REVIEW URRENT C OPINION
High-resolution typing of Chlamydia trachomatis: epidemiological and clinical uses Henry J.C. de Vries a,b,c, Maarten F. Schim van der Loeff b,d, and Sylvia M. Bruisten b,e
Purpose of review A state-of-the-art overview of molecular Chlamydia trachomatis typing methods that are used for routine diagnostics and scientific studies. Recent findings Molecular epidemiology uses high-resolution typing techniques such as multilocus sequence typing, multilocus variable number of tandem repeats analysis, and whole-genome sequencing to identify strains based on their DNA sequence. These data can be used for cluster, network and phylogenetic analyses, and are used to unveil transmission networks, risk groups, and evolutionary pathways. High-resolution typing of C. trachomatis strains is applied to monitor treatment efficacy and re-infections, and to study the recent emergence of lymphogranuloma venereum (LGV) amongst men who have sex with men in highincome countries. Chlamydia strain typing has clinical relevance in disease management, as LGV needs longer treatment than non-LGV C. trachomatis. It has also led to the discovery of a new variant Chlamydia strain in Sweden, which was not detected by some commercial C. trachomatis diagnostic platforms. Summary After a brief history and comparison of the various Chlamydia typing methods, the applications of the current techniques are described and future endeavors to extend scientific understanding are formulated. High-resolution typing will likely help to further unravel the pathophysiological mechanisms behind the wide clinical spectrum of chlamydial disease. Keywords Chlamydia trachomatis, molecular epidemiology, molecular typing, multilocus sequence typing, sexually transmitted disease
INTRODUCTION Chlamydia trachomatis urogenital infection is a common sexually transmitted infection (STI) causing a high burden of morbidity such as pelvic inflammatory disease, infertility, and life-threatening conditions like ectopic pregnancy [1]. The WHO estimated that at any point in 2005, there were approximately 98 million adults infected with C. trachomatis (prevalence) and that yearly 101 million new cases of C. trachomatis occurred globally (incidence) [2]. The incidence of C. trachomatis exceeds the prevalence because of the relative short duration of infection compared with other STIs. As a result, the C. trachomatis epidemic is highly dynamic, affecting hundreds of millions of individuals who can become re-infected after treatment or spontaneous clearance. C. trachomatis affects all regions across the globe with prevalence rates amongst adults ranging from 1% in south-east Asia to nearly 6% in the Americas [2].
Identification of those infected is hindered because about three-quarters of infected women and about half of infected men have no symptoms [1]. The cost-effectiveness of population-based screening programmes is under debate, as they have not been shown to reduce the C. trachomatis a
STI Outpatient Clinic, Public Health Service of Amsterdam (GGD Amsterdam), bCenter for Infection and Immunology Amsterdam (CINIMA), Academic Medical Center (AMC), University of Amsterdam, c Department of Dermatology, Academic Medical Center (AMC), University of Amsterdam, dDepartment of Research, Public Health Service of Amsterdam (GGD Amsterdam) and ePublic Health Laboratory, Public Health Service of Amsterdam (GGD Amsterdam), Amsterdam, the Netherlands Correspondence to Henry J.C. de Vries, STI Outpatient Clinic, Public Health Service of Amsterdam (GGD Amsterdam), PO Box 2200, 1000 CE, Amsterdam, the Netherlands. Tel: +31 205555063; e-mail: [email protected] Curr Opin Infect Dis 2015, 28:61–71 DOI:10.1097/QCO.0000000000000129
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Sexually transmitted diseases
KEY POINTS
screening interventions and to monitor mutations of clinical importance.
Multilocus molecular typing methods of Chlamydia trachomatis provide a much better discrimination of C. trachomatis strains compared with traditional serological or ompA only typing methods.
HISTORY OF C. TRACHOMATIS TYPING: FROM SEROVAR TO MOLECULAR TYPING
Molecular typing of C. trachomatis has shown that the urogenital Chlamydia endemics amongst heterosexual men and women on the one hand and homosexual men on the other hand are genetically distinct and not overlapping. In repeat infections, molecular typing methods of C. trachomatis can be used to help distinguish treatment failure from re-infection. As lymphogranuloma venereum (LGV) infections require longer antimicrobial treatment courses than non-LGV C. trachomatis infections, it is of clinical importance to identify LGV strains with molecular typing methods. Whole-genome sequencing demonstrated that recombination and gene transfer between C. trachomatis strains occurs frequently; the diagnostic and clinical impact of these occurrences needs to be elucidated in the coming years.
prevalence [3,4]. Therefore, identifying specific risk groups for C. trachomatis infections is still important to target the limited public health resources. The circular genome of C. trachomatis is just over 1 million bp in length. C. trachomatis bacteria also contain a plasmid of 7.5 kb. As each C. trachomatis bacterium contains one genome but multiple (7–10) copies of the plasmid [5], the latter is often used as a diagnostic target, thus enhancing the sensitivity. In 2006, a new variant C. trachomatis (nvCt) strain was discovered with a plasmid DNA deletion that was missed by some widely used commercial C. trachomatis diagnostic tests [6]. This was the first event of a microbial diagnostic testing failure and demonstrated the importance of genotyping for surveillance purposes [7]. From a clinical point of view, it is relevant to discriminate the most commonly found C. trachomatis strains causing urogenital infections (genovars D to K), from genovar L, causing lymphogranuloma venereum (LGV) [8 ]. Whereas the majority of uncomplicated genovar D-K C. trachomatis infections cause few or no symptoms, LGV is an ulcerative, highly invasive STI with a potential for irreversible destruction and therefore the latter condition needs prolonged antibiotic treatment [9]. In this review, we give an overview of C. trachomatis strain typing and high-resolution strain typing in epidemiological and clinical studies to elucidate transmission networks for targeted prevention and &
62
www.co-infectiousdiseases.com
Typing requires genetic polymorphism within a species. Polymorphism arises because pathogens adapt to different environments such as the host immune response. In C. trachomatis evolution and diversification, the bacterial outer membrane proteins (OMPs) are crucial.
Serotyping Since the 1960s, serotyping of C. trachomatis was based on characterizing the major outer membrane protein (MOMP), also named OMP1 or OMPA, using specific antibodies [10]. The earliest assays used polyvalent mouse antiserum in an indirect microimmunofluorescence method [11,12]. In that way, 15 different OMPA types could be discerned representing the currently recognized 12 serotypes A to L, with subtypes B and Ba and L1, L2 and L3 [10,13]. Some years later, specific monoclonal antibodies against OMPA were successfully used for typing [14]. Serotyping was performed on cultured chlamydial elementary bodies isolated from HeLa cells infected with liquefied clinical samples. The elementary bodies were either tested in a radioimmunoassay or in an ELISA-type assay to identify the serovar type [14]. As this serotyping required propagation of C. trachomatis in cell cultures, it was an insensitive and rather cumbersome technique.
Molecular typing With molecular techniques, clinical isolates can be directly genotyped without the need for cultivation. This is done by sequence analysis of the ompA gene encoding for the OMPA protein, producing a genovar type with the same letter-based nomenclature as in serology. The ompA gene is 1.2 kb long and contains four highly polymorphic, variable segments, VS-1 to VS-4, with lengths of 40–100 bp, flanked by five constant domains (Fig. 1) [15]. Typing of clinical specimens requires amplification by PCR using specific primers. The PCR-amplified ompA fragment can be quickly typed using restriction enzymes with the restriction fragment length polymorphism (RFLP) method [16–19]. Alternatively, nucleotide sequence analysis is performed, after PCR amplification of relevant parts of the VS-1 to VS-4 regions of ompA, with the VS-2 region being the most discriminatory domain [20–23]. Concordance between serotyping and ompA RFLP genotyping was shown Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al.
CS-1
CS-2 VS-1
CS-3 VS-2
CS-4 VS-2
CS-5 VS-4
CT omp1 gene
GATAATGAAAATCAAAGCACGGTCAAAAAGGATGCT---GTACCAAATATGAGCTTTGATCAATCT Ll GATAATGAGAACCATGCTACAGTTTCAGATAGTAAGCTTGTACCAAATATGAGCTTTGATCAATCT L2 GATAATGAGAACCATACTACAGTTTCAGATAGTAAGCTTGTACCAAATATGAGCTTAGATCAATCT L2a GATAATGAGAACCATACTACAGTTTCAGATAGTAAGCTTGTACCAAATATGATCTTAGATCAATCT L2' ACAAAAACACAATCTACTAACTTTAATACAGCGAAGCTTGTTCCTAACACTGCTTTGGATCAAGCT L3 Our patients : L2b (new)
L2a L2'
L2
GATAGTGAGAACCATGCTACAGTTTCAGATAGTAAGCTTGTACCAAATATGAGCTTAGATCAATCT L2b
AGT = Serine: L2b AAA = Lysine: LJ AAT = Asp: L2 L2' L2a L1
aa = 162
GCT = Alanine : L2b, L2 AGC = Serine : L1 ACT = Threonine: L2a L2' L3
aa = 166
TTA = Leucine: L2b, L2' L2a TTT = Phenylalanine: L2 TTG = Leucine: L1 L3
aa = 179
FIGURE 1. Schematic overview of the Chlamydia trachomatis ompA (omp1) gene. Discriminatory mutations in the variable segment 2 (VS-2) region define the difference between the L1, L2, and L3 genovars. Schematic representation of the ompA gene. In detail, variable segment 2 (VS-2): nucleotide and amino acid (aa) sequence comparison of the prototypes L1, L2, L2a, L20 , and L3 and the newly identified lymphogranuloma venereum (LVG) strain, which we designated as ‘L2b’. Conserved nucleotides in VS-2 for all LGV strains are shown in blue. The nucleotide substitutions in L2b compared to all LGV strains are indicated by arrows. All amino acids encoded by the substitution combinations are indicated. CS, constant segment; omp, outer membrane protein. Reproduced with permission [15].
to be around 95% [17]. The RFLP technique is faster and easier to perform. Sequence analysis of the complete ompA variable segment regions, however, provides the ultimate discrimination including silent mutations. As the bacterial load in clinical specimens may be low, a nested PCR was developed to analyze the relevant VS-2 region of the ompA gene [16,24]. As this is a single-locus typing method, the discriminatory power is low (Table 1).
