H u m G e n e t (1992) 8 9 : 1 2 3 - 1 2 4
9 Springer-Verlag 1992
Highly polymorphic region of the human prothrombin (F2) gene Hiroyuki lwahana, Katsuhiko Yoshimoto, and Mitsuo Itakura Otsuka Department of Clinical and MolecularNutrition, Schoolof Medicine, Universityof Tokushima, Tokushima,770 Japan Received July 1, 1991 / Revised October 22, 1991
Summary. We have found a highly polymorphic region in the human prothrombin gene. Our sequence differed from that previously reported at as many as 6 positions in a 225-bp stretch spanning exon 6 and its flanking regions; four of these positions were related to endonuclease restriction sites for AluI, HpalI(MspI), MbolI, and NcoI. AluI and HpalI digested all alleles of the Japanese tested. MbolI and NcoI restriction fragment length polymorphisms are highly heterozygous and not in linkage disequilibrium; they thus serve as good human DNA markers
Prothrombin is the precursor of thrombin that participates in the final stage of blood coagulation in mammals. The nucleotide sequences of cDNA (Degen et al. 1983) and genomic DNA (Degen and Davie 1987) for human prothrombin have been reported; this gene has been assigned to chromosomal region 11pll-q12 (Royle et al. 1987). Its polymorphisms have been described (Degen and Davie 1987; De Vetten et al. 1990; McAlpine et al. 1991; Iwahana et al. 1991). We have studied the human prothrombin gene using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis, and have found that exon 6 and its flanking regions are highly polymorphic. A 418-bp fragment spanning exons 5, 6, and their flanking regions have been amplified by PCR using 2 primers of PT1 (AATAAGTCCCCAGGCTCCAA) and PT2 (TGGTCATGGGTCGCCCCACT) (Iwahana et al. 1991). The amplified 418-bp fragments from 2 different genomic DNAs have been cloned into pUC19 and sequenced by the method of dideoxy chain termination. Four and six clones were obtained from persons 1 (P1) and 2 (P2), respectively. The nucleotide sequence of clone 1 (C1) of P1, with the accession number X59597 to the EMBL Data Library, was different at as many as 6 positions (in a stretch of 225 bp) from the sequence reported by Degen and Davie (1987), as shown in Fig. 1. Because 4 of these positions were related to endonuclease restriction sites for HpaII (MspI), MboII, NcoI, and AluI, we carried out restriction fragment length polyOffprint requests to: M. I t a k u r a
morphism (RFLP) analyses. HpaII and AluI digested all alleles of the 24 Japanese studied. We have previously reported the NcoI RFLP (Iwahana et al. 1991). MboII RFLP analysis showed a frequency of 0.35 for the originally reported allele, 0.65 for the newly found allele (which lost an MboII site), and 54% for the rate of heterozygosity. Co-dominant inheritance of the MboII RFLP was demonstrated in 4 two-generation Japanese families. Although the distance between the MboII and NcoI recognition sites was only 71 bp, MboII and NcoI RFLPs were independent from each other in 24 Japanese tested (data not shown). The substitutions of CC for TT at positions 4097 and 4098 were not related to any restriction sites, and were confirmed by the sequence analysis of 4 and 6 clones of P1 and P2, respectively. Exon 6 of human prothrombin gene encodes part of a kringle 1 domain. Degen and Davie (1987) have reported 3 different polymorphisms of C, A, or T at position 4200 in exon 6. Among these highly polymorphic sites in
Degen GTGAGTGAGGGGTCGGCETTCCCAECATGGGCTGAGAACAGGGAGCAAGC 4085 P1 -Cl . . . . . . . . . . . ~ ......................
Hpmn(Mspl) Mboll Degen P1-C1
CTACCTCAAC TTCAACAGCr TCCTGTI'GGC r 1 6 2 ........ CC. . . . . . . . . . . . . . . . . . . .
N S T
T H P G
(E) [ 4135
G
(*) *
A D L
Q E N
F E R N
*
*
*
Degen AACTCEACTACCEATCCTGGGGCEGACETACAGGAGAATTTCTGCCGCAA 4185
PI-Cl
........................................ 9
*
*
P D S
*
*
*
S T T
*
*
*
G P W C
*
*
Y T T
*
*
*
D P T
Degen CCECGACAGCAGCACCACGGGACCCTGGTGCTACAETAEAGACCECAEEG 4 2 3 5 P1 -C1
.........
~
. . . . . . . . . . . . . . . . . . . .
