGMT gene are predisposed to mutation of tumor suppressor genes.
Mol Neurobiol
Epigenetic silencing of the MGMT gene has been identified as a strong and independent predictive factor of treatment response for GBM patients undergoing chemotherapy with alkylating agents [4, 5]; determination of the promoter methylation status may thus serve as a Bchemosensitivity sensor^ in glioma patients. Hegi’s group concluded that patients with glioblastoma and a promoter-methylated MGMT gene benefited from treatment with temozolomide [6]. HIN-1 known as secretoglobin, family 3A, member 1 (SCGB3A1) expression is significantly downregulated in 94 % of human breast carcinomas and in 95 % of preinvasive lesions, such as ductal and lobular carcinoma in situ [7]. Function: potential growth inhibitory cytokine. Subcellular location: secreted. Tissue specificity: highly expressed in breast tissues. Absent in breast cancer cell lines. Sequence similarities: belongs to the secretoglobin family, UGRP subfamily. High in normal-1 (HIN-1) is highly expressed in normal luminal mammary epithelial cells but lost in the majority of breast cancers. Restoration of HIN-1 expression suppressed growth of breast cancer cells [8]. HIN-1 can also regulate cell cycle reentry, suppress tumor cell migration and invasion, and induce apoptosis in breast cancer cell lines [8]. Although HIN-1 processes the putative tumor suppressor function, no somatically genetic changes of HIN-1 gene are found in breast cancer. Previous studies demonstrated frequent methylation of HIN-1 gene promoter in breast cancer, prostate cancer, malignant mesotheliomas, non-small cell lung cancer, lymphoma, retinoblastoma, Wilms’ tumor, and rhabdomyosarcomas [8–12]. HIN-1 is a potent inhibitor of cell growth, migration, and invasion. Expression of HIN-1 in synchronized cells inhibits cell cycle reentry and retinoblastoma protein (Rb) phosphorylation whereas in exponentially growing cells; HIN-1 induces apoptosis without apparent cell cycle arrest and effect on Rb. Investigation of multiple signaling pathways revealed that mitogen-induced phosphorylation and activation of AKT are inhibited in HIN-1-expressing cells. These studies provide evidence that HIN-1 tumor suppressor functions may be mediated through AKT pathway [13]. In this study, we focus on the identification of new methylated genes implicated and related in GBM.
Material and Methods Tumor Samples GBM tumors were collected following the ethics’ guidelines of human specimens at University Hospital Complex in Santiago de Compostela, Spain. Eighty-eight paraffin-embedded brain tumors, including paired normal tissue, were analyzed to screen methylation rates and evaluate association between genes methylation and clinicopathologic variables. The
study was approved by Clinical Research Ethics Committee of Galicia (Spanish region where the study was done and name of the hospital is attached, code 2011/153). The committee realized that being a retrospective study obtaining consent was difficult for the expected median survival for this pathology; therefore, it was decided that it would be accepted if the principal investigator guarantees the confidentiality of the data and verifies that each participant of the study had not indicated or expressed objection to such use of his or her samples. Tumor samples were obtained from the Biobank of Santiago (Hospital Clínico Santiago, SERGAS). Tumors came from patients’ biopsies used for the diagnosis by surgical procedures. Samples were in paraffin-embedded blocks. Biobank provided us three cuts of 14 μM. After DNA was obtained, it was stored at −80 °C. DNA Samples Genomic DNAs from paired normal and tumor brain samples were obtained. Genomic DNA from human normal brain was used as a control for unmethylated DNA and the Cp Genome Universal Methylated DNA (Chemicon) for methylated DNA. Distribution of Aberrant Promoter Methylation Methylation-specific polymerase chain reaction (MSP) was carried out following Herman et al. method [1]. DNA was extracted using the QIAmp DNA Mini Kit (Qiagen GmbH, Hilden, Germany) and modified using EZ DNA Methylation Kit (Zymo Research) and by standard procedures with sodium bisulphite. Primers for MGMT were selected from Yutaka et al. [9]. Two pairs of primers for HIN-1 were selected, one from Krop et al. [14] and the other was designed in our laboratory as follows: Fragments of the human promoter (http:// rulai.cshl.edu/cgi-bin/TRED/tred.cgi?process=home=) of HIN-1 gene, containing the transcription start site, was selected from the NCBI database (http://ncbi.nlm.nih.gov/). These sequences were analyzed with the CpGPLOT software program (http://bioinfo.hku.hk/cgi-bin/), and primers were designed using primer 3 software (http://frodo.wi.mit.edu). DNA methylation patterns in the CpG islands of those genes were determined by PCR of chemical modification of unmethylated, but not methylated DNA samples, and subsequent polymerase chain reaction using specific primers [15, 16]. Controls for non-methylated DNA (amygdale), methylated DNA (IVD), and DNA contamination (water) were performed for each set of polymerase chain reaction. Amplifications were carried out in a 25-μl volume: 200 μM each of dATP, dCTP, dGTP, and dTTP; 0.2 μm each of forward and reverse primers; 10 mm Tris (pH 8.4); 50 mm KCl; 1.5 mm MgCl2; and 0.5 U of Taq polymerase (Invitrogen). Cycling: 10 min at 95 °C; 35 cycles of 30 s at 95 °C, 45 s at 57 °C for HIN-1 (own primers: MF-GGTACGGGTTTTTTACGGTT CGTC, MR-AACTTCTTATACCCGATCCTCG, UF-GGTA
Mol Neurobiol
TGGGTTTTTTATGGTTTGTT, UR-CAAAACTTCTTATA CCCAATCCTCA; Krop et al. primers: MF-GTTTAGTTTT GAGGGGGGCGC, MR-AACTTCCTACTACGACCGACG, UF-ATTGTAAAGTGAAGGTGTGGGTT, UR-CCAACTTC CTACTACAACCAACA) and one cycle of 10 min at 95 °C; 40 cycles of 1 min at 95 °C, 1 min at 55 °C for MGMT (Yutaka et al. primers, MF-GGTCGTTTGTACGTTCGC, MR-GACC GATACAAACCGAACG, UF-GTAGGTTGTTTGTATGTT TGT, UR-AACCAATACAAACCAAACA), and 1 min at 72 °C; and a final step at 72 °C for 10 min. PCR products were separated in 8–12 % nondenaturing acrylamide-Tris-HCl (pH 8.8)-buffered gels or 2 % agarose gels, stained with ethidium bromide and visualized under UV illumination.