HIGH-RESOLUTION TYPING: MULTILOCUS VARIABLE NUMBER TANDEM-REPEAT ANALYSIS AND MULTILOCUS SEQUENCE TYPING The discriminatory power of C. trachomatis typing is increased when information on multiple parts of the genome and plasmid are obtained. One method to distinguish C. trachomatis stains is to use tandem repeat sequence polymorphism. Between strains, the number of these repeats varies, resulting in loci
with a ‘variable number of tandem repeats’ (VNTR). Several of these genomic VNTR loci are used in a technique called multilocus VNTR analysis (MLVA). A VNTR locus can be simply described by the number of repeats present in that C. trachomatis strain. The extent of repetition results in a sequence type that is used for cluster analysis (see below). MLVA has increased discriminatory power compared to techniques using only ompA typing (Table 1) [25–27]. The combination of MLVA and ompA typing is a relatively fast and discriminatory technique [28]. Multilocus sequence typing (MLST) is another typing method that uses data from several polymorphic loci. In MLST, each locus is sequenced and assigned an allele number per locus. A string of allele numbers constitutes a profile of the strain and each unique profile is designated a sequence type. This was performed with approximately seven household genes [29,30]. The ‘household gene MLST’ discriminates Chlamydiaceae on the level of the
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
63
Sexually transmitted diseases Table 1. Comparison of different typing techniques of Chlamydia trachomatis Technical complexity
Time to resulta (estimated, in days)
þþþ
5
Low
0.5
þþ
3
Medium
0.78
MLVA
þ
2
Low
0.96
MLST
þþ
3
Medium
WGS-SNP
þþ
7
High
Typing method Serotyping ompA sequence
Relative costs per sample
Discriminatory power (HG-DI)b
0.96 >0.96
HG-DI, Hunter and Gaston’s modification of Simpson’s index of diversity; MLST, multilocus sequence typing; MLVA, multilocus variable number tandem repeat analysis; WGS–SNP, whole-genome sequencing–single-nucleotide polymorphism. a Estimated time to result includes data analysis. b Discriminatory power is quantified using the Hunter and Gaston’s modification of Simpson’s index of diversity. The formula used to define Simpson’s index of Ps 1 diversity (D) is D ¼ 1 NðN1Þ j¼1 xj ðxj 1Þ, in which, N is the number of unrelated strains tested, s the number of different types, and xj the number of strains belonging to the jth type. The D-value is a value between 0 and 1, and typing methods with values of 0.95 or higher are considered very suitable for molecular typing. For more details, see Ref. [33].
genus (see chlamydia.mlst.net/), and can also be used to discriminate the genovar strains of C. trachomatis associated with ocular, urogenital, and invasive (LGV) infections (Fig. 2) [29]. Klint et al. [31] first reported that it is possible to obtain a higher level of discrimination within the C. trachomatis species by choosing highly polymorphic genetic regions for typing instead of the conserved household genes. We improved this technique by using nested PCR prior to sequencing, thus increasing the sensitivity. This enabled typing of many clinical samples, even those with a low bacterial load [32–34]. The genetic loci used in MLVA and high-resolution MLST proved to be very stable in multiple rounds of cell division, thus ensuring their use in short-term transmission chains in human hosts [35]. The sequence types of this ‘highresolution multi locus sequence typing (MLST)’ technique are available online (mlstdb.bmc.uu.se/). The discriminatory indexes of MLVA and MLST are much higher compared with serovar or genovar typing (Table 1) [24,36].
WHOLE-GENOME AND SINGLENUCLEOTIDE POLYMORPHISM ANALYSIS Analysis of the first few complete genomes showed more than 95% sequence identity between C. trachomatis strains [37,38 ]. Whole-genome sequencing (WGS) of different C. trachomatis strains provided a wealth of data on the similarities and discordances of several genomes with different genovar (ompA) types (see http://www.sanger.ac. uk/resources/downloads/bacteria/chlamydia-trachom atis.html). Until recently, WGS could only be performed on cultured samples containing large quantities of complete C. trachomatis genomes. Cultivation is not only labor intensive, but also may &&
64
www.co-infectiousdiseases.com
introduce bias as some clinical strains may not grow. Comparison of full genomes identified the most polymorphic regions (ompA, pmpH, inc, CT144, CT058) and single-nucleotide polymorphisms (SNPs) within more conserved regions, which could now be included to define C. trachomatis strains (Fig. 3) [38 ]. Attempts to perform WGS on noncultured C. trachomatis samples have been described recently [39,40 ]. One approach involved the use of MOMPbinding antibodies that are attached to magnetic beads to pull down C. trachomatis infected cells from native clinical samples [40 ,41]. Unfortunately, this technique cannot be used on samples collected in devices for commercial assays that contain a lysis buffer which disrupts the MOMP structure, thus preventing antibody binding. Another cell-culture-independent WGS assay uses microdroplet PCR in a multiplex setting to enrich for chlamydial sequences in crude diagnostic DNA extracts. After next-generation sequencing, C. trachomatis genomes were partly reconstituted and could be compared for SNPs using the existing known sequences [39]. The sensitivity of WGS analysis on clinical samples still needs to be improved. &&
&&
&&
CLUSTER AND NETWORK ANALYSIS OF SEQUENCE TYPING DATA To better understand the interrelatedness of generated sequence types in MLVA and MLST analysis, minimum spanning trees (MSTs) are constructed as visual tools. Aggregating the epidemiological, clinical and geographical data of the hosts to the sequence types generated by MLST or MLVA allows for molecular epidemiological studies. MSTs may thus be used to unveil sexual partner networks Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
T
G15s ST14: s 14s J27 s,G 16: 13 ST 1: G 2 ST 20p 1: H
46
,I Ia
H
, 2s
5:
ST3
:D 23
T
7e a5
nl ST 9: J ST2 9: H ,Ja 21p ST24: Ia24s, Ia 25s
23p
p G16
S S
l
4n
ST 28: Ia
26: ST
Cluster I
D43nl ST20: ST15: K42nl,K49nl ST8: K
High-resolution typing of Chlamydia trachomatis de Vries et al.
J4 p, I22 s, 87e 8 1 E , H 7: nl T1 40 S
p 17 :G ,H 27 83s T S 19: D : G 0 ST ST3
s 84 5: D : D ST2
ST12: A48t,A59t,B50t, B60t,B61t,B62t,Ba52t
s
:C
33
C
32
:C
Subcluster I
37
13
n
ST
: 43
35
S
93
l
C
8n
79
F3
: 32
12s
,F
1s
ST
, 30n n,C n C29 n,C37 , n 36 C1 4 4: 34n,C T S C
1 ,F
0s F1 35: T S l E39n T36:
70 S
3s
ST38: D
ST
, E7 p, E 5
F, F Ja 8p, 41n F9 l, J p, E 5 a4 7n s, E 19e l
,
nl,
E28
e, E
55e
, E5
6e,
E6p
E4s 40: ST
34:
8t
ST 42:
C3 1n
T
S
Cluster III
T
S
T
B 6:
Ja
:D a
n,
: 41
T
T
S
26
n
11
S
ST
74
t B53 10: :A ST Ba 22 T 8: S 1 ST
:H ST3 I ST7:
51t
4: A
2 ST
ST 39
: E,
E45
0.0005
99`
33:
ST l 85n L2b
L2, L254s, L2a, L2b86nl, L3
ST1: L1,
8nl,
4 L2b
Cluster II
FIGURE 2. Phylogenetic minimum evolution tree based on the concatenated sequences of seven household genes included in an multilocus sequence typing (MLST) scheme. The tree was constructed using the matrix of pairwise differences between the 87 concatenated sequences for the seven loci using maximum composite likelihood method for estimating genetic distances. Numbers are bootstrap values (1000 replicates) greater than 70%. Lavender, invasive lymphogranuloma venereum (LGV); gold, noninvasive, nonprevalent sexually transmitted infection (STI) strains; red, trachoma strains; blue, noninvasive, highly prevalent STI strains; green, putative recombinant stains. Scale bar indicates number of substitutions per site. Reproduced with permission [29]. Available from http://www.cdc.gov/EID/content/15/9/1385.htm). 0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
65
10 00 00 0
90 00 00
80 00 00
70 00 00
60 00 00
50 00 00
40 00 00
30 00 00
20 00 00
10 00 00
Sexually transmitted diseases
L2b/UCH-2 L2b/Ams5 L2b/UCH-1 L2b/Ams4 L2b/Ams2 L2b/Ams1 L2b/CV204 L2b/LST L2b/795 L2b/Ams3 L2b/Canada2 L2b/Canada1 L2b/8200/07 L1/1322/p2 L2/434/BU L2/25667R L1/224 L1/115 L3/404/LN L1/440/LN D/UW3/CX D/SotonD5 G/SotonG1 K/SotonK1 D/SotonD6 G/11222 G/9301 G/9768 G/11074 Ia/SotonIa3 Ia/SotonIa1 J/6276 A/2497 A/5291 A/363 A/7249 B/TZ1A828/OT B/Jali20 A/HAR-13 E/SW3 E/150 E/SW2 E/SotonE8 E/SotonE4 E/Bour E/11023 F/SotonF3 F/SW5 D(s)/2923 D/SotonD1 F/SW4 F(s)/70
1000.0
0.147
1
2
0.123
13.877
3
4 5
6
Non-homoplasic sites
Homoplasic sites
Recombinations
FIGURE 3. Whole-genome sequences of 51 Chlamydia trachomatis strains shown in a phylogenetic tree. Also, the location of SNPs and hotspots of mutations are shown next to the tree. Reconstruction of recombination events on the species phylogeny of C. trachomatis. The top line represents the full chromosome structure of C. trachomatis based on the L2/434/BU strain, with coding sequences represented as blue boxes on the relevant coding strand. The numbers indicate the position in the genome alignment, beginning at CTL0001 (L2/434/BU GenBank accession code AM884176). Each horizontal track represents the chromosome of a strain in the species phylogeny on the left. Blocks shown on the tracks represent the location of received homologous replacements, with their color corresponding to the color of the donor branch on the tree. Tree branches and taxon names are colored by phylogenetic distance, with more similar colors representing more closely related branches. Regions of interest along the genome are highlighted immediately below the recombination tracks. Shown below are plots of the density of nonhomoplasic SNP sites, homoplasic SNP sites, and recombination events based on a moving window analysis. The window size used was 2000 bp. SNP, single-nucleotide polymorphism. Reproduced with permission [38 ]. &&
containing individuals who are all infected by the same pathogen strain, propagated via sexual contact (Fig. 4) [42 ]. As described earlier, MSTs are construed by aligning the sequence types generated via MLVA or MLST. If sequence types are identical, they are assumed to belong to the same C. trachomatis strain. This is graphically represented in an MST by a circle, in which the size of the circle is proportional to the number of sequence types found in a population (Fig. 4). Single-locus variants (SLVs) are strains that differ from one another at one locus only. From an evolutionary viewpoint, they are considered to be &
66
www.co-infectiousdiseases.com
closely interrelated. On the basis of the arbitrary number of varying loci allowed for, sequence types can be considered to belong to the same cluster. In most studies, all strains that differ by, at most, one SLV from a neighbouring sequence type are considered to belong to the same C. trachomatis strain cluster. Strain clusters are used to describe a network of hosts sharing the same C. trachomatis strains [24]. These MSTs indicate the need to reconsider the ompA single-gene-based nomenclature, as there is a disparity between ompA-based clusters and MLSTbased clusters. The discongruence between ompA and the remaining parts of the genome is becoming Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al.
Cluster IV L2, L2b (n = 34)
Cluster I G, J (n = 128)
Cluster VIII I (n = 25)
Cluster V D, F, J (n = 71)
Cluster III D (n = 10)
Cluster II D (n = 80)
Cluster VI E (n = 77)
Cluster VII E (n = 26)
FIGURE 4. Minimum spanning tree based on multi locus sequence typing, showing the sexual orientation of the host of 526 Chlamydia trachomatis-positive samples from men who have sex with men (MSM) and heterosexuals in Amsterdam between July 2008 and May 2010. Sizes of the node discs are proportional to the number of samples of each sequence type; branches show single-locus variants (SLVs); halos indicate clusters based on SLV; and letters indicate ompA genovar type. The color coding is as follows: pink, MSM only (n ¼ 262); green, men who have sex with men and women (n ¼ 8); and blue, heterosexual men and women (n ¼ 256). Reproduced with permission [42 ]. &
increasingly clear with the availablitiy of richer and more refined sequence data [37,38 ,39,40 ]. In addition, earlier reports of mosaic ompA gene structures indicated that ompA or parts of ompA may be exchanged between C. trachomatis strains [35].
high-resolution typing, sexual networks can be unveiled with unprecedented precision and less bias. A selection of these endeavors is described below.
