Research Communication Heterologous Expression and Characterization of Human Cellular Glutathione Peroxidase Mutants
Xiao Guo† Yang Yu† Xixi Liu Yinlong Zhang Tuchen Guan Guiqiu Xie* Jingyan Wei*
College of Pharmaceutical Science, Jilin University, Changchun, China
Abstract Cellular glutathione peroxidase (GPx1; EC1.11.1.9) is a major intracellular antioxidant selenoenzyme in mammals. However, the complicated expression mechanism of selenocysteine (Sec)-containing protein increases the difficulty of expressing human GPx1 (hGPx1) in Escherichia coli (E. coli). In this study, hGPx1 gene was cloned from a cDNA library of the human hepatoma cell line HepG2. The codon UGA encoding Sec49 of hGPx1 was first mutated to UGC encoding cysteine (Cys) and then biosynthetically converted to Sec during expression in an E. coli BL21(DE3)cys auxotrophic system. Seleno-GPx1Sec displayed a low GPx activity of 522 U/lmol. To improve the activity, the other five Cys residues (C2, C78, C115, C156, C202)
were mutated to serine (Ser) in one hGPx1 molecule. The mutant seleno-hGPx1Ser showed a high activity of 5278 U/ lmol, which was more than 10-fold enhanced as compared with seleno-GPx1Sec. The activity was the highest among all of those seleno-proteins obtained by this method so far. Kinetic analysis of seleno-hGPx1Ser showed a typical ping-pong mechanism, which was similar to those of natural GPxs. This research will be of value in overcoming the problem of limited sources of natural GPx and substantially promotes the C 2014 IUBMB Life, research of the characterization of GPx. V 66(3):212–219, 2014
Keywords: glutathione peroxidase; selenocystein; cysteine auxotrophic strain; site-directed mutagenesis
Introduction Reactive oxygen species (ROS) are associated with a variety of disease states, such as atherosclerosis, cancer, Parkinson’s dis-
C International Union of Biochemistry and Molecular Biology V
Volume 66, Number 3, March 2014, Pages 212–219 *Address correspondence to: Jingyan Wei, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun 130021, China. Tel.: 186–431-85619716. Fax: 186–431-85619252. E-mail: [email protected] or Guiqiu Xie, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun, 130021, China. Tel.: 186-43185619716. Fax: 186-431-85619252. E-mail: [email protected] Abbreviations: GPx, glutathione peroxidase; hGPx1, human glutathione peroxidase 1; Sec, selenocysteine; GSH, glutathione; HepG2, human hepatoma cell line; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; PCR, polymerase chain reaction. Received 24 February 2014; Accepted 1 March 2014 † X.G. and Y.Y. contributed equally to this article. DOI 10.1002/iub.1255 Published online 23 March 2014 in Wiley Online Library (wileyonlinelibrary.com)
212
ease, diabetes, and aging (1,2). The harmful effects of ROS are balanced by the antioxidant action of antioxidant enzymes and nonenzymatic antioxidants (3). Central antioxidant enzymes include superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx). As a scavenger of ROS, GPx is a critical selenoenzyme which can protect biomembranes and other cellular components from oxidative damage by catalyzing the reduction of hydrogen peroxide (H2O2), organic hydroperoxides, and lipid peroxides to water and the corresponding alcohol, using reduced glutathione (GSH) as an essential cosubstrate (4,5). Up to date, eight distinct GPxs have been identified in mammals and these isozymes differ from each other by the structure, substrate specificity, and tissue distribution (6). GPx1 was the first seleno-containing enzyme to be identified, which is widely expressed and particularly abundant in erythrocytes, kidney, and liver (7,8). The pivotal role of GPx1 in protection against different oxidative stressors has been widely demonstrated (9–11). In the absence of GPx1, it will result in reductions in antioxidant defense and lead to diverse disease progression (12). Sec encoded by the stop codon UGA is the catalytic group in the active site of GPx (13). To synthesize GPx, both
IUBMB Life
TABLE 1
Strains and plasmids
Strains/plasmids
Relevant genotype or description
Source or reference
Strains DH5a
SupE44 Dlac U169 (/80 lac ZDM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1
Invitrogen
BL21(DE3)
hsdS gal (lcIts857 ind1 sam7 nin5 lacUV5-T7 gene 1)
Invitrogen
BL21(DE3)cys
BL21(DE3) selB::kan cysE51
(23,24)
pCold I
Cloning and expression vector, Ampr
Takara
pCG
pCold I with hGPx1 fragment in NdeI-HindIII
This study
pCG(U49C)
pCold I with hGPx1 (U49C) fragment in NdeI-HindIII
This study
pCG(C2/78/115/156/202S)
pCold I with hGPx1 (U49C,C2/78/115/156/202S) fragment in NdeI-HindIII
This study
Plasmids
prokaryotic and eukaryotic cells have their own mechanism of Sec insertion (14). Selenocysteine insertion sequence (SECIS) in the open reading frame would be needed for expression of a eukaryotic selenoprotein in bacteria. However, the major obstacle to such engineering is that the introduction of SECIS would alter the amino acid sequence and may affect the biological function of the enzyme. Owing to the difficulty in gene recombination technique and important biological roles of GPx, many research efforts have been made to mimic the function of GPx. Ebselen, a synthetic eleno-organic compound, is in phase II clinical trials for the treatment of acute ischemic stroke (15). Due to the application of Ebselen, several methods for its derivates synthesis have been developed (16,17). Glutathione S-transferase (GST) and glutaredoxin (Grx) are natural protein scaffolds with intrinsic GSH-binding sites and widely used to redesign GPx mimics (18,19). Furthermore, a number of GPx mimics have been built by a monoclonal antibody and bioimprinting techniques, which introduce the GSH binding site into the models (20,21). In this study, we prepared the recombinant hGPx1 using the cysteine auxotrophic system, which could effectively incorporate Sec into protein. The catalytic activity was greatly affected following all Cys residues in the protein changed to Sec in this system. After all Cys residues in hGPx1 were mutated to Ser residues, the mutant displayed remarkably higher activity toward H2O2. The biological properties of the mutant seleno-hGPx1Ser were also characterized.
Materials and Methods Bacterial Strains, Plasmids, and Media Bacterial strains and plasmids used in this study are listed in Table 1. The medium used in subcloning experiments and site-
Guo et al.
directed mutagenesis was Luria-Bertani broth. The media used in expression experiments were a modification of the minimal medium described previously (22).