, , , , *NMol * , , , , , , , , , V R R Q E C S I P V C (G) Degen TGAGGAGGCAGGAATGCAGCATCCCTGTCTG T G G T ~ GGGGGC P I - C l ,--,--,--, --, ,_ 9 * *- * *-i*)~]Alul -
4281
Fig. 1. N u c l e o t i d e s e q u e n c e , a m i n o acid s e q u e n c e , a n d t h e restric-
sites for exon 6 and its flanking regions in the human prothrombin gene. The sequence reported by Degen and Davie (1987) and clone 1 of person 1 are designated as Degen and P1-C1, respectively. Dashes show identical nucleotides in the P1-C1 and Degen sequences; * designates the presence of the same amino acid in a P1-C1 sequence compared with that in Degen; boxed sequences are the recognition sites for the indicated restriction endonucleases. The nucleotidesequence is numbered as describedby Degen and Davie (1987) tion
124 exon 6 a n d its f l a n k i n g regions, MboII a n d NcoI R F L P s are highly h e t e r o z y g o u s a n d not in linkage disequilibrium; they thus serve as good h u m a n D N A markers.
Acknowledgements. We wish to thank Noriko Mizusawa for excellent technical assistance. This study was supported in part by a grant from the Otsuka Pharmaceutical Factory Inc. to the Otsuka Department of Clinical and Molecular Nutrition, School of Medicine, University of Tokushima.
References Degen SJF, Davie EW (1987) Nucleotide sequence of the gene for human prothrombin. Biochemistry 26 : 6165-6177
Degen SJF, MacGillivray RTA, Davie EW (1983) Characterization of the complementary deoxyribonucleic acid and gene coding for human prothrombin. Biochemistry 22 : 2087-2097 De Vetten M, Ploos van Amstel HK, Reitsma PH (1990) RFLP for the human prothrombin (F2) gene. Nucleic Acids Res 18: 5917 Iwahana H, Yoshimoto K. Itakura M (1991) Ncol RFLP in the human prothrombin (F2) gene. Nucleic Acids Res 19 : 4309 McAlpine PJ, Dickson M, Guy C, Wiens A, Irwin DM, MacGillivray RTA (1991) Polymorphism detected by multiple RENS in the human coagulation factor II (F2) gene. Nucleic Acids Res 19:193 Royle NJ, Irwin DM, Koschinsky ML, MacGillivray RTA, Hamerton JL (1987) Human genes encoding prothrombin and ceruloplasmin map to l l p l l - q l 2 and 3q21-24, respectively. Somat Cell Mol Genet 13 : 285-292
9 Springer-Verlag 1992
Highly polymorphic region of the human prothrombin (F2) gene Hiroyuki lwahana, Katsuhiko Yoshimoto, and Mitsuo Itakura Otsuka Department of Clinical and MolecularNutrition, Schoolof Medicine, Universityof Tokushima, Tokushima,770 Japan Received July 1, 1991 / Revised October 22, 1991
Summary. We have found a highly polymorphic region in the human prothrombin gene. Our sequence differed from that previously reported at as many as 6 positions in a 225-bp stretch spanning exon 6 and its flanking regions; four of these positions were related to endonuclease restriction sites for AluI, HpalI(MspI), MbolI, and NcoI. AluI and HpalI digested all alleles of the Japanese tested. MbolI and NcoI restriction fragment length polymorphisms are highly heterozygous and not in linkage disequilibrium; they thus serve as good human DNA markers
Prothrombin is the precursor of thrombin that participates in the final stage of blood coagulation in mammals. The nucleotide sequences of cDNA (Degen et al. 1983) and genomic DNA (Degen and Davie 1987) for human prothrombin have been reported; this gene has been assigned to chromosomal region 11pll-q12 (Royle et al. 1987). Its polymorphisms have been described (Degen and Davie 1987; De Vetten et al. 1990; McAlpine et al. 1991; Iwahana et al. 1991). We have studied the human prothrombin gene using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis, and have found that exon 6 and its flanking regions are highly polymorphic. A 418-bp fragment spanning exons 5, 6, and their flanking regions have been amplified by PCR using 2 primers of PT1 (AATAAGTCCCCAGGCTCCAA) and PT2 (TGGTCATGGGTCGCCCCACT) (Iwahana et al. 1991). The amplified 418-bp fragments from 2 different genomic DNAs have been cloned into pUC19 and sequenced by the method of dideoxy chain termination. Four and six clones were obtained from persons 1 (P1) and 2 (P2), respectively. The nucleotide sequence of clone 1 (C1) of P1, with the accession number X59597 to the EMBL Data Library, was different at as many as 6 positions (in a stretch of 225 bp) from the sequence reported by Degen and Davie (1987), as shown in Fig. 1. Because 4 of these positions were related to endonuclease restriction sites for HpaII (MspI), MboII, NcoI, and AluI, we carried out restriction fragment length polyOffprint requests to: M. I t a k u r a
morphism (RFLP) analyses. HpaII and AluI digested all alleles of the 24 Japanese studied. We have previously reported the NcoI RFLP (Iwahana et al. 1991). MboII RFLP analysis showed a frequency of 0.35 for the originally reported allele, 0.65 for the newly found allele (which lost an MboII site), and 54% for the rate of heterozygosity. Co-dominant inheritance of the MboII RFLP was demonstrated in 4 two-generation Japanese families. Although the distance between the MboII and NcoI recognition sites was only 71 bp, MboII and NcoI RFLPs were independent from each other in 24 Japanese tested (data not shown). The substitutions of CC for TT at positions 4097 and 4098 were not related to any restriction sites, and were confirmed by the sequence analysis of 4 and 6 clones of P1 and P2, respectively. Exon 6 of human prothrombin gene encodes part of a kringle 1 domain. Degen and Davie (1987) have reported 3 different polymorphisms of C, A, or T at position 4200 in exon 6. Among these highly polymorphic sites in
Degen GTGAGTGAGGGGTCGGCETTCCCAECATGGGCTGAGAACAGGGAGCAAGC 4085 P1 -Cl . . . . . . . . . . . ~ ......................