MOLECULAR TYPING APPLIED
As a result of the ongoing exposure, recurrent STIs are a main problem amongst high-risk groups, and recurrent C. trachomatis infections are very common amongst young adults [1]. Proper interpretation of repeated detection of C. trachomatis after treatment is important for monitoring patient management, partner notification and treatment evaluation. Redetection of C. trachomatis after treatment can indicate first, a new infection by another infected (new) partner; second, re-infection
&&
&&
In recent years, molecular typing methods have been increasingly used to elucidate various clinical, evolutionary and epidemiological questions. Before molecular typing methods became available, STI transmission network analysis was performed using source and contact tracing. This is laborious and also biased by (often socially desirable) information provided by the infected index patient and potentially moralistic attitudes of interviewers. With
Typing to monitor treatment efficacy, persistence, and re-infections
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
67
Sexually transmitted diseases
because of re-exposure to a parner not identified or inadequately managed via partner notification; and third, persistence because of treatment failure. Comparing the C. trachomatis strains by typing before and after treatment can help to identify the cause of the redetection. Strain discordance excludes explanations second and third. Strain concordance is less discriminatory: it can either be caused by re-exposure to the original source or persistence. In a study in STI clinic visitors with repeat C. trachomatis infections, high-resolution MLST and ompA genovar typing were compared to discriminate between re-infection, new infection or persistence [43]. Many cases (37%) showed the same sequence type C. trachomatis strain after 6 months, suggesting re-infection through re-exposure to the original source or persistence. The authors concluded that partner treatment remains essential as well as retesting C. trachomatis patients after 6 months.
Lymphogranuloma venereum amongst men who have sex with men Historically, LGV was considered an STI confined to tropical climate areas [44]. In 2003, an epidemic was unveiled in Europe, North America and Australia amongst mainly HIV co-infected men who have sex with men (MSM) [45]. Sequencing of the ompA gene demonstrated that all LGV-positive samples in Amsterdam contained a new C. trachomatis genovariant, designated genovar L2b (Fig. 1) [15]. A retrospective study showed that L2b already circulated amongst MSM in San Francisco in 1981 [46]. This indicated it was a rather slow epidemic that had gone unnoticed for more than 20 years amongst MSM in high-income countries [47]. Increasing numbers of LGV cases were reported over recent years in the UK, Amsterdam, Barcelona, and Madrid [48 ]. Most infections were anorectal; LGV is rarely reported at urogenital or pharyngeal sites [49,50]. Until to date, the LGV epidemic caused by L2b strains remains confined to the MSM community, although isolated cases of heterosexual transmission have been described [51]. Recently, new LGV strains L2c (a recombinant of L2 and D strains) and L2/L2f have been identified which may be associated with different pathophysiological and clinical characteristics [52,53]. Bacteria of the LGV genovar have no additional genes that account for the differences in disease outcome compared to genovars D-K, but in both the circular genome and the plasmid of LGV many genes differ in their sequences compared with other genovars [37,38 ]. It is therefore expected that in the near future, genotyping and phenotyping will elucidate the invasive, more pathogenic nature of LGV strains. &
&&
68
www.co-infectiousdiseases.com
Clinical relevance of lymphogranuloma venereum typing It is of relevance to differentiate patients with LGV infections from those infected with a nonLGV genovar. First, a more extensive treatment is needed for anorectal infections caused by LGV compared with non-LGV strains: 3 weeks of doxycycline versus 1 week, respectively [54]. Second, LGV is a more destructive infection, sometimes requiring additional clinical management and follow-up. Third, LGV is more common in MSM with HIV-1 and hepatitis C infection; therefore, these two infections must be excluded [55]. We recently reported that a significant proportion (27.2%) of anorectal LGV infections in Amsterdam were asymptomatic upon presentation [48 ]. Thus, LGV typing of C. trachomatis-positive anorectal samples is important in symptomatic as well as asymptomatic MSM. It is recommended to screen all MSM who report receptive anal sex in the previous 6 months for anorectal C. trachomatis infection [9,56], and subsequently type C. trachomatispositive rectal samples for LGV [57,58]. &
New variant C. trachomatis strain, diagnostic resistance In 2006, following an unexplained drop in the number of reported C. trachomatis infections in two counties in Sweden, a new strain called ‘new variant C. trachomatis’ (nvCt) was found, characterized by a 377 bp deletion in the plasmid pLGV 440 gene [6]. This deletion is located in the target area of some commercially available diagnostic tests for urogenital C. trachomatis infections. As a result, these tests failed to detect nvCt infections, which subsequently offered the organism an advantage [59,60]. The spread of nvCt remained confined to Scandinavia [7,61]. The nvCt was the first reported example of a mutant that caused microbial diagnostic resistance. Its discovery prompted companies to adjust their diagnostic tests quickly, using in some cases multiple genetic regions for target detection. It has been shown that functional gene loss and regions of heightened sequence variation are important sites for interstrain recombination [62] and gene transfer between C. trachomatis genovars [52,63 ]. This could change the clinical C. trachomatis pathophysiology and complicate diagnostics and therapeutic interventions. Therefore, C. trachomatis sequence typing for surveillance purposes is needed to monitor the emerging mutations that circulate in populations. &
Epidemiological studies With low-resolution typing methods based on the ompA gene, it was previously shown that there is a Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al.
surprising homogeneity of C. trachomatis strains amongst heterosexuals from different international regions [64–66]. This homogeneity over large geographical distances was nuanced by the recent studies using the high-resolution MLST typing method. In a comparison of C. trachomatis strains circulating amongst heterosexuals from Nanjing and Amsterdam, it was found that most strains were specific to Nanjing, but some clustered with strains from Amsterdam, showing worldwide spread of certain C. trachomatis strains [33]. Low-resolution typing methods also suggested some overlap in the C. trachomatis genovar distribution amongst heterosexuals and MSM. Using our high-resolution MLST typing method, we were able to show distinct networks of C. trachomatis amongst heterosexuals and MSM: the previously suggested overlap by the less discriminatory ompA typing proved not to exsist (Fig. 4) [42 ]. Also, the genetic diversity in the MSM clusters was found to be much lower than in heterosexual clusters. These findings were also shown in international comparisons [67 ]. MLST analysis identified the L2b (LGV) strain to circulate preferentially amongst specific subpopulations within the MSM community (leather, military, rubber/Lycra, or jeans scenes) in Amsterdam [32]. The high degree of clonality found in C. trachomatis strains amongst MSM could be explained by network-associated factors (i.e. sexual host behavior), but bacterial factors (like tissue tropism) may play a role as well, although the indications for the latter are weak [68]. The MLST method was also used to assess whether Surinamese migrants living in the Netherlands might form a bridging population for C. trachomatis transmission between native Surinamese in Suriname and native Dutch in the Netherlands [34]. Although sexual mixing between migrants and the native populations both in Suriname and the Netherlands was frequently reported, the MLST cluster distributions did not differ significantly between migrants who mixed and those who did not. It was therefore concluded that Surinamese migrants did not seem to form a bridge population for C. trachomatis transmission between the native populations. &
&
CONCLUSION C. trachomatis is a highly prevalent STI pathogen, and therefore an important candidate when the transmission of STIs in sexual networks is studied. Molecular high-resolution typing techniques have caused a breakthrough in the revelation of previously hard-to-study transmission networks. Linking hosts infected by genetically identical or closely
related strains can reveal transmission networks. With high-resolution CT-MLST, we were able to identify high-risk groups for LGV within the MSM community. This helped in the formulation of targeted prevention and screening campaigns. High-resolution C. trachomatis typing has direct clinical value to identify LGV infections. Although several, commercial, high-throughput platforms for the detection of C. trachomatis are available, none offer the possibility to discriminate between a nonLGV and a LGV infection. Therefore, validated ‘in house’ or new commercial assays are required to identify L genovar C. trachomatis strains in routine samples; this will enhance the control of the still ongoing LGV epidemic. Probably, with WGS, the pathophysiological mechanisms of LGV C. trachomatis strains will be elucidated. The discovery of nvCt in Sweden as the first example of microbial diagnostic resistance revealed the weakness of modern molecular diagnostic tests based on a single locus. This led to the concept of multilocus diagnostic testing, which should prevent future emergence of strains that evade diagnostic detection. High-resolution molecular typing has improved diagnosis, increased our understanding of the epidemiology, and the evolution of C. trachomatis. Acknowledgements None. Financial support and sponsorship This work was supported by the Infectious Diseases Cluster, Public Health Service Amsterdam, Amsterdam, the Netherlands. Conflicts of interest There are no conflicts of interest.
REFERENCES AND RECOMMENDED READING Papers of particular interest, published within the annual period of review, have been highlighted as: & of special interest && of outstanding interest 1. Peipert JF. Clinical practice. Genital chlamydial infections. N Engl J Med 2003; 349:2424–2430. 2. Prevalence and incidence of selected sexually transmitted infections, Chlamydia trachomatis, Neisseria gonorrhoeae, syphilis, and Trichomonas vaginalis: methods and results used by WHO to generate 2005 estimates. Vol. 2014. WHO; 2011. Available at: http://whqlibdoc.who.int/publications/ 2011/9789241502450_eng.pdf?ua¼1 [Accessed 3 December 2014]. 3. Jackson LJ, Auguste P, Low N, Roberts TE. Valuing the health states associated with Chlamydia trachomatis infections and their sequelae: a systematic review of economic evaluations and primary studies. Value Health 2014; 17:116–130. 4. Van den Broek IV, van Bergen JE, Brouwers EE, et al. Effectiveness of yearly, register based screening for Chlamydia in the Netherlands: controlled trial with randomised stepped wedge implementation. BMJ 2012; 345:e4316.