Construction of Plasmids The cDNA library from human hepatoma cell line HepG2 was used as a template for polymerase chain reaction (PCR). Amplification primers hGPx1-F/hGPx1-R (Table 2) were designed using the hGPx1 cDNA sequences in NCBI. DNA was amplified in a 50 lL volume containing 1 lL template cDNA, 200 lM concentration of each deoxynucleoside triphosphate, 25 pM concentration of the respective primer, 1.5 U of Taq DNA polymerase (TAKARA), and 13 Taq polymerase buffer. PCR was executed under the following conditions: preheating for 120 sec at 94 C; 30 cycles of 30 sec at 94 C, 45 sec at 55 C, and 60 sec at 72 C; 10 min at 72 C. PCR fragments containing sequences encoding hGPx1 were cut with NdeI and HindIII and cloned into pCold I vector that was previously linearized with similar enzymes to give pCG expression vector. Positive clones were verified by enzyme digestion. Point mutations were generated by QuikChange SiteDirected Mutagenesis Kit (Stratagene, La Jolla, CA) according to manufacturer’s recommendations, and the mutagenic primers used in this study are listed in Table 2. The mutagenesis PCR reactions contained 50 ng template plasmid, 25 pmol of mutagenic primers, 0.1 mM of dNTP, 2.5 U of PfuTurbo DNA polymerase. The reaction was executed under the following conditions: preheating for 120 sec at 95 C and 18 cycles of 30 sec at 95 C, 60 sec at 55 C, and 12 min at 68 C. Add 1 lL of the DpnI restriction enzyme directly to the amplification reaction to digest the parental DNA template. The products were transformed E. coli DH5a. All mutated constructs were sequenced to confirm that no additional mutations had been introduced into the sequences.
213
IUBMB LIFE
TABLE 2
Primers used in this study
Gene(s)
Sequence 50 !30
hGPx1-F
GGAATTCCATATGTGTGCTGCTCGGC
hGPx1-R
CCCAAGCTTCTAGGCACAGCTGGGC
C2S-F
GAAGGTAGGCATATGTCTGCTGCTCGGCTAGCG
C2S-R
CGCTAGCCGAGCAGCAGACATATGCCTACCTTC
U49C-F
GAATGTGGCGTCCCTCTGCGGCACCACGGTCCGGGAC
U49C-R
GTCCCGGACCGTGGTGCCGCAGAGGGACGCCACATTC
C78S-F
GTGCTCGGCTTCCCGAGCAACCAGTTTGGGC
C78S-R
GCCCAAACTGGTTGCTCGGGAAGCCGAGCAC
C115S-F
CATGCTCTTCGAGAAGAGCGAGGTGAACGGTGC
C115S-R
GCACCGTTCACCTCGCTCTTCTCGAAGAGCATG
C156S-F
CACCTGGTCTCCGGTGAGTCGCAACGATGTTGC
C156S-R
GCAACATCGTTGCGACTCACCGGAGACCAGGTG
C202S-F
CTCAAGGGCCCAGCTCTGCCTAGAAGCTTGTC
C202S-R
GACAAGCTTCTAGGCAGAGCTGGGCCCTTGAG
Italics indicate the substitutions which resulted in mutation.
Overexpression and Purification of the Protein Plasmid DNA of pCG(U49C) and pCG(C2/78/115/156/202S) transformed into BL21(DE3)cys for the production of selenoproteins. Overexpression of seleno-hGPx1 and the mutant in the presence of Sec instead of Cys was performed using the method described previously (24,25). Crude protein extracts were prepared in buffer A containing 20 mM sodium phosphate (pH 7.4) and 500 mM NaCl. The proteins were purified by the immobilized metal affinity chromatography purification system using standard Ni21 charged beads. Unspecifically bound proteins were eluted by a washing step with three column volumes of buffer A containing 20 mM, 50 mM, 75 mM, and 100 mM imidazol. After the column was washed, the target protein was eluted with 300 mM imidazole and dialyzed in 150 mM NaCl to remove imidazole. The 63 His tag at Nterminus was removed by treatment with a factor Xa protease (New England Biolabs). Concentration of proteins was estimated by the Bradford method using bovine serum albumin as a standard.
PAGE and Western Blot Analysis Cells and the purified protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie Blue staining. Purified protein samples diluted 1:1 with nondenaturing loading buffer [50 mM glycine (pH 8.0), 20% glycerol (vol/vol)], and the mixture was electro-
214
phoresed using a 10% native PAGE gel (pH 8.0) with Tris/Glycine running buffer. For Western blotting, protein samples were loaded on a 12% (w/v) SDS-PAGE gel. When it was complete, the proteins on the gel were electrophoretically transferred to nitrocellulose membrane. The membrane was blocked with Tris-borate-NaCl (TBS) containing 5% nonfat dry milk for 1 h at 37 C and incubated with mouse anti-His6 monoclonal antibodies (Pharmacia) (1:1,000) at 37 C for 1 h. The membrane was washed three times with TBST and incubated with goat anti-mouse monoclonal antibody (Pharmacia) conjugated with horseradish peroxidase with gentle agitation for 1 h at 37 C. Reacting proteins were visualized by 3,3N-diaminobenzidine tertrahydrochloride (DAB)-H2O2 substrate that gave brown color.
Assay of Enzyme Activities GPx activities were assayed according to the method previously described by Wilson (26). The reaction was carried out at 37 C in 500 lL of solution containing 50 mM PBS (pH 7.4), 1 mM EDTA, 1 mM GSH (Sigma), 0.25 mM NADPH (Sigma), one unit of glutathione reductase, and 20–50 nM of samples. The mixture was preincubated for 5 min at 37 C and the reaction was then initiated by addition of substrate (0.5 mM H2O2). GPx activity was determined by the decrease of NADPH absorption at 340 nm. Negative control was performed in parallel without enzyme and was subtracted from assay values. The activity unit (U) is
Expression and Characterization of hGPx1 Mutants
defined as the amount of the protein that uses 1 lmol of NADPH per min. The specific activity is expressed in U/lmol.
Determination of Optimal pH and Temperature GPx activity of seleno-hGPx1Ser was measured with the same method as above. The pH value of buffer was changed in determining the initial rates of the reaction to obtain the optimal pH condition for seleno-hGPx1Ser catalyzed reaction. Similarly, the optimal temperature was determined by assaying the activity at various reaction temperatures.
Assay of Kinetics of Seleno-hGPx1Ser Steady-state kinetics was carried out following the method as described above (19). The initial rates were measured by observing the decrease of NADPH absorption at 340 nm at several concentrations of one substrate while the concentration of the second substrate was kept constant. GPx activities were measured using the same method as described above at 37 C and pH 7.4.
Results and Discussion Human GPx1, a major selenium-containing antioxidant enzyme in mammal, has been implicated in proliferation, apoptosis, activation of transcription factors, and modulating inflammation (27). Due to its essential function, many efforts have been made to obtain natural GPx and its mimics with prominent activities. In this context, the aim of this work was to express hGPx1 in Cys auxotrophic expression system and characterize its properties. A full-size hGPx1 cDNA was generated by PCR as described under Materials and Methods section. To express the gene of hGPx1 in E. coli, the codon UGA encoding Sec49 was first mutated to UGC encoding Cys. Then hGPx1 was expressed in Cys auxotrophic strain system, which could be efficiently replaced Cys with Sec in BL21(DE3)cys when Cys was omitted in the medium. However, there are five Cys residues in the protein; multi-Sec substitutions on hGPx1 would affect the structure and property of the protein in this expression system (22,28,29). Based on the results of previous studies, we constructed the mutant that the other five Cys in hGPx1 were mutated to Ser before introducing Sec at position 49. Heterologous expression of seleno-hGPx1Sec and selenohGPx1Ser gave a 24-kDa band visualized by Coomassie staining of SDS-PAGE (Fig. 1A) and the same band was detected by Western blot (Fig. 1C), which indicated that the hGPx1 mutants were successfully expressed and purified. The N-terminal 63 His-tag was removed by digestion with Factor Xa protease, as was proved by SDS-PAGE (Fig. 1B) the molecular weight was smaller than before. Figure 1D showed the results of the analysis of expression. There is no target band in the E. coli transformed with recombinant plasmid before induction (lane 2) and the soluble form of seleno-hGPx1Ser were produced in the expression (Lane 3). The complex of nondenatured and denatured seleno-hGPx1Ser migrated as two bands with apparent molecular weights of 97 kDa and 24 kDa (Lane 5). The dena-
Guo et al.