Results We checked methylation status of different cellular genes: p16, cyclin D2, GSTP1, RASSF1A (Fig. 1a), MGMT, and HIN-1 in GBM. Patients’ characteristics are shown in Table 1. Age median was 65, ranging between 32–84. Percentages: 53.4 for men and 46.6 for women. Frequency of tumoral MGMT promoter methylation was 42.04 % (Fig. 1). A median survival day was 224 for methylated and 150 for patients with unmethylated gene (Table 1). Median survival was higher in the combined therapy group among those with methylated MGMT. Kaplan-Meyer survival analysis (Fig. 2) indicates that patients with methylated MGMT gene still have less progression with time, instead of those with no methylated gene. In the same group, 38 % of patients survive more than 15 months. HIN-1 promoter methylation was 31 % (Fig. 1). Interestingly, in almost all cases, methylated HIN-1 corresponds and coincides
Fig. 1 Genes’ methylation results in glioblastoma samples. a Methylation-specific PCR (MSP) gel examples for p16, cyclin D2, Ecadherin, RASSF1A, GSTP1, and RARb2 promoters. b MSP examples for MGMT and HIN-1 promoters. c Methylation profiles and percentages. Black box for methylated promoter, white box for
Table 1
Patients’ characteristics and statistical analysis
Patients’ characteristics Age: median (range) Male Female MGMT promoter methylation Survival days: median (range) MGMT promoter unmethylation Survival days: median (range) HIN-1 promoter methylation Survival days: median (range) HIN-1 promoter unmethylation Survival days: median (range) Unmethylated promoters Survival days: median (range)
65 (32–84) 53.4 % 46.6 % 42 % 224 (13–4075) 58 % 150 (10–5015) 31 % 170 (10–455) 69 % 210 (13–5015) 27 % 150 (17–5015)
with unmethylated for MGMT gene; only two cases (2.2 %) have methylation in both promoters. Unmethylated HIN-1 promoter survival median was 210 days. Twenty-seven percent of the patients had unmethylated gene promoter for MGMT and HIN-1. Median survival days were 150, with a range 17–5015 (Table 1). Curiously, survival time in patients with methylated MGMT almost overlaps with survival time when HIN-1 is unmethylated and vice versa suggesting a complementary effect (Fig. 2).