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
69
Sexually transmitted diseases 5. Tam JE, Davis CH, Thresher RJ, Wyrick PB. Location of the origin of replication for the 7.5-kb Chlamydia trachomatis plasmid. Plasmid 1992; 27:231–236. 6. Ripa T, Nilsson P. A variant of Chlamydia trachomatis with deletion in cryptic plasmid: implications for use of PCR diagnostic tests. Euro Surveill 2006; 11:E061109.2. 7. Metzgar D. Adaptive evolution of diagnostic resistance. J Clin Microbiol 2011; 49:2774–2775. 8. De Vrieze NH, de Vries HJ. Lymphogranuloma venereum among men who & have sex with men. An epidemiological and clinical review. Expert Rev Anti Infect Ther 2014; 12:697–704. This review discusses the microbiological, epidemiological, and clinical aspects of the ongoing detected LGV epidemic amongst MSM. 9. De Vries HJC, Zingoni A, Kreuter A, et al. 2013 European guideline on the management of lymphogranuloma venereum. J Eur Acad Dermatol Venereol 2014. (in press). 10. Grayston JT, Wang S. New knowledge of chlamydiae and the diseases they cause. J Infect Dis 1975; 132:87–105. 11. Caldwell HD, Schachter J. Antigenic analysis of the major outer membrane protein of Chlamydia spp. Infect Immun 1982; 35:1024–1031. 12. Barnes RC, Wang SP, Kuo CC, Stamm WE. Rapid immunotyping of Chlamydia trachomatis with monoclonal antibodies in a solid-phase enzyme immunoassay. J Clin Microbiol 1985; 22:609–613. 13. Schachter J. Chlamydial infections (third of three parts). N Engl J Med 1978; 298:540–549. 14. Batteiger BE, Newhall WJt, Terho P, et al. Antigenic analysis of the major outer membrane protein of Chlamydia trachomatis with murine monoclonal antibodies. Infect Immun 1986; 53:530–533. 15. Spaargaren J, Fennema HS, Morre SA, et al. New lymphogranuloma venereum Chlamydia trachomatis variant, Amsterdam. Emerg Infect Dis 2005; 11:1090–1092. 16. Lan J, Ossewaarde JM, Walboomers JM, et al. Improved PCR sensitivity for direct genotyping of Chlamydia trachomatis serovars by using a nested PCR. J Clin Microbiol 1994; 32:528–530. 17. Morre SA, Ossewaarde JM, Lan J, et al. Serotyping and genotyping of genital Chlamydia trachomatis isolates reveal variants of serovars Ba, G, and J as confirmed by omp1 nucleotide sequence analysis. J Clin Microbiol 1998; 36:345–351. 18. Gaydos CA, Bobo L, Welsh L, et al. Gene typing of Chlamydia trachomatis by polymerase chain reaction and restriction endonuclease digestion. Sex Transm Dis 1992; 19:303–308. 19. Rodriguez P, Vekris A, de Barbeyrac B, et al. Typing of Chlamydia trachomatis by restriction endonuclease analysis of the amplified major outer membrane protein gene. J Clin Microbiol 1991; 29:1132–1136. 20. Dean D, Patton M, Stephens RS. Direct sequence evaluation of the major outer membrane protein gene variant regions of Chlamydia trachomatis subtypes D0 , I0 , and L20 . Infect Immun 1991; 59:1579–1582. 21. Dean D, Millman K. Molecular and mutation trends analyses of omp1 alleles for serovar E of Chlamydia trachomatis. Implications for the immunopathogenesis of disease. J Clin Invest 1997; 99:475–483. 22. Yang CL, Maclean I, Brunham RC. DNA sequence polymorphism of the Chlamydia trachomatis omp1 gene. J Infect Dis 1993; 168:1225–1230. 23. Yuan Y, Zhang YX, Watkins NG, Caldwell HD. Nucleotide and deduced amino acid sequences for the four variable domains of the major outer membrane proteins of the 15 Chlamydia trachomatis serovars. Infect Immun 1989; 57:1040–1049. 24. Bom RJ, Christerson L, Schim van der Loeff MF, et al. Evaluation of highresolution typing methods for Chlamydia trachomatis in samples from heterosexual couples. J Clin Microbiol 2011; 49:2844–2853. 25. Pedersen LN, Podenphant L, Moller JK. Highly discriminative genotyping of Chlamydia trachomatis using omp1 and a set of variable number tandem repeats. Clin Microbiol Infect 2008; 14:644–652. 26. Ikryannikova LN, Shkarupeta MM, Shitikov EA, et al. Comparative evaluation of new typing schemes for urogenital Chlamydia trachomatis isolates. FEMS Immunol Med Microbiol 2010; 59:188–196. 27. Satoh M, Ogawa M, Saijo M, Ando S. Multilocus VNTR analysis-ompA typing of venereal isolates of Chlamydia trachomatis in Japan. J Infect Chemother 2014; 20:656–659. 28. Wang Y, Skilton RJ, Cutcliffe LT, et al. Evaluation of a high resolution genotyping method for Chlamydia trachomatis using routine clinical samples. PLoS One 2011; 6:e16971. 29. Dean D, Bruno WJ, Wan R, et al. Predicting phenotype and emerging strains among Chlamydia trachomatis infections. Emerg Infect Dis 2009; 15:1385– 1394. 30. Pannekoek Y, Morelli G, Kusecek B, et al. Multi locus sequence typing of Chlamydiales: clonal groupings within the obligate intracellular bacteria Chlamydia trachomatis. BMC Microbiol 2008; 8:42. 31. Klint M, Fuxelius HH, Goldkuhl RR, et al. High-resolution genotyping of Chlamydia trachomatis strains by multilocus sequence analysis. J Clin Microbiol 2007; 45:1410–1414. 32. Bom RJ, Matser A, Bruisten SM, et al. Multilocus sequence typing of Chlamydia trachomatis among men who have sex with men reveals cocirculating strains not associated with specific subpopulations. J Infect Dis 2013; 208:969–977.
70
www.co-infectiousdiseases.com
33. Bom RJ, van den Hoek A, Wang Q, et al. High-resolution typing reveals distinct Chlamydia trachomatis strains in an at-risk population in Nanjing, China. Sex Transm Dis 2013; 40:647–649. 34. Bom RJ, van der Helm JJ, Bruisten SM, et al. The role of Surinamese migrants in the transmission of Chlamydia trachomatis between Paramaribo, Suriname and Amsterdam, The Netherlands. PLoS One 2013; 8:e77977. 35. Labiran C, Clarke IN, Cutcliffe LT, et al. Genotyping markers used for multi locus VNTR analysis with ompA (MLVA-ompA) and multi sequence typing (MST) retain stability in Chlamydia trachomatis. Front Cell Infect Microbiol 2012; 2:68. 36. Van Belkum A, Tassios PT, Dijkshoorn L, et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect 2007; 13 (Suppl. 3):1–46. 37. Clarke IN. Evolution of Chlamydia trachomatis. Ann N Y Acad Sci 2011; 1230:E11–E18. 38. Harris SR, Clarke IN, Seth-Smith HM, et al. Whole-genome analysis of diverse && Chlamydia trachomatis strains identifies phylogenetic relationships masked by current clinical typing. Nat Genet 2012; 44:413–419; S411. This is one of the first studies presenting a large body of sequences contributing to the full-genome database of C. trachomatis, see Fig. 3. 39. Joseph SJ, Li B, Ghonasgi T, et al. Direct amplification, sequencing and profiling of Chlamydia trachomatis strains in single and mixed infection clinical samples. PLoS One 2014; 9:e99290. 40. Seth-Smith HM, Harris SR, Skilton RJ, et al. Whole-genome sequences of && Chlamydia trachomatis directly from clinical samples without culture. Genome Res 2013; 23:855–866. In this study, whole-genome Chlamydia trachomatis sequences are for the first time produced from direct clinical samples. 41. Seth-Smith HM, Harris SR, Scott P, et al. Generating whole bacterial genome sequences of low-abundance species from complex samples with IMS-MDA. Nat Protoc 2013; 8:2404–2412. 42. Bom RJ, van der Helm JJ, Schim van der Loeff MF, et al. Distinct transmission & networks of Chlamydia trachomatis in men who have sex with men and heterosexual adults in Amsterdam, The Netherlands. PLoS One 2013; 8:e53869. This study revealed that the overlap in genovars between strains circulating amongst heterosexuals and MSM hides the almost complete separation of C. trachomatis clusters (based on MLST) circulating in these two sexual subgroups. 43. Gotz HM, Bom RJ, Wolfers ME, et al. Use of Chlamydia trachomatis highresolution typing: an extended case study to distinguish recurrent or persistent infection from new infection. Sex Transm Infect 2014; 90:155–160. 44. De Vries HJ, Reddy BS, Khandpur S. Lymphogranuloma Venereum. In: Gupta S, Kumar B, editors. Sexually transmitted infections, 2nd ed. Elsevier; 2012. pp. 506–521. 45. White JA. Manifestations and management of lymphogranuloma venereum. Curr Opin Infect Dis 2009; 22:57–66. 46. Spaargaren J, Schachter J, Moncada J, et al. Slow epidemic of lymphogranuloma venereum L2b strain. Emerg Infect Dis 2005; 11:1787–1788. 47. Christerson L, de Vries HJ, de Barbeyrac B, et al. Typing of lymphogranuloma venereum Chlamydia trachomatis strains. Emerg Infect Dis 2010; 16:1777– 1779. 48. De Vrieze NH, van Rooijen M, Schim van der Loeff MF, de Vries HJ. Anorectal & and inguinal lymphogranuloma venereum among men who have sex with men in Amsterdam, the Netherlands. trends over time, symptomatology and concurrent infections. Sex Transm Infect 2013; 89:548–552. This article studies the epidemiological and clinical aspects of the LGV epidemic in Amsterdam; it shows that a large proportion of MSM with LGV is asymptomatic, underlining the need to perform typing for LGV of all C. trachomatis-positive anorectal samples of MSM. 49. De Vrieze NH, van Rooijen M, Speksnijder AG, de Vries HJ. Urethral lymphogranuloma venereum infections in men with anorectal lymphogranuloma venereum and their partners: the missing link in the current epidemic? Sex Transm Dis 2013; 40:607–608. 50. Oud EV, de Vrieze NH, de Meij A, de Vries HJ. Pitfalls in the diagnosis and management of inguinal lymphogranuloma venereum: important lessons from a case series. Sex Transm Infect 2014; 90:279–282. 51. Verweij SP, Ouburg S, de Vries H, et al. The first case record of a female patient with bubonic lymphogranuloma venereum (LGV), serovariant L2b. Sex Transm Infect 2012; 88:346–347. 52. Somboonna N, Wan R, Ojcius DM, et al. Hypervirulent Chlamydia trachomatis clinical strain is a recombinant between lymphogranuloma venereum (L(2)) and D lineages. MBio 2011; 2:e00045-11. 53. Rodriguez-Dominguez M, Puerta T, Menendez B, et al. Clinical and epidemiological characterization of a lymphogranuloma venereum outbreak in Madrid, Spain: co-circulation of two variants. Clin Microbiol Infect 2014; 20:219–225. 54. De Vries HJ, Smelov V, Middelburg JG, et al. Delayed microbial cure of lymphogranuloma venereum proctitis with doxycycline treatment. Clin Infect Dis 2009; 48:e53–e56. 55. Van de Laar T, Pybus O, Bruisten S, et al. Evidence of a large, international network of HCV transmission in HIV-positive men who have sex with men. Gastroenterology 2009; 136:1609–1617. 56. De Vries HJ, Zingoni A, White JA, et al. 2013 European guideline on the management of proctitis, proctocolitis and enteritis caused by sexually transmissible pathogens. Int J STD AIDS 2013; 25:465–474.
Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al. 57. Morre SA, Ouburg S, van Agtmael MA, de Vries HJ. Lymphogranuloma venereum diagnostics: from culture to real-time quadriplex polymerase chain reaction. Sex Transm Infect 2008; 84:252–253. 58. Chen CY, Chi KH, Alexander S, et al. A real-time quadriplex PCR assay for the diagnosis of rectal lymphogranuloma venereum and nonlymphogranuloma venereum Chlamydia trachomatis infections. Sex Transm Infect 2008; 84: 273–276. 59. Bjartling C, Osser S, Johnsson A, Persson K. Clinical manifestations and epidemiology of the new genetic variant of Chlamydia trachomatis. Sex Transm Dis 2009; 36:529–535. 60. Unemo M, Clarke IN. The Swedish new variant of Chlamydia trachomatis. Curr Opin Infect Dis 2011; 24:62–69. 61. De Vries HJ, Catsburg A, van der Helm JJ, et al. No indication of Swedish Chlamydia trachomatis variant among STI clinic visitors in Amsterdam. Euro Surveill 2007; 12:; E070208.3. 62. Thomson NR, Holden MT, Carder C, et al. Chlamydia trachomatis: genome sequence analysis of lymphogranuloma venereum isolates. Genome Res 2008; 18:161–171. 63. Joseph SJ, Didelot X, Rothschild J, et al. Population genomics of Chlamydia & trachomatis: insights on drift, selection, recombination, and population structure. Mol Biol Evol 2012; 29:3933–3946. This study is informative on all genomic aspects of Chlamydia trachomatis.
64. Lysen M, Osterlund A, Rubin CJ, et al. Characterization of ompA genotypes by sequence analysis of DNA from all detected cases of Chlamydia trachomatis infections during 1 year of contact tracing in a Swedish County. J Clin Microbiol 2004; 42:1641–1647. 65. Machado AC, Bandea CI, Alves MF, et al. Distribution of Chlamydia trachomatis genovars among youths and adults in Brazil. J Med Microbiol 2011; 60:472–476. 66. Hsu MC, Tsai PY, Chen KT, et al. Genotyping of Chlamydia trachomatis from clinical specimens in Taiwan. J Med Microbiol 2006; 55:301– 308. 67. Christerson L, Bom RJ, Bruisten SM, et al. Chlamydia trachomatis strains & show specific clustering for men who have sex with men compared to heterosexual populations in Sweden, the Netherlands, and the United States. J Clin Microbiol 2012; 50:3548–3555. This important study demonstrated, using MLST, that the C. trachomatis clusters circulating amongst MSM of three countries do not differ, but that there is some variation in strains circulating amongst heterosexuals in these countries. 68. Versteeg B, van Rooijen MS, Schim van der Loeff MF, et al. No indication for tissue tropism in urogenital and anorectal Chlamydia trachomatis infections using high-resolution multilocus sequence typing. BMC Infect Dis 2014; 14:464.