tured and nondenatured enzyme migrated as a single band but showed a distinct migration rate on native page (Fig. 1E). These results indicated that seleno-hGPx1Ser existed in solution as a tetrameric complex, which corresponded to the naturally occurring form of GPx1 (13). To test the catalytic capability of seleno-hGPx1Sec and seleno-hGPx1Ser, the activities were estimated by the coupled enzyme system under the same conditions. Seleno-hGPx1Sec showed a low GPx activity of 522 U/lmol. It could be proposed that the substitutions of the multi-Sec for Cys residues, especially at position 2, 78, 115, 156, and 202 at the same time in the auxotrophic strain, caused a considerable change of the hGPx1 structure and affected the catalytic activity. SelenohGPx1Ser displayed a high GPx activity of 5,278 U/lmol that was more than 10-fold higher than that of seleno-hGPx1Sec. Accordingly, the increasing GPx activity of the mutant should result from the conversion of the five Cys residues to Ser, which has been widely recognized. To examine whether the 63 His tag may have an impact on the structure and enzyme activity, equal amounts of pure seleno-hGPx1Sec and selenohGPx1Ser proteins without 63 His tag were added for activity assays as described in Material and Methods section. There is no significant difference in the activity between seleno-enzyme with and without 63 His tag. It suggested that 63 His tag had little effect on the structure and activity of the enzyme. However, considering the introduction of 63 His tag may increase immunogenicity of the mutant, it is encouraged to remove the 63 His tag in the future clinical applications. The capability of catalytic activity of seleno-hGPx1Ser toward H2O2 was found to be much more efficient than most of previous GPx mimics (Table 3). For instance, it was about 5,300-fold higher than Ebselen, which is currently being used in clinical trials against stroke (30). The activity was still the highest among all of those seleno-proteins obtained by this method so far. And it even could be comparable to those of natural GPx, such as human GPx4 (31), human plasma GPx (32), bovine liver GPx (33), and rabbit liver GPx (34) whose activities were in the order of 1022103 U/lmol. In summary, our data demonstrate a major role for the mutant in protection against H2O2. High GPx activity of seleno-hGPx1ser could be attributed to basing the natural hGPx1 scaffold with a conserved catalytic center and an intrinsic GSH binding site. At the catalytic moiety of natural GPx1, Sec and the specific binding site for GSH lie in a shallow groove of the enzyme surface, which is prone to recognize and combine with GSH (13). In addition, the conserved catalytic triad (Sec, Trp, and Gln) and Arg residues surrounding the active-site selenium composed a unique active center of GPx1, which would facilitate the nucleophilic attach on the hydroperoxide and involve in GSH binding via electrostatic attraction (35). These characteristics of seleno-hGPx1Ser exhibited an incomparable ability of reduction of peroxides with GSH, which hardly possesses in most GPx mimics. Temperature and pH exert a significant impact on the catalytic reactions of GPx. So the activity was performed at
215
IUBMB LIFE
FIG 1
PAGE and Western blot analysis of recombinant hGPx1. SDS-PAGE analysis of purified seleno-hGPx1Sec and seleno-hGPx1Ser with (A) and without (B) 63 His tag. (C) Western blot analysis of purified seleno-hGPx1 mutants. (D) SDS-PAGE analysis of fractions from E. coli BL21(DE3)cys cells transformed with pCGPx1(C2/78/115/156/202S). Lane 1, marker; lane 2, soluble fraction of E. coli without isopropyl-b-d-1-thiogalactopyranoside (IPTG) induction; lane 3, soluble fraction of E. coli after IPTG induction; lane 4, the purified seleno-hGPx1Ser; lane 5, the complex with nondenatured and denatured seleno-hGPx1Ser. (E) Nondenaturing PAGE analysis of the purified seleno-hGPx1Ser. Lane 1, denatured seleno-hGPx1Ser; lane 2, nondenatured seleno-hGPx1Ser. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
different temperatures and pH to determine optimal conditions for seleno-hGPx1Ser. It was examined over the temperature range from 20.0 C to 70.0 C. As shown in Fig. 2, selenohGPx1Ser displayed the highest enzyme activity at 37 C. At 50 C relative GPx activity displayed a sharp decrease reaching a value of about 75%, and increasingly higher temperatures resulted in a steady decrease of relative activity, reaching a value of about 45% at 70 C. And the activity was also measured under various pH conditions (6–12). The enzyme had an optimum pH at 9 (Fig. 2), which was close to the optimum pH8.5 of natural GPx1 from human liver (36) and the optimum pH8.8 of natural GPx1 from bovine red blood cells (37). It is obvious that the activity of seleno-hGPx1Ser at pH 7.4, 37 C was only 26% of its maximum at pH 9, 37 C, but it is still the highest among all GPx mutants and mimics prepared using this method. To probe the mechanism of seleno-hGPx1Ser, comprehensive kinetic studies were carried out. The initial velocities for H2O2 reduction catalyzed by seleno-hGPx1Ser were determined
216
TABLE 3
The GPx activities of seleno-hGPX1 mutants and other catalyst
Catalyst
Activity (U/mmol)
seleno-hGPx1Sec
522 6 58
seleno-hGPx1Ser
5,278 6 335
Ebselen (30)
0.99
seleno-hGrx1 (18)
136
seleno-hGSTZ1-1 (19)
2,266
GPx (human plasma) (32)
302
GPx (bovine liver) (33)
2,084
GPx (rabbit liver) (34)
5,780
Expression and Characterization of hGPx1 Mutants
FIG 2
Properties of seleno-hGPx1Ser. The activities were determined when the concentration of GSH and H2O2 were 1 and 0.5 mM, respectively. (A) Relative GPx activity versus temperature. (B) Relative GPx activity versus pH. The GPx activity was converted to the relative value, and the highest activity was defined to be 100%.
as a function of substrate concentration when the concentration of one substrate was varied and that of the other was fixed. Equation (1) is the relevant steady-state rate equation. kcat is the H2 O2 GSH pseudo-first-order rate constant, Km and Km are the apparent Michaelis constants for peroxide and thiol, respectively. The apparent kinetic parameters deduced from Equation (1) and obtained at several GSH and H2O2 concentrations are listed H2 O2 in Table 4. The apparent second-order rate constant kcat =Km GSH and kcat =Km were found to be 1.39 3 107 M21 min21 and 1.30 H2 O2 3 107 M21 min21, respectively. Although the value of kcat =Km was lower than natural hGPx1 (38), it was much higher than those of some GPx mimics (30,39). It illustrated that the rate of catalytic reaction between the enzyme and H2O2 was slower than the natural one, but faster than those mimics. The value of GSH kcat =Km was in the same order of magnitude as that of natural
TABLE 4 [GSH] (mM)
hGPx1 (38), indicating that seleno-hGPx1Ser and native GPx had similar affinities to GSH. It should still be ascribed to the special catalytic center of natural GPx, which could stabilize intermolecular interactions. Double reciprocal plots of the initial velocities versus concentrations of the substrates generate a group of parallel lines (Fig. 3), these values fit in the ping-pong mechanism in analogy with those of natural GPx (38). That is to say, the catalytic reaction of the enzyme comprises two independent events: oxidation of the reduced enzyme by hydroperoxide and reduction of the oxidized enzyme by GSH (40). Furthermore, treatment of seleno-hGPx1Ser with excess iodoacetate resulted in complete loss of GPx activity, suggesting the presentation of the enzyme-bound selenol in the catalytic cycle. All these facts are in agreement with those of native GPx.