Discussion Our study analyzes methylation of MGMT promoter and, for the first time, status of promoter methylation of HIN-1 in GBM, checking possible synergies or complementarities
unmethylated one. Samples from glioblastoma multiforme (GBM#); normal brain (N.B.) as negative control for methylation; in vitro DNA (IVD) as positive control for methylation and H2O as contamination control
Mol Neurobiol Fig. 2 Survival curve. Differences in survival time in patients with only radiotherapy (RT), and with a combination of chemo- and radiotherapy related with the methylation status of promoter genes in our study: MGMT and HIN-1 [unmethylated (−), methylated (+)]
between both, and effects in patient’s survival time. Methylation status impact of MGMT gene promoter in therapy for patients with GBM is well known [6], representing differences in survival time. However, there are no related studies concerning epigenetic state of HIN-1 gene promoter and its impact in therapy efficiency on patients with GBM. As per our knowledge, the relationship between the two genes has not been described before. MGMT methylation, namely lack of protein expression, means that DNA repair is failing. On the other hand, the potential tumor suppressor function of HIN-1 is indicated because it enhances susceptibility of cytotoxic drugs [17]. Our study shows that methylation status of both genes is inverted (70.45 % of all cases but 98 % when one or both are methylated). Methylation status impact of MGMT gene promoter is well known. Hegi’s work related the implication of this methylated gene in therapy for patients with GBM, which represents differences in survival time, as our study has shown. But, there are no related studies concerning the epigenetic state with gene promoter HIN-1 and its impact on patients with GBM. Aberrant methylation needs to meet the cutoff ratio of ≥30 % set by the mathematical algorithm designed to distinguish legitimate methylation [17]. HIN-1 promoter hypermethylation, a common mechanism involved in ovarian carcinogenesis appears where expression of this gene increased paclitaxel and cisplatin sensitivity (mainly through AKT
phosphorylation) [17]. Some reports defined HIN-1 expression as downregulated in lung, breast, prostate, and other tumors, expression associated with hypermethylation of the HIN-1 promoter [10, 14, 18]. Thus, silencing of HIN-1 expression by methylation is an early and frequent event in multiple human cancer types, functionally relevant to tumorigenesis [19]. In our series, levels of HIN-1 promoter methylation indicate that tumor suppressor progression effect of HIN-1 was annulated with effect in tumor outcome. Methylation of HIN-1 in neuroblastoma [20] indicate poor tumor outcome, but there are no references on glioblastoma. Studies analyzing promoter methylation frequency of genes show that these levels increase with lesions’ severity, suggesting that hypermethylation is an early event in carcinogenesis, and epigenomic instability may be involved [20]. HIN-1 methylation is an important epigenetic mechanism for gene inactivation, being a potential biomarker for biological and clinical status prediction in several malignancies [18], suggesting, in turn, an important role in control and therapeutic selection. Harada (2002) reported that HIN-1 is frequently methylated in retinoblastoma, Wilms’ tumors, and rhabdomyosarcomas, and its expression was restored after 5-AzaCdR treatment [24], meaning that HIN-1 may play an important role in the pathogenesis of these tumors, role that can be reversed using a demethylating agent. We hypothesized that chemotherapy susceptibility of tumors is higher when MGMT promoter is methylated and
Mol Neurobiol
HIN-1 promoter is unmethylated (corroborated by the increased survival with TMZ) or the opposite (need to be therapy improvement) because both situations increase cell susceptibility to chemotherapy, suggesting possible implication in therapy outcome of both genes in a synergistic (or reverse) way. These results have led us to argue about implications of these gene expressions in GBM response to therapy. Is there any common pathway upstream or downstream that can explain this behavior? Do they act synergistically or in exclusion? These are questions which we are still left to answer. The underlying mechanism and pathways regulating HIN-1-MGMT interactions in GBM need to be explored. Our findings led us to consider in patients with MGMT unmethylated promoter and HIN-1 methylated promoter the suitability of using temozolomide; its obvious looking at the survival curves (Fig. 2), the poor utility, being more appropriate to use new therapies. Since TMZ is related to the MGMT gene, these new therapies should be considered HIN-1 as target. One possibility will be to combine TMZ with taxol, as paclitaxel, as in ovarian cancer [17]. This combination should be explored in patients with GBM and HIN-1 promoter unmethylated. In this paper, we study, for the first time, status of MGMT and HIN-1 gene promoter in GBM. We find in most cases that methylation status is reversing and very important (over 70 % of all patients and more than 90 % analyzing only methylated samples). Survival analysis shows different outcomes with different combinations of genes methylation profiles. These results lead us to consider the following: (i) HIN-1 could be included in methylation studies before therapy treatment is selected for GBM patients and (ii) new or combined therapies must be implemented depending on the methylation status of both genes, probably through HIN-1 pathway effectors as paclitaxel.
Acknowledgments Pathology Department, especially Molecular BiologyArea: Elena Couso, T. Yolanda Rico and Raquel Perez-Becerra; Biobank of the Complejo Hospitalario Universitario de Santiago de Compostela, and Paula Vieiro Balo. Conflict of Interest The authors declare that they have no conflict of interest. Author Contributions H.M. and PI.M. designed and performed the experiments and analyzed the data. ML.N. performed the clinical follow-up. AL.S., RD.P., and BV.E performed the clinical oncology analysis. C.JJ. and A.JR. performed the pathological studies, and R.A. and LL.R. wrote the paper and supervised the project. Ethical Statement The study complied with the Declaration of Helsinki Principles and was approved by Clinical Research Ethics Committee of Galicia (Spanish region where the study was done and name of the hospital is attached, code 2011/153). Written informed consent was obtained from all subjects.