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
71
High-resolution typing of Chlamydia trachomatis: epidemiological and clinical uses Henry J.C. de Vries a,b,c, Maarten F. Schim van der Loeff b,d, and Sylvia M. Bruisten b,e
Purpose of review A state-of-the-art overview of molecular Chlamydia trachomatis typing methods that are used for routine diagnostics and scientific studies. Recent findings Molecular epidemiology uses high-resolution typing techniques such as multilocus sequence typing, multilocus variable number of tandem repeats analysis, and whole-genome sequencing to identify strains based on their DNA sequence. These data can be used for cluster, network and phylogenetic analyses, and are used to unveil transmission networks, risk groups, and evolutionary pathways. High-resolution typing of C. trachomatis strains is applied to monitor treatment efficacy and re-infections, and to study the recent emergence of lymphogranuloma venereum (LGV) amongst men who have sex with men in highincome countries. Chlamydia strain typing has clinical relevance in disease management, as LGV needs longer treatment than non-LGV C. trachomatis. It has also led to the discovery of a new variant Chlamydia strain in Sweden, which was not detected by some commercial C. trachomatis diagnostic platforms. Summary After a brief history and comparison of the various Chlamydia typing methods, the applications of the current techniques are described and future endeavors to extend scientific understanding are formulated. High-resolution typing will likely help to further unravel the pathophysiological mechanisms behind the wide clinical spectrum of chlamydial disease. Keywords Chlamydia trachomatis, molecular epidemiology, molecular typing, multilocus sequence typing, sexually transmitted disease
INTRODUCTION Chlamydia trachomatis urogenital infection is a common sexually transmitted infection (STI) causing a high burden of morbidity such as pelvic inflammatory disease, infertility, and life-threatening conditions like ectopic pregnancy [1]. The WHO estimated that at any point in 2005, there were approximately 98 million adults infected with C. trachomatis (prevalence) and that yearly 101 million new cases of C. trachomatis occurred globally (incidence) [2]. The incidence of C. trachomatis exceeds the prevalence because of the relative short duration of infection compared with other STIs. As a result, the C. trachomatis epidemic is highly dynamic, affecting hundreds of millions of individuals who can become re-infected after treatment or spontaneous clearance. C. trachomatis affects all regions across the globe with prevalence rates amongst adults ranging from 1% in south-east Asia to nearly 6% in the Americas [2].
Identification of those infected is hindered because about three-quarters of infected women and about half of infected men have no symptoms [1]. The cost-effectiveness of population-based screening programmes is under debate, as they have not been shown to reduce the C. trachomatis a
STI Outpatient Clinic, Public Health Service of Amsterdam (GGD Amsterdam), bCenter for Infection and Immunology Amsterdam (CINIMA), Academic Medical Center (AMC), University of Amsterdam, c Department of Dermatology, Academic Medical Center (AMC), University of Amsterdam, dDepartment of Research, Public Health Service of Amsterdam (GGD Amsterdam) and ePublic Health Laboratory, Public Health Service of Amsterdam (GGD Amsterdam), Amsterdam, the Netherlands Correspondence to Henry J.C. de Vries, STI Outpatient Clinic, Public Health Service of Amsterdam (GGD Amsterdam), PO Box 2200, 1000 CE, Amsterdam, the Netherlands. Tel: +31 205555063; e-mail: [email protected] Curr Opin Infect Dis 2015, 28:61–71 DOI:10.1097/QCO.0000000000000129
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Sexually transmitted diseases
KEY POINTS
screening interventions and to monitor mutations of clinical importance.
Multilocus molecular typing methods of Chlamydia trachomatis provide a much better discrimination of C. trachomatis strains compared with traditional serological or ompA only typing methods.
HISTORY OF C. TRACHOMATIS TYPING: FROM SEROVAR TO MOLECULAR TYPING
Molecular typing of C. trachomatis has shown that the urogenital Chlamydia endemics amongst heterosexual men and women on the one hand and homosexual men on the other hand are genetically distinct and not overlapping. In repeat infections, molecular typing methods of C. trachomatis can be used to help distinguish treatment failure from re-infection. As lymphogranuloma venereum (LGV) infections require longer antimicrobial treatment courses than non-LGV C. trachomatis infections, it is of clinical importance to identify LGV strains with molecular typing methods. Whole-genome sequencing demonstrated that recombination and gene transfer between C. trachomatis strains occurs frequently; the diagnostic and clinical impact of these occurrences needs to be elucidated in the coming years.
prevalence [3,4]. Therefore, identifying specific risk groups for C. trachomatis infections is still important to target the limited public health resources. The circular genome of C. trachomatis is just over 1 million bp in length. C. trachomatis bacteria also contain a plasmid of 7.5 kb. As each C. trachomatis bacterium contains one genome but multiple (7–10) copies of the plasmid [5], the latter is often used as a diagnostic target, thus enhancing the sensitivity. In 2006, a new variant C. trachomatis (nvCt) strain was discovered with a plasmid DNA deletion that was missed by some widely used commercial C. trachomatis diagnostic tests [6]. This was the first event of a microbial diagnostic testing failure and demonstrated the importance of genotyping for surveillance purposes [7]. From a clinical point of view, it is relevant to discriminate the most commonly found C. trachomatis strains causing urogenital infections (genovars D to K), from genovar L, causing lymphogranuloma venereum (LGV) [8 ]. Whereas the majority of uncomplicated genovar D-K C. trachomatis infections cause few or no symptoms, LGV is an ulcerative, highly invasive STI with a potential for irreversible destruction and therefore the latter condition needs prolonged antibiotic treatment [9]. In this review, we give an overview of C. trachomatis strain typing and high-resolution strain typing in epidemiological and clinical studies to elucidate transmission networks for targeted prevention and &
62
www.co-infectiousdiseases.com
Typing requires genetic polymorphism within a species. Polymorphism arises because pathogens adapt to different environments such as the host immune response. In C. trachomatis evolution and diversification, the bacterial outer membrane proteins (OMPs) are crucial.
Serotyping Since the 1960s, serotyping of C. trachomatis was based on characterizing the major outer membrane protein (MOMP), also named OMP1 or OMPA, using specific antibodies [10]. The earliest assays used polyvalent mouse antiserum in an indirect microimmunofluorescence method [11,12]. In that way, 15 different OMPA types could be discerned representing the currently recognized 12 serotypes A to L, with subtypes B and Ba and L1, L2 and L3 [10,13]. Some years later, specific monoclonal antibodies against OMPA were successfully used for typing [14]. Serotyping was performed on cultured chlamydial elementary bodies isolated from HeLa cells infected with liquefied clinical samples. The elementary bodies were either tested in a radioimmunoassay or in an ELISA-type assay to identify the serovar type [14]. As this serotyping required propagation of C. trachomatis in cell cultures, it was an insensitive and rather cumbersome technique.
Molecular typing With molecular techniques, clinical isolates can be directly genotyped without the need for cultivation. This is done by sequence analysis of the ompA gene encoding for the OMPA protein, producing a genovar type with the same letter-based nomenclature as in serology. The ompA gene is 1.2 kb long and contains four highly polymorphic, variable segments, VS-1 to VS-4, with lengths of 40–100 bp, flanked by five constant domains (Fig. 1) [15]. Typing of clinical specimens requires amplification by PCR using specific primers. The PCR-amplified ompA fragment can be quickly typed using restriction enzymes with the restriction fragment length polymorphism (RFLP) method [16–19]. Alternatively, nucleotide sequence analysis is performed, after PCR amplification of relevant parts of the VS-1 to VS-4 regions of ompA, with the VS-2 region being the most discriminatory domain [20–23]. Concordance between serotyping and ompA RFLP genotyping was shown Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al.
CS-1
CS-2 VS-1
CS-3 VS-2
CS-4 VS-2
CS-5 VS-4
CT omp1 gene
GATAATGAAAATCAAAGCACGGTCAAAAAGGATGCT---GTACCAAATATGAGCTTTGATCAATCT Ll GATAATGAGAACCATGCTACAGTTTCAGATAGTAAGCTTGTACCAAATATGAGCTTTGATCAATCT L2 GATAATGAGAACCATACTACAGTTTCAGATAGTAAGCTTGTACCAAATATGAGCTTAGATCAATCT L2a GATAATGAGAACCATACTACAGTTTCAGATAGTAAGCTTGTACCAAATATGATCTTAGATCAATCT L2' ACAAAAACACAATCTACTAACTTTAATACAGCGAAGCTTGTTCCTAACACTGCTTTGGATCAAGCT L3 Our patients : L2b (new)
L2a L2'
L2
GATAGTGAGAACCATGCTACAGTTTCAGATAGTAAGCTTGTACCAAATATGAGCTTAGATCAATCT L2b
AGT = Serine: L2b AAA = Lysine: LJ AAT = Asp: L2 L2' L2a L1
aa = 162
GCT = Alanine : L2b, L2 AGC = Serine : L1 ACT = Threonine: L2a L2' L3
aa = 166
TTA = Leucine: L2b, L2' L2a TTT = Phenylalanine: L2 TTG = Leucine: L1 L3
aa = 179
FIGURE 1. Schematic overview of the Chlamydia trachomatis ompA (omp1) gene. Discriminatory mutations in the variable segment 2 (VS-2) region define the difference between the L1, L2, and L3 genovars. Schematic representation of the ompA gene. In detail, variable segment 2 (VS-2): nucleotide and amino acid (aa) sequence comparison of the prototypes L1, L2, L2a, L20 , and L3 and the newly identified lymphogranuloma venereum (LVG) strain, which we designated as ‘L2b’. Conserved nucleotides in VS-2 for all LGV strains are shown in blue. The nucleotide substitutions in L2b compared to all LGV strains are indicated by arrows. All amino acids encoded by the substitution combinations are indicated. CS, constant segment; omp, outer membrane protein. Reproduced with permission [15].
to be around 95% [17]. The RFLP technique is faster and easier to perform. Sequence analysis of the complete ompA variable segment regions, however, provides the ultimate discrimination including silent mutations. As the bacterial load in clinical specimens may be low, a nested PCR was developed to analyze the relevant VS-2 region of the ompA gene [16,24]. As this is a single-locus typing method, the discriminatory power is low (Table 1).
HIGH-RESOLUTION TYPING: MULTILOCUS VARIABLE NUMBER TANDEM-REPEAT ANALYSIS AND MULTILOCUS SEQUENCE TYPING The discriminatory power of C. trachomatis typing is increased when information on multiple parts of the genome and plasmid are obtained. One method to distinguish C. trachomatis stains is to use tandem repeat sequence polymorphism. Between strains, the number of these repeats varies, resulting in loci
with a ‘variable number of tandem repeats’ (VNTR). Several of these genomic VNTR loci are used in a technique called multilocus VNTR analysis (MLVA). A VNTR locus can be simply described by the number of repeats present in that C. trachomatis strain. The extent of repetition results in a sequence type that is used for cluster analysis (see below). MLVA has increased discriminatory power compared to techniques using only ompA typing (Table 1) [25–27]. The combination of MLVA and ompA typing is a relatively fast and discriminatory technique [28]. Multilocus sequence typing (MLST) is another typing method that uses data from several polymorphic loci. In MLST, each locus is sequenced and assigned an allele number per locus. A string of allele numbers constitutes a profile of the strain and each unique profile is designated a sequence type. This was performed with approximately seven household genes [29,30]. The ‘household gene MLST’ discriminates Chlamydiaceae on the level of the
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
63
Sexually transmitted diseases Table 1. Comparison of different typing techniques of Chlamydia trachomatis Technical complexity
Time to resulta (estimated, in days)
þþþ
5
Low
0.5
þþ
3
Medium
0.78
MLVA
þ
2
Low
0.96
MLST
þþ
3
Medium
WGS-SNP
þþ
7
High
Typing method Serotyping ompA sequence
Relative costs per sample
Discriminatory power (HG-DI)b
0.96 >0.96
HG-DI, Hunter and Gaston’s modification of Simpson’s index of diversity; MLST, multilocus sequence typing; MLVA, multilocus variable number tandem repeat analysis; WGS–SNP, whole-genome sequencing–single-nucleotide polymorphism. a Estimated time to result includes data analysis. b Discriminatory power is quantified using the Hunter and Gaston’s modification of Simpson’s index of diversity. The formula used to define Simpson’s index of Ps 1 diversity (D) is D ¼ 1 NðN1Þ j¼1 xj ðxj 1Þ, in which, N is the number of unrelated strains tested, s the number of different types, and xj the number of strains belonging to the jth type. The D-value is a value between 0 and 1, and typing methods with values of 0.95 or higher are considered very suitable for molecular typing. For more details, see Ref. [33].
genus (see chlamydia.mlst.net/), and can also be used to discriminate the genovar strains of C. trachomatis associated with ocular, urogenital, and invasive (LGV) infections (Fig. 2) [29]. Klint et al. [31] first reported that it is possible to obtain a higher level of discrimination within the C. trachomatis species by choosing highly polymorphic genetic regions for typing instead of the conserved household genes. We improved this technique by using nested PCR prior to sequencing, thus increasing the sensitivity. This enabled typing of many clinical samples, even those with a low bacterial load [32–34]. The genetic loci used in MLVA and high-resolution MLST proved to be very stable in multiple rounds of cell division, thus ensuring their use in short-term transmission chains in human hosts [35]. The sequence types of this ‘highresolution multi locus sequence typing (MLST)’ technique are available online (mlstdb.bmc.uu.se/). The discriminatory indexes of MLVA and MLST are much higher compared with serovar or genovar typing (Table 1) [24,36].