The kinetic parameters of seleno-hGPx1Ser
kcat (min21)
H2 O 2 Km (M)
H2 O2 kcat/Km (M21min21)
3
283 6 45
(2.04 6 0.24) 3 1025
(1.39 6 0.41) 3 107
5
636 6 31
(4.58 6 0.21) 3 1025
(1.39 6 0.15) 3 107
8
2,460 6 103
(1.77 6 0.37) 3 1024
(1.39 6 0.28) 3 107
10
43,668 6 598
(3.14 6 0.26) 31023
(1.39 6 0.23) 3 107
[H2O2] (lM)
kcat (min21)
GSH Km (M)
GSH kcat/Km (M21min21)
30
291 6 23
(2.24 6 0.13) 3 1025
(1.30 6 0.18) 3 107
50
694 6 38
(5.30 6 0.21) 3 1025
(1.30 6 0.19) 3 107
80
13,386 6 624
(1.03 6 0.26) 3 1024
(1.30 6 0.24) 3 107
100
40,983 6 925
(3.12 6 0.25) 3 1023
(1.30 6 0.37) 3 107
Guo et al.
217
IUBMB LIFE
Double-reciprocal plots for the reduction of H2O2 by GSH catalyzed by seleno-hGPx1Ser. (A) [E]0/V0 versus 1/[H2O2] (mM21) at [GSH] 5 3 mM (black filled square), 5 mM (red filled circle), 8 mM (green filled triangle), 10 mM (blue filled down triangle). (B) [E]0/V0 versus 1/[GSH] (mM21) at [H2O2] 5 30 lM (black filled square), 50 lM (red filled circle), 80 lM (green filled triangle), 100 lM (blue filled down triangle). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
FIG 3
V0 kcat ½GSH ½H2 O2 5 HO 2 2 GSH ½H O 1½GSH ½H O ½E0 Km ½GSH 1Km 2 2 2 2
(1)
In conclusion, we successfully cloned hGPx1 gene and expressed seleno-hGPx1 mutant proteins in E. coli using cysteine auxotrophic expression system. The enzymatic properties also have been characterized. Seleno-hGPx1Ser shows an excellent antioxidant capacity in the protection of hydrogen peroxide that could compare with other artificial selenoenzymes. This should be attributed to the structure of natural GPx, which contains a conserved catalytic center and the GSH binding site. We expect that this research would provide a suitable enzymatic model for a further studying of the relationships between structures and functions of GPx. In addition, seleno-hGPx1Ser will be a potential candidate as an oxidant for medical applications.
Acknowledgements €ck The authors thank Prof. Marie-Paule Strub and August Bo for providing the E. coli Cys auxotrophic strain, BL21(DE3)cys. This work is supported by the National Natural Science Funds, China (Nos. 30970633 and 31270851) and Doctoral Funding Grants, Norman Bethune Health Science Center of Jilin University (No. 2013B73333).
References [1] Ray, P. D., Huang, B. W., and Tsuji, Y. (2012) Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signal. 24, 981– 990. [2] Bachschmid, M. M., Schildknecht, S., Matsui, R., Zee, R., Haeussler, D., A. Cohen, R., et al. (2013) Vascular aging: chronic oxidative stress and impairment of redox signaling-consequences for vascular homeostasis and disease. Ann. Med. 45, 17–36. [3] Oliveira, B. F., Nogueira-Machado, J. A., and Chaves, M. M. (2010) The role of oxidative stress in the aging process. Sci World J. 10, 1121–1128. [4] Mugesh, G. and du Mont, W. W. (2001) Structure–activity correlation between natural glutathione peroxidase (GPx) and mimics: a biomimetic con-
218
cept for the design and synthesis of more efficient GPx mimics. Chem. A Eur. J. 7, 1365–1370. [5] Xu, H., Gao, J., Wang, Y., Wang, Z., Smet, M., et al. (2006) Hyperbranched polyselenides as glutathione peroxidase mimics. Chem. Commun. 7, 796–798. [6] de Haan, J. B., Bladier, C., Griffiths, P., Kelner, M., O’Shea, R. D., et al. (1998) Mice with a homozygous null mutation for the most abundant glutathione peroxidase, Gpx1, show increased susceptibility to the oxidative stressinducing agents paraquat and hydrogen peroxide. J. Biol. Chem. 273, 22528– 22536. [7] Arsova-Sarafinovska, Z., Matevska, N., Eken, A., Petrovski, D., Banev, S., et al. (2009) Glutathione peroxidase 1 (GPX1) genetic polymorphism, erythrocyte GPX activity, and prostate cancer risk. Int. Urol. Nephrol. 41, 63–70. [8] Hayes, J. D. and McLellan, L. I. (1999) Glutathione and glutathione-dependent enzymes represent a co-ordinately regulated defence against oxidative stress. Free Radic. Res. 31, 273–300. [9] Hu, Y., Benya, R. V., Carroll, R. E., and Diamond, A. M. (2005) Allelic loss of the gene for the GPX1 selenium-containing protein is a common event in cancer. J. Nutr. 135, 3021S–3024S. [10] Lei, X. G. and Cheng, W. H. (2005) New roles for an old selenoenzyme: evidence from glutathione peroxidase-1 null and overexpressing mice. J. Nutr. 135, 2295–2298. [11] Cao, C., Leng, Y., Huang, W., Liu, X., and Kufe, D. (2003) Glutathione peroxidase 1 is regulated by the c-Abl and Arg tyrosine kinases. J. Biol. Chem. 278, 39609–39614. [12] Cheng, F., Torzewski, M., Degreif, A., Rossmann, H., Canisius, A., et al. (2013) Impact of glutathione peroxidase-1 deficiency on macrophage foam cell formation and proliferation: implications for atherogenesis. PloS One 8, e72063. [13] Epp, O., Ladenstein, R., and Wendel, A. (1983) The refined structure of the selenoenzyme glutathione peroxidase at 0.2-nm resolution. Eur. J. Biochem. 133, 51–69. [14] Latre`che, L., Duhieu, S., Touat-Hamici, Z., Jean-Jean, O., and Chavatte, L. (2012) The differential expression of glutathione peroxidase 1 and 4 depends on the nature of the SECIS element. RNA Biol. 9, 681–690. [15] Ogawa, A., Yoshimoto, T., Kikuchi, H., Sano, K., Saito, I., et al. (1999) Ebselen in acute middle cerebral artery occlusion: a placebo-controlled, doubleblind clinical trial. Cerebrovasc. Dis. 9, 112–118. [16] Singh, V. P., Singh, H. B., and Butcher, R. J. (2011) Synthesis and glutathione peroxidase-like activities of isoselenazolines. Eur. J. Org. Chem. 28, 5485–5497. [17] Messali, M., Abboudi, M., Aouad, M. R., Rezki, N., and Christiaens, L. E. (2012) Synthesis and characterization of a new five and six membered selenoheterocyclic compounds homologues of ebselen. Org. Chem. Int. 2011.