Hpmn(Mspl) Mboll Degen P1-C1
CTACCTCAAC TTCAACAGCr TCCTGTI'GGC r 1 6 2 ........ CC. . . . . . . . . . . . . . . . . . . .
N S T
T H P G
(E) [ 4135
G
(*) *
A D L
Q E N
F E R N
*
*
*
Degen AACTCEACTACCEATCCTGGGGCEGACETACAGGAGAATTTCTGCCGCAA 4185
PI-Cl
........................................ 9
*
*
P D S
*
*
*
S T T
*
*
*
G P W C
*
*
Y T T
*
*
*
D P T
Degen CCECGACAGCAGCACCACGGGACCCTGGTGCTACAETAEAGACCECAEEG 4 2 3 5 P1 -C1
.........
~
. . . . . . . . . . . . . . . . . . . .
, , , , *NMol * , , , , , , , , , V R R Q E C S I P V C (G) Degen TGAGGAGGCAGGAATGCAGCATCCCTGTCTG T G G T ~ GGGGGC P I - C l ,--,--,--, --, ,_ 9 * *- * *-i*)~]Alul -
4281
Fig. 1. N u c l e o t i d e s e q u e n c e , a m i n o acid s e q u e n c e , a n d t h e restric-
sites for exon 6 and its flanking regions in the human prothrombin gene. The sequence reported by Degen and Davie (1987) and clone 1 of person 1 are designated as Degen and P1-C1, respectively. Dashes show identical nucleotides in the P1-C1 and Degen sequences; * designates the presence of the same amino acid in a P1-C1 sequence compared with that in Degen; boxed sequences are the recognition sites for the indicated restriction endonucleases. The nucleotidesequence is numbered as describedby Degen and Davie (1987) tion
124 exon 6 a n d its f l a n k i n g regions, MboII a n d NcoI R F L P s are highly h e t e r o z y g o u s a n d not in linkage disequilibrium; they thus serve as good h u m a n D N A markers.
Acknowledgements. We wish to thank Noriko Mizusawa for excellent technical assistance. This study was supported in part by a grant from the Otsuka Pharmaceutical Factory Inc. to the Otsuka Department of Clinical and Molecular Nutrition, School of Medicine, University of Tokushima.
References Degen SJF, Davie EW (1987) Nucleotide sequence of the gene for human prothrombin. Biochemistry 26 : 6165-6177
Degen SJF, MacGillivray RTA, Davie EW (1983) Characterization of the complementary deoxyribonucleic acid and gene coding for human prothrombin. Biochemistry 22 : 2087-2097 De Vetten M, Ploos van Amstel HK, Reitsma PH (1990) RFLP for the human prothrombin (F2) gene. Nucleic Acids Res 18: 5917 Iwahana H, Yoshimoto K. Itakura M (1991) Ncol RFLP in the human prothrombin (F2) gene. Nucleic Acids Res 19 : 4309 McAlpine PJ, Dickson M, Guy C, Wiens A, Irwin DM, MacGillivray RTA (1991) Polymorphism detected by multiple RENS in the human coagulation factor II (F2) gene. Nucleic Acids Res 19:193 Royle NJ, Irwin DM, Koschinsky ML, MacGillivray RTA, Hamerton JL (1987) Human genes encoding prothrombin and ceruloplasmin map to l l p l l - q l 2 and 3q21-24, respectively. Somat Cell Mol Genet 13 : 285-292