WHOLE-GENOME AND SINGLENUCLEOTIDE POLYMORPHISM ANALYSIS Analysis of the first few complete genomes showed more than 95% sequence identity between C. trachomatis strains [37,38 ]. Whole-genome sequencing (WGS) of different C. trachomatis strains provided a wealth of data on the similarities and discordances of several genomes with different genovar (ompA) types (see http://www.sanger.ac. uk/resources/downloads/bacteria/chlamydia-trachom atis.html). Until recently, WGS could only be performed on cultured samples containing large quantities of complete C. trachomatis genomes. Cultivation is not only labor intensive, but also may &&
64
www.co-infectiousdiseases.com
introduce bias as some clinical strains may not grow. Comparison of full genomes identified the most polymorphic regions (ompA, pmpH, inc, CT144, CT058) and single-nucleotide polymorphisms (SNPs) within more conserved regions, which could now be included to define C. trachomatis strains (Fig. 3) [38 ]. Attempts to perform WGS on noncultured C. trachomatis samples have been described recently [39,40 ]. One approach involved the use of MOMPbinding antibodies that are attached to magnetic beads to pull down C. trachomatis infected cells from native clinical samples [40 ,41]. Unfortunately, this technique cannot be used on samples collected in devices for commercial assays that contain a lysis buffer which disrupts the MOMP structure, thus preventing antibody binding. Another cell-culture-independent WGS assay uses microdroplet PCR in a multiplex setting to enrich for chlamydial sequences in crude diagnostic DNA extracts. After next-generation sequencing, C. trachomatis genomes were partly reconstituted and could be compared for SNPs using the existing known sequences [39]. The sensitivity of WGS analysis on clinical samples still needs to be improved. &&
&&
&&
CLUSTER AND NETWORK ANALYSIS OF SEQUENCE TYPING DATA To better understand the interrelatedness of generated sequence types in MLVA and MLST analysis, minimum spanning trees (MSTs) are constructed as visual tools. Aggregating the epidemiological, clinical and geographical data of the hosts to the sequence types generated by MLST or MLVA allows for molecular epidemiological studies. MSTs may thus be used to unveil sexual partner networks Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
T
G15s ST14: s 14s J27 s,G 16: 13 ST 1: G 2 ST 20p 1: H
46
,I Ia
H
, 2s
5:
ST3
:D 23
T
7e a5
nl ST 9: J ST2 9: H ,Ja 21p ST24: Ia24s, Ia 25s
23p
p G16
S S
l
4n
ST 28: Ia
26: ST
Cluster I
D43nl ST20: ST15: K42nl,K49nl ST8: K
High-resolution typing of Chlamydia trachomatis de Vries et al.
J4 p, I22 s, 87e 8 1 E , H 7: nl T1 40 S
p 17 :G ,H 27 83s T S 19: D : G 0 ST ST3
s 84 5: D : D ST2
ST12: A48t,A59t,B50t, B60t,B61t,B62t,Ba52t
s
:C
33
C
32
:C
Subcluster I
37
13
n
ST
: 43
35
S
93
l
C
8n
79
F3
: 32
12s
,F
1s
ST
, 30n n,C n C29 n,C37 , n 36 C1 4 4: 34n,C T S C
1 ,F
0s F1 35: T S l E39n T36:
70 S
3s
ST38: D
ST
, E7 p, E 5
F, F Ja 8p, 41n F9 l, J p, E 5 a4 7n s, E 19e l
,
nl,
E28
e, E
55e
, E5
6e,
E6p
E4s 40: ST
34:
8t
ST 42:
C3 1n
T
S
Cluster III
T
S
T
B 6:
Ja
:D a
n,
: 41
T
T
S
26
n
11
S
ST
74
t B53 10: :A ST Ba 22 T 8: S 1 ST
:H ST3 I ST7:
51t
4: A
2 ST
ST 39
: E,
E45
0.0005
99`
33:
ST l 85n L2b
L2, L254s, L2a, L2b86nl, L3
ST1: L1,
8nl,
4 L2b
Cluster II
FIGURE 2. Phylogenetic minimum evolution tree based on the concatenated sequences of seven household genes included in an multilocus sequence typing (MLST) scheme. The tree was constructed using the matrix of pairwise differences between the 87 concatenated sequences for the seven loci using maximum composite likelihood method for estimating genetic distances. Numbers are bootstrap values (1000 replicates) greater than 70%. Lavender, invasive lymphogranuloma venereum (LGV); gold, noninvasive, nonprevalent sexually transmitted infection (STI) strains; red, trachoma strains; blue, noninvasive, highly prevalent STI strains; green, putative recombinant stains. Scale bar indicates number of substitutions per site. Reproduced with permission [29]. Available from http://www.cdc.gov/EID/content/15/9/1385.htm). 0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
65
10 00 00 0
90 00 00
80 00 00
70 00 00
60 00 00
50 00 00
40 00 00
30 00 00
20 00 00
10 00 00
Sexually transmitted diseases
L2b/UCH-2 L2b/Ams5 L2b/UCH-1 L2b/Ams4 L2b/Ams2 L2b/Ams1 L2b/CV204 L2b/LST L2b/795 L2b/Ams3 L2b/Canada2 L2b/Canada1 L2b/8200/07 L1/1322/p2 L2/434/BU L2/25667R L1/224 L1/115 L3/404/LN L1/440/LN D/UW3/CX D/SotonD5 G/SotonG1 K/SotonK1 D/SotonD6 G/11222 G/9301 G/9768 G/11074 Ia/SotonIa3 Ia/SotonIa1 J/6276 A/2497 A/5291 A/363 A/7249 B/TZ1A828/OT B/Jali20 A/HAR-13 E/SW3 E/150 E/SW2 E/SotonE8 E/SotonE4 E/Bour E/11023 F/SotonF3 F/SW5 D(s)/2923 D/SotonD1 F/SW4 F(s)/70
1000.0
0.147
1
2
0.123
13.877
3
4 5
6
Non-homoplasic sites
Homoplasic sites
Recombinations
FIGURE 3. Whole-genome sequences of 51 Chlamydia trachomatis strains shown in a phylogenetic tree. Also, the location of SNPs and hotspots of mutations are shown next to the tree. Reconstruction of recombination events on the species phylogeny of C. trachomatis. The top line represents the full chromosome structure of C. trachomatis based on the L2/434/BU strain, with coding sequences represented as blue boxes on the relevant coding strand. The numbers indicate the position in the genome alignment, beginning at CTL0001 (L2/434/BU GenBank accession code AM884176). Each horizontal track represents the chromosome of a strain in the species phylogeny on the left. Blocks shown on the tracks represent the location of received homologous replacements, with their color corresponding to the color of the donor branch on the tree. Tree branches and taxon names are colored by phylogenetic distance, with more similar colors representing more closely related branches. Regions of interest along the genome are highlighted immediately below the recombination tracks. Shown below are plots of the density of nonhomoplasic SNP sites, homoplasic SNP sites, and recombination events based on a moving window analysis. The window size used was 2000 bp. SNP, single-nucleotide polymorphism. Reproduced with permission [38 ]. &&
containing individuals who are all infected by the same pathogen strain, propagated via sexual contact (Fig. 4) [42 ]. As described earlier, MSTs are construed by aligning the sequence types generated via MLVA or MLST. If sequence types are identical, they are assumed to belong to the same C. trachomatis strain. This is graphically represented in an MST by a circle, in which the size of the circle is proportional to the number of sequence types found in a population (Fig. 4). Single-locus variants (SLVs) are strains that differ from one another at one locus only. From an evolutionary viewpoint, they are considered to be &
66
www.co-infectiousdiseases.com
closely interrelated. On the basis of the arbitrary number of varying loci allowed for, sequence types can be considered to belong to the same cluster. In most studies, all strains that differ by, at most, one SLV from a neighbouring sequence type are considered to belong to the same C. trachomatis strain cluster. Strain clusters are used to describe a network of hosts sharing the same C. trachomatis strains [24]. These MSTs indicate the need to reconsider the ompA single-gene-based nomenclature, as there is a disparity between ompA-based clusters and MLSTbased clusters. The discongruence between ompA and the remaining parts of the genome is becoming Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al.
Cluster IV L2, L2b (n = 34)
Cluster I G, J (n = 128)
Cluster VIII I (n = 25)
Cluster V D, F, J (n = 71)
Cluster III D (n = 10)
Cluster II D (n = 80)
Cluster VI E (n = 77)
Cluster VII E (n = 26)
FIGURE 4. Minimum spanning tree based on multi locus sequence typing, showing the sexual orientation of the host of 526 Chlamydia trachomatis-positive samples from men who have sex with men (MSM) and heterosexuals in Amsterdam between July 2008 and May 2010. Sizes of the node discs are proportional to the number of samples of each sequence type; branches show single-locus variants (SLVs); halos indicate clusters based on SLV; and letters indicate ompA genovar type. The color coding is as follows: pink, MSM only (n ¼ 262); green, men who have sex with men and women (n ¼ 8); and blue, heterosexual men and women (n ¼ 256). Reproduced with permission [42 ]. &
increasingly clear with the availablitiy of richer and more refined sequence data [37,38 ,39,40 ]. In addition, earlier reports of mosaic ompA gene structures indicated that ompA or parts of ompA may be exchanged between C. trachomatis strains [35].
high-resolution typing, sexual networks can be unveiled with unprecedented precision and less bias. A selection of these endeavors is described below.
MOLECULAR TYPING APPLIED
As a result of the ongoing exposure, recurrent STIs are a main problem amongst high-risk groups, and recurrent C. trachomatis infections are very common amongst young adults [1]. Proper interpretation of repeated detection of C. trachomatis after treatment is important for monitoring patient management, partner notification and treatment evaluation. Redetection of C. trachomatis after treatment can indicate first, a new infection by another infected (new) partner; second, re-infection
&&
&&
In recent years, molecular typing methods have been increasingly used to elucidate various clinical, evolutionary and epidemiological questions. Before molecular typing methods became available, STI transmission network analysis was performed using source and contact tracing. This is laborious and also biased by (often socially desirable) information provided by the infected index patient and potentially moralistic attitudes of interviewers. With
Typing to monitor treatment efficacy, persistence, and re-infections
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
67
Sexually transmitted diseases
because of re-exposure to a parner not identified or inadequately managed via partner notification; and third, persistence because of treatment failure. Comparing the C. trachomatis strains by typing before and after treatment can help to identify the cause of the redetection. Strain discordance excludes explanations second and third. Strain concordance is less discriminatory: it can either be caused by re-exposure to the original source or persistence. In a study in STI clinic visitors with repeat C. trachomatis infections, high-resolution MLST and ompA genovar typing were compared to discriminate between re-infection, new infection or persistence [43]. Many cases (37%) showed the same sequence type C. trachomatis strain after 6 months, suggesting re-infection through re-exposure to the original source or persistence. The authors concluded that partner treatment remains essential as well as retesting C. trachomatis patients after 6 months.