Expression and Characterization of hGPx1 Mutants
[18] Zhang, W., Luo, Q., Wang, X., Zhang, D., Miao, L., et al. (2012) Engineering human seleno-glutaredoxin containing consecutive rare codons as an artificial glutathione peroxidase. Chin. Sci. Bull. 57, 25–32. [19] Yin, L., Song, J., Board, P. G., Yu, Y., Han, X., et al. (2013) Characterization of selenium-containing glutathione transferase zeta1-1 with high GPX activity prepared in eukaryotic cells. J. Mol. Recogn. 26, 38–45. [20] Xu, J. J., Song, J., Su, J. M., Wei, J. Y., Yu, Y., et al. (2010) A new human catalytic antibody Se-scFv-2D8 and its selenium-containing single domains with high GPX activity. J. Mol. Recogn. 23, 352–359. [21] Xu, J. J., Song, J., Yan, F., Chu, H. Y., Luo, J. X., et al. (2009) Improving GPX activity of selenium-containing human single-chain Fv antibody by site-directed mutation based on the structural analysis. J. Mol. Recogn. 22, 293–300. [22] Yu, Y., Song, J., Song, Y., Guo, X., Han, Y. D., et al. (2013) Characterization of catalytic activity and structure of selenocysteine-containing hGSTZ1c-1c based on site-directed mutagenesis and computational analysis. IUBMB Life 65, 163–170. [23] Sanchez, J. F., Hoh, F., Strub, M. P., Aumelas, A., and Dumas, C. (2002). Structure of the cathelicidin motif of protegrin-3 precursor: structural insights into the activation mechanism of an antimicrobial protein. Structure 10, 1363 – 1370. € ck, A., et al. (2003) Sele[24] Strub, M. P., Hoh, F., Sanchez, J. F., Strub, J. M., Bo nomethionine and selenocysteine double labeling strategy for crystallographic phasing. Structure 11, 1359–1367. [25] Mueller, S., Senn, H., Gsell, B., Vetter, W., Baron, C., et al. (1994) The formation of diselenide bridges in proteins by incorporation of selenocysteine residues: biosynthesis and characterization of (Se) 2-thioredoxin. Biochemistry 33, 3404–3412. [26] Wilson, S. R., Zucker, P. A., Huang, R. R. C., and Spector, A. (1989) Development of synthetic compounds with glutathione peroxidase activity. J. Am. Chem. Soc. 111, 5936–5939. [27] Won, H. Y., Sohn, J. H., Min, H. J., Lee, K., Woo, H. A., et al. (2010) Glutathione peroxidase 1 deficiency attenuates allergen-induced airway inflammation by suppressing Th2 and Th17 cell development. Antioxidants Redox Signal. 13, 575–587.
Guo et al.
[28] Guo, X., Song, J., Yu, Y., and Wei, J. Y. (2014) Can recombinant human glutathione peroxidase 1 with high activity be efficiently produced in Escherichia coli? Antioxidants Redox Signal. 20, 1524–1530. € ck, A., Li, J., Luo, G. M., et al. (2005) Engineering glu[29] Yu, H. J., Liu, J. Q., Bo tathione transferase to a novel glutathione peroxidase mimic with high catalytic efficiency. J. Biol. Chem. 280, 11930–11935. [30] Sakurai, T., Kanayama, M., Shibata, T., Itoh, K., Kobayashi, A., et al. (2006) Ebselen, a seleno-organic antioxidant, as an electrophile. Chem. Res. Toxicol. 19, 1196–1204. [31] Han, X., Fan, Z. L., Yu, Y., Liu, S. L., Hao, Y. Z., et al. (2013) Expression and characterization of recombinant human phospholipid hydroperoxide glutathione peroxidase. IUBMB Life 65, 951–956. [32] Yamamoto, Y. and Takahashi, K. (1993) Glutathione peroxidase isolated from plasma reduces phospholipid hydroperoxides. Arch. Biochem. Biophys. 305, 541–545. [33] Thompson, K. G., Fraser, A. J., Harrop, B. M., and Kirk, J. A. (1980) Glutathione peroxidase activity in bovine serum and erythrocytes in relation to selenium concentrations of blood, serum and liver. Res. Vet. Sci. 28, 321–324. [34] Manneervik, B. (1985) Glutathione peroxidase. Method Enzymol. 113, 490– 495. , L., Toppo, S., Cozza, G., and Ursini, F. (2011) A comparison of thiol [35] Flohe peroxidase mechanisms. Antioxidants Redox Signal. 15, 763–780. [36] Toshinobu, M., Tetsuo, A., Yoshimasa, I., Kazuyuki, H., and Mamoru, S. (1983) Purification and properties of glutathione peroxidase from human liver. Chem. Pharm. Bull. 31, 179–185. [37] Wendel, A. (1981) Glutathione peroxidase. In Methods Enzymol, pp. 325– 333, Academic Press, New York. [38] Takebe, G., Yarimizu, J., Saito, Y., Hayashi, T., Nakamura, H., et al. (2002) A comparative study on the hydroperoxide and thiol specificity of the glutathione peroxidase family and selenoprotein P. J. Biol. Chem. 277, 41254– 41258. [39] Ren, X. J., Gao, S. J., You, D. L., Huang, H. L., Liu, Z., et al. (2001) Cloning and expression of a single-chain catalytic antibody that acts as a glutathione peroxidase mimic with high catalytic efficiency. Biochem. J. 359, 369–374. , L., Ursini, F., Vanin, S., and Maiorino, M. (2009) Catalytic [40] Toppo, S., Flohe mechanisms and specificities of glutathione peroxidases: variations of a basic scheme. Biochim. Biophys. Acta Gen. Subjects. 1790, 1486–1500.