References 1. Herman JG et al (2003) Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 349:2042–2054 2. Das PM, Singal R (2004) DNA methylation and cancer. J Clin Oncol 22:4632–4642 3. Jirtle RL et al (1999) Genomic imprinting and cancer. Exp Cell Res 248:18–24 4. Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N et al (2005) MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med 352:997–1003. doi:10.1056/ NEJMoa043331 5. Wick W, Hartmann C, Engel C, Stoffels M, Felsberg J et al (2009) NOA-04 randomized phase III trial of sequential radiochemotherapy of anaplastic glioma with procarbazine, lomustine, and vincristine or temozolomide. J Clin Oncol 27:5874–5880. doi:10.1200/JCO.2009. 23.6497 6. Hegi ME et al (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352:987–996 7. Krop IE, Sgroi D, Porter DA, Lunetta KL, LeVangie R, Seth P, Kaelin CM, Rhei E et al (2001) HIN-1, a putative cytokine highly expressed in normal but not cancerous mammary epithelial cells. Proc Natl Acad Sci USA 98:9796–801 8. Krop I, Parker MT, Bloushtain-Qimron N, Porter D, Gelman R, Sasaki H, Maurer M, Terry MB et al (2005) HIN-1, an inhibitor of cell growth, invasion, and AKT activation. Cancer Res 65(21):9659– 9669 9. Krop I, Player A, Tablante A, Taylor-Parker M, Lahti-Domenici J, Fukuoka J, Batra SK, Papadopoulos N et al (2004) Frequent HIN-1 promoter methylation and lack of expression in multiple human tumor types. Mol Cancer Res 2:489–494 10. Wong TS, Kwong DL, Sham JS, Tsao SW, Wei WI, Kwong YL, Yuen AP (2003) Promoter hypermethylation of high-in-normal 1 gene in primary nasopharyngeal carcinoma. Clin Cancer Res 9: 3042–3046 11. Lehmann U, Berg-Ribbe I, Wingen LU, Brakensiek K, Becker T, Klempnauer J, Schlegelberger B, Kreipe H et al (2005) Distinct methylation patterns of benign and malignant liver tumors revealed by quantitative methylation profiling. Clin Cancer Res 11:3654–3660 12. Guo M, Ren J, Brock MV, Herman JG, Carraway HE (2008) Promoter methylation of HIN-1 in the progression to esophageal squamous cancer. Epigenetics 3:336–341, 13 13. Yutaka K, LanLan S, Jean-Pierre J (2003) Issa Critical role of histone methylation in tumor suppressor gene silencing in colorectal cancer. Mol Cell Biol 23(1):206–215 14. Esteller M et al (1999) Inactivation of the DNA repair gene O6methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 59: 793–797 15. Herman JG et al (1996) Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 96:9821–9826 16. Ho CM et al (2012) Promoter Methylation status of HIN-1 associated with outcomes of ovarian clear cell adenocarcinoma. Mol Cancer 11: 53 17. Shigematsu H, Suzuki M, Takahashi T, Shivapurkar N, Echebiri C, Nomura M, Stastny V, Augustus M et al (2005) Aberrant methylation of HIN-1 (high in normal-1) is a frequent event in many human malignancies. Int J Cancer 113:600–604 18. Marchetti A, Barassi F, Martella C, Chella A, Salvatore S, Castrataro A, Mucilli F, Sacco R et al (2004) Down regulation of high in normal1 (HIN-1) is a frequent event in stage I non-small cell lung cancer and correlates with poor clinical outcome. Clin Cancer Res 10:1338– 1343
Mol Neurobiol 19. Qiwei Y, Kiernan CM, Yufeng T, Salwen HR, Chlenski A, Brumback BA, London WB, Cohn SL (2007) Methylation of CASP8, DCR2, and HIN-1 in neuroblastoma is associated with poor outcome. Clin Cancer Res 13:3191
20. Harada K, Toyooka S, Shivapurkar N, Maitra A, Reddy JL, Matta H, Miyajima K, Timmons CF et al (2002) Deregulation of caspase 8 and 10 expression in pediatric tumors and cell lines. Cancer Res 62:5897– 5901
HIN-1: a New Epigenetic Biomarker Crucial for Therapy Selection in Glioblastoma Multiforme M. Herranz & M. E. Padín-Iruegas & Nieves Martínez-Lago & S. Aguín Losada & P. Raña-Díez & E. Brozos Vázquez & J. J. Carrera & J. R. Antúnez & A. Ruibal & R. López-López
Received: 19 May 2014 / Accepted: 22 February 2015 # Springer Science+Business Media New York 2015
Abstract Glioblastoma multiforme (GBM) is the most common brain tumor in adults. The role of high in normal-1 (HIN1) as a potential biomarker in combating this disease is being described for the first time in this study. A combination of O6methylguanine DNA methyltransferase (MGMT) and HIN-1 methylation could be a possible biomarker in therapy choice. Interestingly, survival data shows a similar trend for the methylation of MGMT and for unmethylation of HIN-1 and vice versa. Eighty-eight paraffin-embedded brain tumors were analyzed to screen methylation rates of different genes and evaluate the association between genes methylation and clinicopathologic variables. Our study is the first of its kind to indicate that MGMT and HIN-1 methylation status are inverted (97.7 % of methylated ones) and could be new markers in the study of GBM prognosis, especially in the therapy selection. Keywords Glioblastoma . Epigenetics . HIN1 . Outcome . Therapy M. Herranz and M. E. Padín-Iruegas contributed equally to this work. M. Herranz (*) : A. Ruibal Nuclear Medicine Department, Molecular Imaging Program, IDIS, USC, Hospital Clínico Universitario. Fundación Tejerina, Santiago de Compostela, Spain e-mail: [email protected] M. E. Padín-Iruegas Department of Functional Biology and Health Sciences, Human Anatomy and Embryology Section, University of Vigo, Vigo, Pontevedra, Spain N. Martínez-Lago : S. A. Losada : P. Raña-Díez : E. B. Vázquez : R. López-López Medical Oncology Department, Hospital Clínico Universitario, Santiago de Compostela, Spain J. J. Carrera : J. R. Antúnez Pathology Department, Hospital Clínico Universitario, Santiago de Compostela, Spain