Lymphogranuloma venereum amongst men who have sex with men Historically, LGV was considered an STI confined to tropical climate areas [44]. In 2003, an epidemic was unveiled in Europe, North America and Australia amongst mainly HIV co-infected men who have sex with men (MSM) [45]. Sequencing of the ompA gene demonstrated that all LGV-positive samples in Amsterdam contained a new C. trachomatis genovariant, designated genovar L2b (Fig. 1) [15]. A retrospective study showed that L2b already circulated amongst MSM in San Francisco in 1981 [46]. This indicated it was a rather slow epidemic that had gone unnoticed for more than 20 years amongst MSM in high-income countries [47]. Increasing numbers of LGV cases were reported over recent years in the UK, Amsterdam, Barcelona, and Madrid [48 ]. Most infections were anorectal; LGV is rarely reported at urogenital or pharyngeal sites [49,50]. Until to date, the LGV epidemic caused by L2b strains remains confined to the MSM community, although isolated cases of heterosexual transmission have been described [51]. Recently, new LGV strains L2c (a recombinant of L2 and D strains) and L2/L2f have been identified which may be associated with different pathophysiological and clinical characteristics [52,53]. Bacteria of the LGV genovar have no additional genes that account for the differences in disease outcome compared to genovars D-K, but in both the circular genome and the plasmid of LGV many genes differ in their sequences compared with other genovars [37,38 ]. It is therefore expected that in the near future, genotyping and phenotyping will elucidate the invasive, more pathogenic nature of LGV strains. &
&&
68
www.co-infectiousdiseases.com
Clinical relevance of lymphogranuloma venereum typing It is of relevance to differentiate patients with LGV infections from those infected with a nonLGV genovar. First, a more extensive treatment is needed for anorectal infections caused by LGV compared with non-LGV strains: 3 weeks of doxycycline versus 1 week, respectively [54]. Second, LGV is a more destructive infection, sometimes requiring additional clinical management and follow-up. Third, LGV is more common in MSM with HIV-1 and hepatitis C infection; therefore, these two infections must be excluded [55]. We recently reported that a significant proportion (27.2%) of anorectal LGV infections in Amsterdam were asymptomatic upon presentation [48 ]. Thus, LGV typing of C. trachomatis-positive anorectal samples is important in symptomatic as well as asymptomatic MSM. It is recommended to screen all MSM who report receptive anal sex in the previous 6 months for anorectal C. trachomatis infection [9,56], and subsequently type C. trachomatispositive rectal samples for LGV [57,58]. &
New variant C. trachomatis strain, diagnostic resistance In 2006, following an unexplained drop in the number of reported C. trachomatis infections in two counties in Sweden, a new strain called ‘new variant C. trachomatis’ (nvCt) was found, characterized by a 377 bp deletion in the plasmid pLGV 440 gene [6]. This deletion is located in the target area of some commercially available diagnostic tests for urogenital C. trachomatis infections. As a result, these tests failed to detect nvCt infections, which subsequently offered the organism an advantage [59,60]. The spread of nvCt remained confined to Scandinavia [7,61]. The nvCt was the first reported example of a mutant that caused microbial diagnostic resistance. Its discovery prompted companies to adjust their diagnostic tests quickly, using in some cases multiple genetic regions for target detection. It has been shown that functional gene loss and regions of heightened sequence variation are important sites for interstrain recombination [62] and gene transfer between C. trachomatis genovars [52,63 ]. This could change the clinical C. trachomatis pathophysiology and complicate diagnostics and therapeutic interventions. Therefore, C. trachomatis sequence typing for surveillance purposes is needed to monitor the emerging mutations that circulate in populations. &
Epidemiological studies With low-resolution typing methods based on the ompA gene, it was previously shown that there is a Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al.
surprising homogeneity of C. trachomatis strains amongst heterosexuals from different international regions [64–66]. This homogeneity over large geographical distances was nuanced by the recent studies using the high-resolution MLST typing method. In a comparison of C. trachomatis strains circulating amongst heterosexuals from Nanjing and Amsterdam, it was found that most strains were specific to Nanjing, but some clustered with strains from Amsterdam, showing worldwide spread of certain C. trachomatis strains [33]. Low-resolution typing methods also suggested some overlap in the C. trachomatis genovar distribution amongst heterosexuals and MSM. Using our high-resolution MLST typing method, we were able to show distinct networks of C. trachomatis amongst heterosexuals and MSM: the previously suggested overlap by the less discriminatory ompA typing proved not to exsist (Fig. 4) [42 ]. Also, the genetic diversity in the MSM clusters was found to be much lower than in heterosexual clusters. These findings were also shown in international comparisons [67 ]. MLST analysis identified the L2b (LGV) strain to circulate preferentially amongst specific subpopulations within the MSM community (leather, military, rubber/Lycra, or jeans scenes) in Amsterdam [32]. The high degree of clonality found in C. trachomatis strains amongst MSM could be explained by network-associated factors (i.e. sexual host behavior), but bacterial factors (like tissue tropism) may play a role as well, although the indications for the latter are weak [68]. The MLST method was also used to assess whether Surinamese migrants living in the Netherlands might form a bridging population for C. trachomatis transmission between native Surinamese in Suriname and native Dutch in the Netherlands [34]. Although sexual mixing between migrants and the native populations both in Suriname and the Netherlands was frequently reported, the MLST cluster distributions did not differ significantly between migrants who mixed and those who did not. It was therefore concluded that Surinamese migrants did not seem to form a bridge population for C. trachomatis transmission between the native populations. &
&
CONCLUSION C. trachomatis is a highly prevalent STI pathogen, and therefore an important candidate when the transmission of STIs in sexual networks is studied. Molecular high-resolution typing techniques have caused a breakthrough in the revelation of previously hard-to-study transmission networks. Linking hosts infected by genetically identical or closely
related strains can reveal transmission networks. With high-resolution CT-MLST, we were able to identify high-risk groups for LGV within the MSM community. This helped in the formulation of targeted prevention and screening campaigns. High-resolution C. trachomatis typing has direct clinical value to identify LGV infections. Although several, commercial, high-throughput platforms for the detection of C. trachomatis are available, none offer the possibility to discriminate between a nonLGV and a LGV infection. Therefore, validated ‘in house’ or new commercial assays are required to identify L genovar C. trachomatis strains in routine samples; this will enhance the control of the still ongoing LGV epidemic. Probably, with WGS, the pathophysiological mechanisms of LGV C. trachomatis strains will be elucidated. The discovery of nvCt in Sweden as the first example of microbial diagnostic resistance revealed the weakness of modern molecular diagnostic tests based on a single locus. This led to the concept of multilocus diagnostic testing, which should prevent future emergence of strains that evade diagnostic detection. High-resolution molecular typing has improved diagnosis, increased our understanding of the epidemiology, and the evolution of C. trachomatis. Acknowledgements None. Financial support and sponsorship This work was supported by the Infectious Diseases Cluster, Public Health Service Amsterdam, Amsterdam, the Netherlands. Conflicts of interest There are no conflicts of interest.
REFERENCES AND RECOMMENDED READING Papers of particular interest, published within the annual period of review, have been highlighted as: & of special interest && of outstanding interest 1. Peipert JF. Clinical practice. Genital chlamydial infections. N Engl J Med 2003; 349:2424–2430. 2. Prevalence and incidence of selected sexually transmitted infections, Chlamydia trachomatis, Neisseria gonorrhoeae, syphilis, and Trichomonas vaginalis: methods and results used by WHO to generate 2005 estimates. Vol. 2014. WHO; 2011. Available at: http://whqlibdoc.who.int/publications/ 2011/9789241502450_eng.pdf?ua¼1 [Accessed 3 December 2014]. 3. Jackson LJ, Auguste P, Low N, Roberts TE. Valuing the health states associated with Chlamydia trachomatis infections and their sequelae: a systematic review of economic evaluations and primary studies. Value Health 2014; 17:116–130. 4. Van den Broek IV, van Bergen JE, Brouwers EE, et al. Effectiveness of yearly, register based screening for Chlamydia in the Netherlands: controlled trial with randomised stepped wedge implementation. BMJ 2012; 345:e4316.
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
69
Sexually transmitted diseases 5. Tam JE, Davis CH, Thresher RJ, Wyrick PB. Location of the origin of replication for the 7.5-kb Chlamydia trachomatis plasmid. Plasmid 1992; 27:231–236. 6. Ripa T, Nilsson P. A variant of Chlamydia trachomatis with deletion in cryptic plasmid: implications for use of PCR diagnostic tests. Euro Surveill 2006; 11:E061109.2. 7. Metzgar D. Adaptive evolution of diagnostic resistance. J Clin Microbiol 2011; 49:2774–2775. 8. De Vrieze NH, de Vries HJ. Lymphogranuloma venereum among men who & have sex with men. An epidemiological and clinical review. Expert Rev Anti Infect Ther 2014; 12:697–704. This review discusses the microbiological, epidemiological, and clinical aspects of the ongoing detected LGV epidemic amongst MSM. 9. De Vries HJC, Zingoni A, Kreuter A, et al. 2013 European guideline on the management of lymphogranuloma venereum. J Eur Acad Dermatol Venereol 2014. (in press). 10. Grayston JT, Wang S. New knowledge of chlamydiae and the diseases they cause. J Infect Dis 1975; 132:87–105. 11. Caldwell HD, Schachter J. Antigenic analysis of the major outer membrane protein of Chlamydia spp. Infect Immun 1982; 35:1024–1031. 12. Barnes RC, Wang SP, Kuo CC, Stamm WE. Rapid immunotyping of Chlamydia trachomatis with monoclonal antibodies in a solid-phase enzyme immunoassay. J Clin Microbiol 1985; 22:609–613. 13. Schachter J. Chlamydial infections (third of three parts). N Engl J Med 1978; 298:540–549. 14. Batteiger BE, Newhall WJt, Terho P, et al. Antigenic analysis of the major outer membrane protein of Chlamydia trachomatis with murine monoclonal antibodies. Infect Immun 1986; 53:530–533. 15. Spaargaren J, Fennema HS, Morre SA, et al. New lymphogranuloma venereum Chlamydia trachomatis variant, Amsterdam. Emerg Infect Dis 2005; 11:1090–1092. 16. Lan J, Ossewaarde JM, Walboomers JM, et al. Improved PCR sensitivity for direct genotyping of Chlamydia trachomatis serovars by using a nested PCR. J Clin Microbiol 1994; 32:528–530. 17. Morre SA, Ossewaarde JM, Lan J, et al. Serotyping and genotyping of genital Chlamydia trachomatis isolates reveal variants of serovars Ba, G, and J as confirmed by omp1 nucleotide sequence analysis. J Clin Microbiol 1998; 36:345–351. 18. Gaydos CA, Bobo L, Welsh L, et al. Gene typing of Chlamydia trachomatis by polymerase chain reaction and restriction endonuclease digestion. Sex Transm Dis 1992; 19:303–308. 19. Rodriguez P, Vekris A, de Barbeyrac B, et al. Typing of Chlamydia trachomatis by restriction endonuclease analysis of the amplified major outer membrane protein gene. J Clin Microbiol 1991; 29:1132–1136. 20. Dean D, Patton M, Stephens RS. Direct sequence evaluation of the major outer membrane protein gene variant regions of Chlamydia trachomatis subtypes D0 , I0 , and L20 . Infect Immun 1991; 59:1579–1582. 21. Dean D, Millman K. Molecular and mutation trends analyses of omp1 alleles for serovar E of Chlamydia trachomatis. Implications for the immunopathogenesis of disease. J Clin Invest 1997; 99:475–483. 22. Yang CL, Maclean I, Brunham RC. DNA sequence polymorphism of the Chlamydia trachomatis omp1 gene. J Infect Dis 1993; 168:1225–1230. 23. Yuan Y, Zhang YX, Watkins NG, Caldwell HD. Nucleotide and deduced amino acid sequences for the four variable domains of the major outer membrane proteins of the 15 Chlamydia trachomatis serovars. Infect Immun 1989; 57:1040–1049. 24. Bom RJ, Christerson L, Schim van der Loeff MF, et al. Evaluation of highresolution typing methods for Chlamydia trachomatis in samples from heterosexual couples. J Clin Microbiol 2011; 49:2844–2853. 25. Pedersen LN, Podenphant L, Moller JK. Highly discriminative genotyping of Chlamydia trachomatis using omp1 and a set of variable number tandem repeats. Clin Microbiol Infect 2008; 14:644–652. 26. Ikryannikova LN, Shkarupeta MM, Shitikov EA, et al. Comparative evaluation of new typing schemes for urogenital Chlamydia trachomatis isolates. FEMS Immunol Med Microbiol 2010; 59:188–196. 27. Satoh M, Ogawa M, Saijo M, Ando S. Multilocus VNTR analysis-ompA typing of venereal isolates of Chlamydia trachomatis in Japan. J Infect Chemother 2014; 20:656–659. 28. Wang Y, Skilton RJ, Cutcliffe LT, et al. Evaluation of a high resolution genotyping method for Chlamydia trachomatis using routine clinical samples. PLoS One 2011; 6:e16971. 29. Dean D, Bruno WJ, Wan R, et al. Predicting phenotype and emerging strains among Chlamydia trachomatis infections. Emerg Infect Dis 2009; 15:1385– 1394. 30. Pannekoek Y, Morelli G, Kusecek B, et al. Multi locus sequence typing of Chlamydiales: clonal groupings within the obligate intracellular bacteria Chlamydia trachomatis. BMC Microbiol 2008; 8:42. 31. Klint M, Fuxelius HH, Goldkuhl RR, et al. High-resolution genotyping of Chlamydia trachomatis strains by multilocus sequence analysis. J Clin Microbiol 2007; 45:1410–1414. 32. Bom RJ, Matser A, Bruisten SM, et al. Multilocus sequence typing of Chlamydia trachomatis among men who have sex with men reveals cocirculating strains not associated with specific subpopulations. J Infect Dis 2013; 208:969–977.