219
Xiao Guo† Yang Yu† Xixi Liu Yinlong Zhang Tuchen Guan Guiqiu Xie* Jingyan Wei*
College of Pharmaceutical Science, Jilin University, Changchun, China
Abstract Cellular glutathione peroxidase (GPx1; EC1.11.1.9) is a major intracellular antioxidant selenoenzyme in mammals. However, the complicated expression mechanism of selenocysteine (Sec)-containing protein increases the difficulty of expressing human GPx1 (hGPx1) in Escherichia coli (E. coli). In this study, hGPx1 gene was cloned from a cDNA library of the human hepatoma cell line HepG2. The codon UGA encoding Sec49 of hGPx1 was first mutated to UGC encoding cysteine (Cys) and then biosynthetically converted to Sec during expression in an E. coli BL21(DE3)cys auxotrophic system. Seleno-GPx1Sec displayed a low GPx activity of 522 U/lmol. To improve the activity, the other five Cys residues (C2, C78, C115, C156, C202)
were mutated to serine (Ser) in one hGPx1 molecule. The mutant seleno-hGPx1Ser showed a high activity of 5278 U/ lmol, which was more than 10-fold enhanced as compared with seleno-GPx1Sec. The activity was the highest among all of those seleno-proteins obtained by this method so far. Kinetic analysis of seleno-hGPx1Ser showed a typical ping-pong mechanism, which was similar to those of natural GPxs. This research will be of value in overcoming the problem of limited sources of natural GPx and substantially promotes the C 2014 IUBMB Life, research of the characterization of GPx. V 66(3):212–219, 2014
Keywords: glutathione peroxidase; selenocystein; cysteine auxotrophic strain; site-directed mutagenesis
Introduction Reactive oxygen species (ROS) are associated with a variety of disease states, such as atherosclerosis, cancer, Parkinson’s dis-
C International Union of Biochemistry and Molecular Biology V
Volume 66, Number 3, March 2014, Pages 212–219 *Address correspondence to: Jingyan Wei, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun 130021, China. Tel.: 186–431-85619716. Fax: 186–431-85619252. E-mail: [email protected] or Guiqiu Xie, College of Pharmaceutical Science, Jilin University, 1266 Fujin Road, Changchun, 130021, China. Tel.: 186-43185619716. Fax: 186-431-85619252. E-mail: [email protected] Abbreviations: GPx, glutathione peroxidase; hGPx1, human glutathione peroxidase 1; Sec, selenocysteine; GSH, glutathione; HepG2, human hepatoma cell line; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; PCR, polymerase chain reaction. Received 24 February 2014; Accepted 1 March 2014 † X.G. and Y.Y. contributed equally to this article. DOI 10.1002/iub.1255 Published online 23 March 2014 in Wiley Online Library (wileyonlinelibrary.com)
212
ease, diabetes, and aging (1,2). The harmful effects of ROS are balanced by the antioxidant action of antioxidant enzymes and nonenzymatic antioxidants (3). Central antioxidant enzymes include superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx). As a scavenger of ROS, GPx is a critical selenoenzyme which can protect biomembranes and other cellular components from oxidative damage by catalyzing the reduction of hydrogen peroxide (H2O2), organic hydroperoxides, and lipid peroxides to water and the corresponding alcohol, using reduced glutathione (GSH) as an essential cosubstrate (4,5). Up to date, eight distinct GPxs have been identified in mammals and these isozymes differ from each other by the structure, substrate specificity, and tissue distribution (6). GPx1 was the first seleno-containing enzyme to be identified, which is widely expressed and particularly abundant in erythrocytes, kidney, and liver (7,8). The pivotal role of GPx1 in protection against different oxidative stressors has been widely demonstrated (9–11). In the absence of GPx1, it will result in reductions in antioxidant defense and lead to diverse disease progression (12). Sec encoded by the stop codon UGA is the catalytic group in the active site of GPx (13). To synthesize GPx, both
IUBMB Life
TABLE 1
Strains and plasmids
Strains/plasmids
Relevant genotype or description
Source or reference
Strains DH5a
SupE44 Dlac U169 (/80 lac ZDM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1
Invitrogen
BL21(DE3)
hsdS gal (lcIts857 ind1 sam7 nin5 lacUV5-T7 gene 1)
Invitrogen
BL21(DE3)cys
BL21(DE3) selB::kan cysE51
(23,24)
pCold I
Cloning and expression vector, Ampr
Takara
pCG
pCold I with hGPx1 fragment in NdeI-HindIII
This study
pCG(U49C)
pCold I with hGPx1 (U49C) fragment in NdeI-HindIII
This study
pCG(C2/78/115/156/202S)
pCold I with hGPx1 (U49C,C2/78/115/156/202S) fragment in NdeI-HindIII
This study
Plasmids
prokaryotic and eukaryotic cells have their own mechanism of Sec insertion (14). Selenocysteine insertion sequence (SECIS) in the open reading frame would be needed for expression of a eukaryotic selenoprotein in bacteria. However, the major obstacle to such engineering is that the introduction of SECIS would alter the amino acid sequence and may affect the biological function of the enzyme. Owing to the difficulty in gene recombination technique and important biological roles of GPx, many research efforts have been made to mimic the function of GPx. Ebselen, a synthetic eleno-organic compound, is in phase II clinical trials for the treatment of acute ischemic stroke (15). Due to the application of Ebselen, several methods for its derivates synthesis have been developed (16,17). Glutathione S-transferase (GST) and glutaredoxin (Grx) are natural protein scaffolds with intrinsic GSH-binding sites and widely used to redesign GPx mimics (18,19). Furthermore, a number of GPx mimics have been built by a monoclonal antibody and bioimprinting techniques, which introduce the GSH binding site into the models (20,21). In this study, we prepared the recombinant hGPx1 using the cysteine auxotrophic system, which could effectively incorporate Sec into protein. The catalytic activity was greatly affected following all Cys residues in the protein changed to Sec in this system. After all Cys residues in hGPx1 were mutated to Ser residues, the mutant displayed remarkably higher activity toward H2O2. The biological properties of the mutant seleno-hGPx1Ser were also characterized.
Materials and Methods Bacterial Strains, Plasmids, and Media Bacterial strains and plasmids used in this study are listed in Table 1. The medium used in subcloning experiments and site-
Guo et al.
directed mutagenesis was Luria-Bertani broth. The media used in expression experiments were a modification of the minimal medium described previously (22).
Construction of Plasmids The cDNA library from human hepatoma cell line HepG2 was used as a template for polymerase chain reaction (PCR). Amplification primers hGPx1-F/hGPx1-R (Table 2) were designed using the hGPx1 cDNA sequences in NCBI. DNA was amplified in a 50 lL volume containing 1 lL template cDNA, 200 lM concentration of each deoxynucleoside triphosphate, 25 pM concentration of the respective primer, 1.5 U of Taq DNA polymerase (TAKARA), and 13 Taq polymerase buffer. PCR was executed under the following conditions: preheating for 120 sec at 94 C; 30 cycles of 30 sec at 94 C, 45 sec at 55 C, and 60 sec at 72 C; 10 min at 72 C. PCR fragments containing sequences encoding hGPx1 were cut with NdeI and HindIII and cloned into pCold I vector that was previously linearized with similar enzymes to give pCG expression vector. Positive clones were verified by enzyme digestion. Point mutations were generated by QuikChange SiteDirected Mutagenesis Kit (Stratagene, La Jolla, CA) according to manufacturer’s recommendations, and the mutagenic primers used in this study are listed in Table 2. The mutagenesis PCR reactions contained 50 ng template plasmid, 25 pmol of mutagenic primers, 0.1 mM of dNTP, 2.5 U of PfuTurbo DNA polymerase. The reaction was executed under the following conditions: preheating for 120 sec at 95 C and 18 cycles of 30 sec at 95 C, 60 sec at 55 C, and 12 min at 68 C. Add 1 lL of the DpnI restriction enzyme directly to the amplification reaction to digest the parental DNA template. The products were transformed E. coli DH5a. All mutated constructs were sequenced to confirm that no additional mutations had been introduced into the sequences.