Background Glioblastoma multiforme (GBM) is the most frequent and most aggressive malignant primary brain tumor in adults. GBM accounts for 12 to 15 % of all intracranial tumors and 50 to 60 % of astrocytic tumors. It primarily occurs in adults between the ages of 45 and 70 years. Classified as a grade IV astrocytoma, GBM develops from the lineage of star-shaped glial cells called astrocytes that support nerve cells. The number of new diagnoses made annually is 2 to 3 per 100,000 people in the USA and Europe. Median survival rate of ~15 monthsand 5 years means a survival rate of ~4 %. Standard treatment is surgery, combined with radio and chemotherapy. GBM’s capacity to wildly invade and infiltrate normal surrounding brain tissue makes complete resection impossible. After surgery, radiation therapy is used to kill leftover tumor cells and prevent recurrence of their growth. Gene promoter methylation is the best characterized epigenetic event of tumoral cells and is found virtually in all types of human neoplasm associated with inappropriate transcriptional silencing gene [1, 2]. This hypermethylation is, at least, as frequent as mutations or deletions in classical tumor suppressor genes. Genes involved, among others, in cell cycle regulation, DNA repair, drug resistance, differentiation, apoptosis, angiogenesis, metastasis, and invasion are pathologically silenced by methylation [3]. O6-Methylguanine DNA methyltransferase (MGMT) repairs the mutagenic and cytotoxic O6-alkylguanine lesions produced by environmental carcinogens and chemotherapeutic nitrosoureas. MGMT carries out direct repair of alkylated DNA by transferring the alkyl group from oxygen atoms within the DNA molecule to a cysteine residue on the enzyme. This reaction is irreversible. Tumors with inactivation of MGMT gene are predisposed to mutation of tumor suppressor genes.
Mol Neurobiol
Epigenetic silencing of the MGMT gene has been identified as a strong and independent predictive factor of treatment response for GBM patients undergoing chemotherapy with alkylating agents [4, 5]; determination of the promoter methylation status may thus serve as a Bchemosensitivity sensor^ in glioma patients. Hegi’s group concluded that patients with glioblastoma and a promoter-methylated MGMT gene benefited from treatment with temozolomide [6]. HIN-1 known as secretoglobin, family 3A, member 1 (SCGB3A1) expression is significantly downregulated in 94 % of human breast carcinomas and in 95 % of preinvasive lesions, such as ductal and lobular carcinoma in situ [7]. Function: potential growth inhibitory cytokine. Subcellular location: secreted. Tissue specificity: highly expressed in breast tissues. Absent in breast cancer cell lines. Sequence similarities: belongs to the secretoglobin family, UGRP subfamily. High in normal-1 (HIN-1) is highly expressed in normal luminal mammary epithelial cells but lost in the majority of breast cancers. Restoration of HIN-1 expression suppressed growth of breast cancer cells [8]. HIN-1 can also regulate cell cycle reentry, suppress tumor cell migration and invasion, and induce apoptosis in breast cancer cell lines [8]. Although HIN-1 processes the putative tumor suppressor function, no somatically genetic changes of HIN-1 gene are found in breast cancer. Previous studies demonstrated frequent methylation of HIN-1 gene promoter in breast cancer, prostate cancer, malignant mesotheliomas, non-small cell lung cancer, lymphoma, retinoblastoma, Wilms’ tumor, and rhabdomyosarcomas [8–12]. HIN-1 is a potent inhibitor of cell growth, migration, and invasion. Expression of HIN-1 in synchronized cells inhibits cell cycle reentry and retinoblastoma protein (Rb) phosphorylation whereas in exponentially growing cells; HIN-1 induces apoptosis without apparent cell cycle arrest and effect on Rb. Investigation of multiple signaling pathways revealed that mitogen-induced phosphorylation and activation of AKT are inhibited in HIN-1-expressing cells. These studies provide evidence that HIN-1 tumor suppressor functions may be mediated through AKT pathway [13]. In this study, we focus on the identification of new methylated genes implicated and related in GBM.