70
www.co-infectiousdiseases.com
33. Bom RJ, van den Hoek A, Wang Q, et al. High-resolution typing reveals distinct Chlamydia trachomatis strains in an at-risk population in Nanjing, China. Sex Transm Dis 2013; 40:647–649. 34. Bom RJ, van der Helm JJ, Bruisten SM, et al. The role of Surinamese migrants in the transmission of Chlamydia trachomatis between Paramaribo, Suriname and Amsterdam, The Netherlands. PLoS One 2013; 8:e77977. 35. Labiran C, Clarke IN, Cutcliffe LT, et al. Genotyping markers used for multi locus VNTR analysis with ompA (MLVA-ompA) and multi sequence typing (MST) retain stability in Chlamydia trachomatis. Front Cell Infect Microbiol 2012; 2:68. 36. Van Belkum A, Tassios PT, Dijkshoorn L, et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect 2007; 13 (Suppl. 3):1–46. 37. Clarke IN. Evolution of Chlamydia trachomatis. Ann N Y Acad Sci 2011; 1230:E11–E18. 38. Harris SR, Clarke IN, Seth-Smith HM, et al. Whole-genome analysis of diverse && Chlamydia trachomatis strains identifies phylogenetic relationships masked by current clinical typing. Nat Genet 2012; 44:413–419; S411. This is one of the first studies presenting a large body of sequences contributing to the full-genome database of C. trachomatis, see Fig. 3. 39. Joseph SJ, Li B, Ghonasgi T, et al. Direct amplification, sequencing and profiling of Chlamydia trachomatis strains in single and mixed infection clinical samples. PLoS One 2014; 9:e99290. 40. Seth-Smith HM, Harris SR, Skilton RJ, et al. Whole-genome sequences of && Chlamydia trachomatis directly from clinical samples without culture. Genome Res 2013; 23:855–866. In this study, whole-genome Chlamydia trachomatis sequences are for the first time produced from direct clinical samples. 41. Seth-Smith HM, Harris SR, Scott P, et al. Generating whole bacterial genome sequences of low-abundance species from complex samples with IMS-MDA. Nat Protoc 2013; 8:2404–2412. 42. Bom RJ, van der Helm JJ, Schim van der Loeff MF, et al. Distinct transmission & networks of Chlamydia trachomatis in men who have sex with men and heterosexual adults in Amsterdam, The Netherlands. PLoS One 2013; 8:e53869. This study revealed that the overlap in genovars between strains circulating amongst heterosexuals and MSM hides the almost complete separation of C. trachomatis clusters (based on MLST) circulating in these two sexual subgroups. 43. Gotz HM, Bom RJ, Wolfers ME, et al. Use of Chlamydia trachomatis highresolution typing: an extended case study to distinguish recurrent or persistent infection from new infection. Sex Transm Infect 2014; 90:155–160. 44. De Vries HJ, Reddy BS, Khandpur S. Lymphogranuloma Venereum. In: Gupta S, Kumar B, editors. Sexually transmitted infections, 2nd ed. Elsevier; 2012. pp. 506–521. 45. White JA. Manifestations and management of lymphogranuloma venereum. Curr Opin Infect Dis 2009; 22:57–66. 46. Spaargaren J, Schachter J, Moncada J, et al. Slow epidemic of lymphogranuloma venereum L2b strain. Emerg Infect Dis 2005; 11:1787–1788. 47. Christerson L, de Vries HJ, de Barbeyrac B, et al. Typing of lymphogranuloma venereum Chlamydia trachomatis strains. Emerg Infect Dis 2010; 16:1777– 1779. 48. De Vrieze NH, van Rooijen M, Schim van der Loeff MF, de Vries HJ. Anorectal & and inguinal lymphogranuloma venereum among men who have sex with men in Amsterdam, the Netherlands. trends over time, symptomatology and concurrent infections. Sex Transm Infect 2013; 89:548–552. This article studies the epidemiological and clinical aspects of the LGV epidemic in Amsterdam; it shows that a large proportion of MSM with LGV is asymptomatic, underlining the need to perform typing for LGV of all C. trachomatis-positive anorectal samples of MSM. 49. De Vrieze NH, van Rooijen M, Speksnijder AG, de Vries HJ. Urethral lymphogranuloma venereum infections in men with anorectal lymphogranuloma venereum and their partners: the missing link in the current epidemic? Sex Transm Dis 2013; 40:607–608. 50. Oud EV, de Vrieze NH, de Meij A, de Vries HJ. Pitfalls in the diagnosis and management of inguinal lymphogranuloma venereum: important lessons from a case series. Sex Transm Infect 2014; 90:279–282. 51. Verweij SP, Ouburg S, de Vries H, et al. The first case record of a female patient with bubonic lymphogranuloma venereum (LGV), serovariant L2b. Sex Transm Infect 2012; 88:346–347. 52. Somboonna N, Wan R, Ojcius DM, et al. Hypervirulent Chlamydia trachomatis clinical strain is a recombinant between lymphogranuloma venereum (L(2)) and D lineages. MBio 2011; 2:e00045-11. 53. Rodriguez-Dominguez M, Puerta T, Menendez B, et al. Clinical and epidemiological characterization of a lymphogranuloma venereum outbreak in Madrid, Spain: co-circulation of two variants. Clin Microbiol Infect 2014; 20:219–225. 54. De Vries HJ, Smelov V, Middelburg JG, et al. Delayed microbial cure of lymphogranuloma venereum proctitis with doxycycline treatment. Clin Infect Dis 2009; 48:e53–e56. 55. Van de Laar T, Pybus O, Bruisten S, et al. Evidence of a large, international network of HCV transmission in HIV-positive men who have sex with men. Gastroenterology 2009; 136:1609–1617. 56. De Vries HJ, Zingoni A, White JA, et al. 2013 European guideline on the management of proctitis, proctocolitis and enteritis caused by sexually transmissible pathogens. Int J STD AIDS 2013; 25:465–474.
Volume 28 Number 1 February 2015
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
High-resolution typing of Chlamydia trachomatis de Vries et al. 57. Morre SA, Ouburg S, van Agtmael MA, de Vries HJ. Lymphogranuloma venereum diagnostics: from culture to real-time quadriplex polymerase chain reaction. Sex Transm Infect 2008; 84:252–253. 58. Chen CY, Chi KH, Alexander S, et al. A real-time quadriplex PCR assay for the diagnosis of rectal lymphogranuloma venereum and nonlymphogranuloma venereum Chlamydia trachomatis infections. Sex Transm Infect 2008; 84: 273–276. 59. Bjartling C, Osser S, Johnsson A, Persson K. Clinical manifestations and epidemiology of the new genetic variant of Chlamydia trachomatis. Sex Transm Dis 2009; 36:529–535. 60. Unemo M, Clarke IN. The Swedish new variant of Chlamydia trachomatis. Curr Opin Infect Dis 2011; 24:62–69. 61. De Vries HJ, Catsburg A, van der Helm JJ, et al. No indication of Swedish Chlamydia trachomatis variant among STI clinic visitors in Amsterdam. Euro Surveill 2007; 12:; E070208.3. 62. Thomson NR, Holden MT, Carder C, et al. Chlamydia trachomatis: genome sequence analysis of lymphogranuloma venereum isolates. Genome Res 2008; 18:161–171. 63. Joseph SJ, Didelot X, Rothschild J, et al. Population genomics of Chlamydia & trachomatis: insights on drift, selection, recombination, and population structure. Mol Biol Evol 2012; 29:3933–3946. This study is informative on all genomic aspects of Chlamydia trachomatis.
64. Lysen M, Osterlund A, Rubin CJ, et al. Characterization of ompA genotypes by sequence analysis of DNA from all detected cases of Chlamydia trachomatis infections during 1 year of contact tracing in a Swedish County. J Clin Microbiol 2004; 42:1641–1647. 65. Machado AC, Bandea CI, Alves MF, et al. Distribution of Chlamydia trachomatis genovars among youths and adults in Brazil. J Med Microbiol 2011; 60:472–476. 66. Hsu MC, Tsai PY, Chen KT, et al. Genotyping of Chlamydia trachomatis from clinical specimens in Taiwan. J Med Microbiol 2006; 55:301– 308. 67. Christerson L, Bom RJ, Bruisten SM, et al. Chlamydia trachomatis strains & show specific clustering for men who have sex with men compared to heterosexual populations in Sweden, the Netherlands, and the United States. J Clin Microbiol 2012; 50:3548–3555. This important study demonstrated, using MLST, that the C. trachomatis clusters circulating amongst MSM of three countries do not differ, but that there is some variation in strains circulating amongst heterosexuals in these countries. 68. Versteeg B, van Rooijen MS, Schim van der Loeff MF, et al. No indication for tissue tropism in urogenital and anorectal Chlamydia trachomatis infections using high-resolution multilocus sequence typing. BMC Infect Dis 2014; 14:464.
0951-7375 Copyright ß 2015 Wolters Kluwer Health, Inc. All rights reserved.
www.co-infectiousdiseases.com
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
71