213
IUBMB LIFE
TABLE 2
Primers used in this study
Gene(s)
Sequence 50 !30
hGPx1-F
GGAATTCCATATGTGTGCTGCTCGGC
hGPx1-R
CCCAAGCTTCTAGGCACAGCTGGGC
C2S-F
GAAGGTAGGCATATGTCTGCTGCTCGGCTAGCG
C2S-R
CGCTAGCCGAGCAGCAGACATATGCCTACCTTC
U49C-F
GAATGTGGCGTCCCTCTGCGGCACCACGGTCCGGGAC
U49C-R
GTCCCGGACCGTGGTGCCGCAGAGGGACGCCACATTC
C78S-F
GTGCTCGGCTTCCCGAGCAACCAGTTTGGGC
C78S-R
GCCCAAACTGGTTGCTCGGGAAGCCGAGCAC
C115S-F
CATGCTCTTCGAGAAGAGCGAGGTGAACGGTGC
C115S-R
GCACCGTTCACCTCGCTCTTCTCGAAGAGCATG
C156S-F
CACCTGGTCTCCGGTGAGTCGCAACGATGTTGC
C156S-R
GCAACATCGTTGCGACTCACCGGAGACCAGGTG
C202S-F
CTCAAGGGCCCAGCTCTGCCTAGAAGCTTGTC
C202S-R
GACAAGCTTCTAGGCAGAGCTGGGCCCTTGAG
Italics indicate the substitutions which resulted in mutation.
Overexpression and Purification of the Protein Plasmid DNA of pCG(U49C) and pCG(C2/78/115/156/202S) transformed into BL21(DE3)cys for the production of selenoproteins. Overexpression of seleno-hGPx1 and the mutant in the presence of Sec instead of Cys was performed using the method described previously (24,25). Crude protein extracts were prepared in buffer A containing 20 mM sodium phosphate (pH 7.4) and 500 mM NaCl. The proteins were purified by the immobilized metal affinity chromatography purification system using standard Ni21 charged beads. Unspecifically bound proteins were eluted by a washing step with three column volumes of buffer A containing 20 mM, 50 mM, 75 mM, and 100 mM imidazol. After the column was washed, the target protein was eluted with 300 mM imidazole and dialyzed in 150 mM NaCl to remove imidazole. The 63 His tag at Nterminus was removed by treatment with a factor Xa protease (New England Biolabs). Concentration of proteins was estimated by the Bradford method using bovine serum albumin as a standard.
PAGE and Western Blot Analysis Cells and the purified protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie Blue staining. Purified protein samples diluted 1:1 with nondenaturing loading buffer [50 mM glycine (pH 8.0), 20% glycerol (vol/vol)], and the mixture was electro-
214
phoresed using a 10% native PAGE gel (pH 8.0) with Tris/Glycine running buffer. For Western blotting, protein samples were loaded on a 12% (w/v) SDS-PAGE gel. When it was complete, the proteins on the gel were electrophoretically transferred to nitrocellulose membrane. The membrane was blocked with Tris-borate-NaCl (TBS) containing 5% nonfat dry milk for 1 h at 37 C and incubated with mouse anti-His6 monoclonal antibodies (Pharmacia) (1:1,000) at 37 C for 1 h. The membrane was washed three times with TBST and incubated with goat anti-mouse monoclonal antibody (Pharmacia) conjugated with horseradish peroxidase with gentle agitation for 1 h at 37 C. Reacting proteins were visualized by 3,3N-diaminobenzidine tertrahydrochloride (DAB)-H2O2 substrate that gave brown color.
Assay of Enzyme Activities GPx activities were assayed according to the method previously described by Wilson (26). The reaction was carried out at 37 C in 500 lL of solution containing 50 mM PBS (pH 7.4), 1 mM EDTA, 1 mM GSH (Sigma), 0.25 mM NADPH (Sigma), one unit of glutathione reductase, and 20–50 nM of samples. The mixture was preincubated for 5 min at 37 C and the reaction was then initiated by addition of substrate (0.5 mM H2O2). GPx activity was determined by the decrease of NADPH absorption at 340 nm. Negative control was performed in parallel without enzyme and was subtracted from assay values. The activity unit (U) is
Expression and Characterization of hGPx1 Mutants
defined as the amount of the protein that uses 1 lmol of NADPH per min. The specific activity is expressed in U/lmol.
Determination of Optimal pH and Temperature GPx activity of seleno-hGPx1Ser was measured with the same method as above. The pH value of buffer was changed in determining the initial rates of the reaction to obtain the optimal pH condition for seleno-hGPx1Ser catalyzed reaction. Similarly, the optimal temperature was determined by assaying the activity at various reaction temperatures.
Assay of Kinetics of Seleno-hGPx1Ser Steady-state kinetics was carried out following the method as described above (19). The initial rates were measured by observing the decrease of NADPH absorption at 340 nm at several concentrations of one substrate while the concentration of the second substrate was kept constant. GPx activities were measured using the same method as described above at 37 C and pH 7.4.
Results and Discussion Human GPx1, a major selenium-containing antioxidant enzyme in mammal, has been implicated in proliferation, apoptosis, activation of transcription factors, and modulating inflammation (27). Due to its essential function, many efforts have been made to obtain natural GPx and its mimics with prominent activities. In this context, the aim of this work was to express hGPx1 in Cys auxotrophic expression system and characterize its properties. A full-size hGPx1 cDNA was generated by PCR as described under Materials and Methods section. To express the gene of hGPx1 in E. coli, the codon UGA encoding Sec49 was first mutated to UGC encoding Cys. Then hGPx1 was expressed in Cys auxotrophic strain system, which could be efficiently replaced Cys with Sec in BL21(DE3)cys when Cys was omitted in the medium. However, there are five Cys residues in the protein; multi-Sec substitutions on hGPx1 would affect the structure and property of the protein in this expression system (22,28,29). Based on the results of previous studies, we constructed the mutant that the other five Cys in hGPx1 were mutated to Ser before introducing Sec at position 49. Heterologous expression of seleno-hGPx1Sec and selenohGPx1Ser gave a 24-kDa band visualized by Coomassie staining of SDS-PAGE (Fig. 1A) and the same band was detected by Western blot (Fig. 1C), which indicated that the hGPx1 mutants were successfully expressed and purified. The N-terminal 63 His-tag was removed by digestion with Factor Xa protease, as was proved by SDS-PAGE (Fig. 1B) the molecular weight was smaller than before. Figure 1D showed the results of the analysis of expression. There is no target band in the E. coli transformed with recombinant plasmid before induction (lane 2) and the soluble form of seleno-hGPx1Ser were produced in the expression (Lane 3). The complex of nondenatured and denatured seleno-hGPx1Ser migrated as two bands with apparent molecular weights of 97 kDa and 24 kDa (Lane 5). The dena-
Guo et al.