Material and Methods Tumor Samples GBM tumors were collected following the ethics’ guidelines of human specimens at University Hospital Complex in Santiago de Compostela, Spain. Eighty-eight paraffin-embedded brain tumors, including paired normal tissue, were analyzed to screen methylation rates and evaluate association between genes methylation and clinicopathologic variables. The
study was approved by Clinical Research Ethics Committee of Galicia (Spanish region where the study was done and name of the hospital is attached, code 2011/153). The committee realized that being a retrospective study obtaining consent was difficult for the expected median survival for this pathology; therefore, it was decided that it would be accepted if the principal investigator guarantees the confidentiality of the data and verifies that each participant of the study had not indicated or expressed objection to such use of his or her samples. Tumor samples were obtained from the Biobank of Santiago (Hospital Clínico Santiago, SERGAS). Tumors came from patients’ biopsies used for the diagnosis by surgical procedures. Samples were in paraffin-embedded blocks. Biobank provided us three cuts of 14 μM. After DNA was obtained, it was stored at −80 °C. DNA Samples Genomic DNAs from paired normal and tumor brain samples were obtained. Genomic DNA from human normal brain was used as a control for unmethylated DNA and the Cp Genome Universal Methylated DNA (Chemicon) for methylated DNA. Distribution of Aberrant Promoter Methylation Methylation-specific polymerase chain reaction (MSP) was carried out following Herman et al. method [1]. DNA was extracted using the QIAmp DNA Mini Kit (Qiagen GmbH, Hilden, Germany) and modified using EZ DNA Methylation Kit (Zymo Research) and by standard procedures with sodium bisulphite. Primers for MGMT were selected from Yutaka et al. [9]. Two pairs of primers for HIN-1 were selected, one from Krop et al. [14] and the other was designed in our laboratory as follows: Fragments of the human promoter (http:// rulai.cshl.edu/cgi-bin/TRED/tred.cgi?process=home=) of HIN-1 gene, containing the transcription start site, was selected from the NCBI database (http://ncbi.nlm.nih.gov/). These sequences were analyzed with the CpGPLOT software program (http://bioinfo.hku.hk/cgi-bin/), and primers were designed using primer 3 software (http://frodo.wi.mit.edu). DNA methylation patterns in the CpG islands of those genes were determined by PCR of chemical modification of unmethylated, but not methylated DNA samples, and subsequent polymerase chain reaction using specific primers [15, 16]. Controls for non-methylated DNA (amygdale), methylated DNA (IVD), and DNA contamination (water) were performed for each set of polymerase chain reaction. Amplifications were carried out in a 25-μl volume: 200 μM each of dATP, dCTP, dGTP, and dTTP; 0.2 μm each of forward and reverse primers; 10 mm Tris (pH 8.4); 50 mm KCl; 1.5 mm MgCl2; and 0.5 U of Taq polymerase (Invitrogen). Cycling: 10 min at 95 °C; 35 cycles of 30 s at 95 °C, 45 s at 57 °C for HIN-1 (own primers: MF-GGTACGGGTTTTTTACGGTT CGTC, MR-AACTTCTTATACCCGATCCTCG, UF-GGTA
Mol Neurobiol
TGGGTTTTTTATGGTTTGTT, UR-CAAAACTTCTTATA CCCAATCCTCA; Krop et al. primers: MF-GTTTAGTTTT GAGGGGGGCGC, MR-AACTTCCTACTACGACCGACG, UF-ATTGTAAAGTGAAGGTGTGGGTT, UR-CCAACTTC CTACTACAACCAACA) and one cycle of 10 min at 95 °C; 40 cycles of 1 min at 95 °C, 1 min at 55 °C for MGMT (Yutaka et al. primers, MF-GGTCGTTTGTACGTTCGC, MR-GACC GATACAAACCGAACG, UF-GTAGGTTGTTTGTATGTT TGT, UR-AACCAATACAAACCAAACA), and 1 min at 72 °C; and a final step at 72 °C for 10 min. PCR products were separated in 8–12 % nondenaturing acrylamide-Tris-HCl (pH 8.8)-buffered gels or 2 % agarose gels, stained with ethidium bromide and visualized under UV illumination.
Results We checked methylation status of different cellular genes: p16, cyclin D2, GSTP1, RASSF1A (Fig. 1a), MGMT, and HIN-1 in GBM. Patients’ characteristics are shown in Table 1. Age median was 65, ranging between 32–84. Percentages: 53.4 for men and 46.6 for women. Frequency of tumoral MGMT promoter methylation was 42.04 % (Fig. 1). A median survival day was 224 for methylated and 150 for patients with unmethylated gene (Table 1). Median survival was higher in the combined therapy group among those with methylated MGMT. Kaplan-Meyer survival analysis (Fig. 2) indicates that patients with methylated MGMT gene still have less progression with time, instead of those with no methylated gene. In the same group, 38 % of patients survive more than 15 months. HIN-1 promoter methylation was 31 % (Fig. 1). Interestingly, in almost all cases, methylated HIN-1 corresponds and coincides
Fig. 1 Genes’ methylation results in glioblastoma samples. a Methylation-specific PCR (MSP) gel examples for p16, cyclin D2, Ecadherin, RASSF1A, GSTP1, and RARb2 promoters. b MSP examples for MGMT and HIN-1 promoters. c Methylation profiles and percentages. Black box for methylated promoter, white box for
Table 1
Patients’ characteristics and statistical analysis
Patients’ characteristics Age: median (range) Male Female MGMT promoter methylation Survival days: median (range) MGMT promoter unmethylation Survival days: median (range) HIN-1 promoter methylation Survival days: median (range) HIN-1 promoter unmethylation Survival days: median (range) Unmethylated promoters Survival days: median (range)
65 (32–84) 53.4 % 46.6 % 42 % 224 (13–4075) 58 % 150 (10–5015) 31 % 170 (10–455) 69 % 210 (13–5015) 27 % 150 (17–5015)
with unmethylated for MGMT gene; only two cases (2.2 %) have methylation in both promoters. Unmethylated HIN-1 promoter survival median was 210 days. Twenty-seven percent of the patients had unmethylated gene promoter for MGMT and HIN-1. Median survival days were 150, with a range 17–5015 (Table 1). Curiously, survival time in patients with methylated MGMT almost overlaps with survival time when HIN-1 is unmethylated and vice versa suggesting a complementary effect (Fig. 2).
Discussion Our study analyzes methylation of MGMT promoter and, for the first time, status of promoter methylation of HIN-1 in GBM, checking possible synergies or complementarities
unmethylated one. Samples from glioblastoma multiforme (GBM#); normal brain (N.B.) as negative control for methylation; in vitro DNA (IVD) as positive control for methylation and H2O as contamination control
Mol Neurobiol Fig. 2 Survival curve. Differences in survival time in patients with only radiotherapy (RT), and with a combination of chemo- and radiotherapy related with the methylation status of promoter genes in our study: MGMT and HIN-1 [unmethylated (−), methylated (+)]
between both, and effects in patient’s survival time. Methylation status impact of MGMT gene promoter in therapy for patients with GBM is well known [6], representing differences in survival time. However, there are no related studies concerning epigenetic state of HIN-1 gene promoter and its impact in therapy efficiency on patients with GBM. As per our knowledge, the relationship between the two genes has not been described before. MGMT methylation, namely lack of protein expression, means that DNA repair is failing. On the other hand, the potential tumor suppressor function of HIN-1 is indicated because it enhances susceptibility of cytotoxic drugs [17]. Our study shows that methylation status of both genes is inverted (70.45 % of all cases but 98 % when one or both are methylated). Methylation status impact of MGMT gene promoter is well known. Hegi’s work related the implication of this methylated gene in therapy for patients with GBM, which represents differences in survival time, as our study has shown. But, there are no related studies concerning the epigenetic state with gene promoter HIN-1 and its impact on patients with GBM. Aberrant methylation needs to meet the cutoff ratio of ≥30 % set by the mathematical algorithm designed to distinguish legitimate methylation [17]. HIN-1 promoter hypermethylation, a common mechanism involved in ovarian carcinogenesis appears where expression of this gene increased paclitaxel and cisplatin sensitivity (mainly through AKT
phosphorylation) [17]. Some reports defined HIN-1 expression as downregulated in lung, breast, prostate, and other tumors, expression associated with hypermethylation of the HIN-1 promoter [10, 14, 18]. Thus, silencing of HIN-1 expression by methylation is an early and frequent event in multiple human cancer types, functionally relevant to tumorigenesis [19]. In our series, levels of HIN-1 promoter methylation indicate that tumor suppressor progression effect of HIN-1 was annulated with effect in tumor outcome. Methylation of HIN-1 in neuroblastoma [20] indicate poor tumor outcome, but there are no references on glioblastoma. Studies analyzing promoter methylation frequency of genes show that these levels increase with lesions’ severity, suggesting that hypermethylation is an early event in carcinogenesis, and epigenomic instability may be involved [20]. HIN-1 methylation is an important epigenetic mechanism for gene inactivation, being a potential biomarker for biological and clinical status prediction in several malignancies [18], suggesting, in turn, an important role in control and therapeutic selection. Harada (2002) reported that HIN-1 is frequently methylated in retinoblastoma, Wilms’ tumors, and rhabdomyosarcomas, and its expression was restored after 5-AzaCdR treatment [24], meaning that HIN-1 may play an important role in the pathogenesis of these tumors, role that can be reversed using a demethylating agent. We hypothesized that chemotherapy susceptibility of tumors is higher when MGMT promoter is methylated and
Mol Neurobiol
HIN-1 promoter is unmethylated (corroborated by the increased survival with TMZ) or the opposite (need to be therapy improvement) because both situations increase cell susceptibility to chemotherapy, suggesting possible implication in therapy outcome of both genes in a synergistic (or reverse) way. These results have led us to argue about implications of these gene expressions in GBM response to therapy. Is there any common pathway upstream or downstream that can explain this behavior? Do they act synergistically or in exclusion? These are questions which we are still left to answer. The underlying mechanism and pathways regulating HIN-1-MGMT interactions in GBM need to be explored. Our findings led us to consider in patients with MGMT unmethylated promoter and HIN-1 methylated promoter the suitability of using temozolomide; its obvious looking at the survival curves (Fig. 2), the poor utility, being more appropriate to use new therapies. Since TMZ is related to the MGMT gene, these new therapies should be considered HIN-1 as target. One possibility will be to combine TMZ with taxol, as paclitaxel, as in ovarian cancer [17]. This combination should be explored in patients with GBM and HIN-1 promoter unmethylated. In this paper, we study, for the first time, status of MGMT and HIN-1 gene promoter in GBM. We find in most cases that methylation status is reversing and very important (over 70 % of all patients and more than 90 % analyzing only methylated samples). Survival analysis shows different outcomes with different combinations of genes methylation profiles. These results lead us to consider the following: (i) HIN-1 could be included in methylation studies before therapy treatment is selected for GBM patients and (ii) new or combined therapies must be implemented depending on the methylation status of both genes, probably through HIN-1 pathway effectors as paclitaxel.
Acknowledgments Pathology Department, especially Molecular BiologyArea: Elena Couso, T. Yolanda Rico and Raquel Perez-Becerra; Biobank of the Complejo Hospitalario Universitario de Santiago de Compostela, and Paula Vieiro Balo. Conflict of Interest The authors declare that they have no conflict of interest. Author Contributions H.M. and PI.M. designed and performed the experiments and analyzed the data. ML.N. performed the clinical follow-up. AL.S., RD.P., and BV.E performed the clinical oncology analysis. C.JJ. and A.JR. performed the pathological studies, and R.A. and LL.R. wrote the paper and supervised the project. Ethical Statement The study complied with the Declaration of Helsinki Principles and was approved by Clinical Research Ethics Committee of Galicia (Spanish region where the study was done and name of the hospital is attached, code 2011/153). Written informed consent was obtained from all subjects.
References 1. Herman JG et al (2003) Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 349:2042–2054 2. Das PM, Singal R (2004) DNA methylation and cancer. J Clin Oncol 22:4632–4642 3. Jirtle RL et al (1999) Genomic imprinting and cancer. Exp Cell Res 248:18–24 4. Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N et al (2005) MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med 352:997–1003. doi:10.1056/ NEJMoa043331 5. Wick W, Hartmann C, Engel C, Stoffels M, Felsberg J et al (2009) NOA-04 randomized phase III trial of sequential radiochemotherapy of anaplastic glioma with procarbazine, lomustine, and vincristine or temozolomide. J Clin Oncol 27:5874–5880. doi:10.1200/JCO.2009. 23.6497 6. Hegi ME et al (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352:987–996 7. Krop IE, Sgroi D, Porter DA, Lunetta KL, LeVangie R, Seth P, Kaelin CM, Rhei E et al (2001) HIN-1, a putative cytokine highly expressed in normal but not cancerous mammary epithelial cells. Proc Natl Acad Sci USA 98:9796–801 8. Krop I, Parker MT, Bloushtain-Qimron N, Porter D, Gelman R, Sasaki H, Maurer M, Terry MB et al (2005) HIN-1, an inhibitor of cell growth, invasion, and AKT activation. Cancer Res 65(21):9659– 9669 9. Krop I, Player A, Tablante A, Taylor-Parker M, Lahti-Domenici J, Fukuoka J, Batra SK, Papadopoulos N et al (2004) Frequent HIN-1 promoter methylation and lack of expression in multiple human tumor types. Mol Cancer Res 2:489–494 10. Wong TS, Kwong DL, Sham JS, Tsao SW, Wei WI, Kwong YL, Yuen AP (2003) Promoter hypermethylation of high-in-normal 1 gene in primary nasopharyngeal carcinoma. Clin Cancer Res 9: 3042–3046 11. Lehmann U, Berg-Ribbe I, Wingen LU, Brakensiek K, Becker T, Klempnauer J, Schlegelberger B, Kreipe H et al (2005) Distinct methylation patterns of benign and malignant liver tumors revealed by quantitative methylation profiling. Clin Cancer Res 11:3654–3660 12. Guo M, Ren J, Brock MV, Herman JG, Carraway HE (2008) Promoter methylation of HIN-1 in the progression to esophageal squamous cancer. Epigenetics 3:336–341, 13 13. Yutaka K, LanLan S, Jean-Pierre J (2003) Issa Critical role of histone methylation in tumor suppressor gene silencing in colorectal cancer. Mol Cell Biol 23(1):206–215 14. Esteller M et al (1999) Inactivation of the DNA repair gene O6methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 59: 793–797 15. Herman JG et al (1996) Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 96:9821–9826 16. Ho CM et al (2012) Promoter Methylation status of HIN-1 associated with outcomes of ovarian clear cell adenocarcinoma. Mol Cancer 11: 53 17. Shigematsu H, Suzuki M, Takahashi T, Shivapurkar N, Echebiri C, Nomura M, Stastny V, Augustus M et al (2005) Aberrant methylation of HIN-1 (high in normal-1) is a frequent event in many human malignancies. Int J Cancer 113:600–604 18. Marchetti A, Barassi F, Martella C, Chella A, Salvatore S, Castrataro A, Mucilli F, Sacco R et al (2004) Down regulation of high in normal1 (HIN-1) is a frequent event in stage I non-small cell lung cancer and correlates with poor clinical outcome. Clin Cancer Res 10:1338– 1343
Mol Neurobiol 19. Qiwei Y, Kiernan CM, Yufeng T, Salwen HR, Chlenski A, Brumback BA, London WB, Cohn SL (2007) Methylation of CASP8, DCR2, and HIN-1 in neuroblastoma is associated with poor outcome. Clin Cancer Res 13:3191
20. Harada K, Toyooka S, Shivapurkar N, Maitra A, Reddy JL, Matta H, Miyajima K, Timmons CF et al (2002) Deregulation of caspase 8 and 10 expression in pediatric tumors and cell lines. Cancer Res 62:5897– 5901