tured and nondenatured enzyme migrated as a single band but showed a distinct migration rate on native page (Fig. 1E). These results indicated that seleno-hGPx1Ser existed in solution as a tetrameric complex, which corresponded to the naturally occurring form of GPx1 (13). To test the catalytic capability of seleno-hGPx1Sec and seleno-hGPx1Ser, the activities were estimated by the coupled enzyme system under the same conditions. Seleno-hGPx1Sec showed a low GPx activity of 522 U/lmol. It could be proposed that the substitutions of the multi-Sec for Cys residues, especially at position 2, 78, 115, 156, and 202 at the same time in the auxotrophic strain, caused a considerable change of the hGPx1 structure and affected the catalytic activity. SelenohGPx1Ser displayed a high GPx activity of 5,278 U/lmol that was more than 10-fold higher than that of seleno-hGPx1Sec. Accordingly, the increasing GPx activity of the mutant should result from the conversion of the five Cys residues to Ser, which has been widely recognized. To examine whether the 63 His tag may have an impact on the structure and enzyme activity, equal amounts of pure seleno-hGPx1Sec and selenohGPx1Ser proteins without 63 His tag were added for activity assays as described in Material and Methods section. There is no significant difference in the activity between seleno-enzyme with and without 63 His tag. It suggested that 63 His tag had little effect on the structure and activity of the enzyme. However, considering the introduction of 63 His tag may increase immunogenicity of the mutant, it is encouraged to remove the 63 His tag in the future clinical applications. The capability of catalytic activity of seleno-hGPx1Ser toward H2O2 was found to be much more efficient than most of previous GPx mimics (Table 3). For instance, it was about 5,300-fold higher than Ebselen, which is currently being used in clinical trials against stroke (30). The activity was still the highest among all of those seleno-proteins obtained by this method so far. And it even could be comparable to those of natural GPx, such as human GPx4 (31), human plasma GPx (32), bovine liver GPx (33), and rabbit liver GPx (34) whose activities were in the order of 1022103 U/lmol. In summary, our data demonstrate a major role for the mutant in protection against H2O2. High GPx activity of seleno-hGPx1ser could be attributed to basing the natural hGPx1 scaffold with a conserved catalytic center and an intrinsic GSH binding site. At the catalytic moiety of natural GPx1, Sec and the specific binding site for GSH lie in a shallow groove of the enzyme surface, which is prone to recognize and combine with GSH (13). In addition, the conserved catalytic triad (Sec, Trp, and Gln) and Arg residues surrounding the active-site selenium composed a unique active center of GPx1, which would facilitate the nucleophilic attach on the hydroperoxide and involve in GSH binding via electrostatic attraction (35). These characteristics of seleno-hGPx1Ser exhibited an incomparable ability of reduction of peroxides with GSH, which hardly possesses in most GPx mimics. Temperature and pH exert a significant impact on the catalytic reactions of GPx. So the activity was performed at
215
IUBMB LIFE
FIG 1
PAGE and Western blot analysis of recombinant hGPx1. SDS-PAGE analysis of purified seleno-hGPx1Sec and seleno-hGPx1Ser with (A) and without (B) 63 His tag. (C) Western blot analysis of purified seleno-hGPx1 mutants. (D) SDS-PAGE analysis of fractions from E. coli BL21(DE3)cys cells transformed with pCGPx1(C2/78/115/156/202S). Lane 1, marker; lane 2, soluble fraction of E. coli without isopropyl-b-d-1-thiogalactopyranoside (IPTG) induction; lane 3, soluble fraction of E. coli after IPTG induction; lane 4, the purified seleno-hGPx1Ser; lane 5, the complex with nondenatured and denatured seleno-hGPx1Ser. (E) Nondenaturing PAGE analysis of the purified seleno-hGPx1Ser. Lane 1, denatured seleno-hGPx1Ser; lane 2, nondenatured seleno-hGPx1Ser. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
different temperatures and pH to determine optimal conditions for seleno-hGPx1Ser. It was examined over the temperature range from 20.0 C to 70.0 C. As shown in Fig. 2, selenohGPx1Ser displayed the highest enzyme activity at 37 C. At 50 C relative GPx activity displayed a sharp decrease reaching a value of about 75%, and increasingly higher temperatures resulted in a steady decrease of relative activity, reaching a value of about 45% at 70 C. And the activity was also measured under various pH conditions (6–12). The enzyme had an optimum pH at 9 (Fig. 2), which was close to the optimum pH8.5 of natural GPx1 from human liver (36) and the optimum pH8.8 of natural GPx1 from bovine red blood cells (37). It is obvious that the activity of seleno-hGPx1Ser at pH 7.4, 37 C was only 26% of its maximum at pH 9, 37 C, but it is still the highest among all GPx mutants and mimics prepared using this method. To probe the mechanism of seleno-hGPx1Ser, comprehensive kinetic studies were carried out. The initial velocities for H2O2 reduction catalyzed by seleno-hGPx1Ser were determined
216
TABLE 3
The GPx activities of seleno-hGPX1 mutants and other catalyst
Catalyst
Activity (U/mmol)
seleno-hGPx1Sec
522 6 58
seleno-hGPx1Ser
5,278 6 335
Ebselen (30)
0.99
seleno-hGrx1 (18)
136
seleno-hGSTZ1-1 (19)
2,266
GPx (human plasma) (32)
302
GPx (bovine liver) (33)
2,084
GPx (rabbit liver) (34)
5,780
Expression and Characterization of hGPx1 Mutants
FIG 2
Properties of seleno-hGPx1Ser. The activities were determined when the concentration of GSH and H2O2 were 1 and 0.5 mM, respectively. (A) Relative GPx activity versus temperature. (B) Relative GPx activity versus pH. The GPx activity was converted to the relative value, and the highest activity was defined to be 100%.
as a function of substrate concentration when the concentration of one substrate was varied and that of the other was fixed. Equation (1) is the relevant steady-state rate equation. kcat is the H2 O2 GSH pseudo-first-order rate constant, Km and Km are the apparent Michaelis constants for peroxide and thiol, respectively. The apparent kinetic parameters deduced from Equation (1) and obtained at several GSH and H2O2 concentrations are listed H2 O2 in Table 4. The apparent second-order rate constant kcat =Km GSH and kcat =Km were found to be 1.39 3 107 M21 min21 and 1.30 H2 O2 3 107 M21 min21, respectively. Although the value of kcat =Km was lower than natural hGPx1 (38), it was much higher than those of some GPx mimics (30,39). It illustrated that the rate of catalytic reaction between the enzyme and H2O2 was slower than the natural one, but faster than those mimics. The value of GSH kcat =Km was in the same order of magnitude as that of natural
TABLE 4 [GSH] (mM)
hGPx1 (38), indicating that seleno-hGPx1Ser and native GPx had similar affinities to GSH. It should still be ascribed to the special catalytic center of natural GPx, which could stabilize intermolecular interactions. Double reciprocal plots of the initial velocities versus concentrations of the substrates generate a group of parallel lines (Fig. 3), these values fit in the ping-pong mechanism in analogy with those of natural GPx (38). That is to say, the catalytic reaction of the enzyme comprises two independent events: oxidation of the reduced enzyme by hydroperoxide and reduction of the oxidized enzyme by GSH (40). Furthermore, treatment of seleno-hGPx1Ser with excess iodoacetate resulted in complete loss of GPx activity, suggesting the presentation of the enzyme-bound selenol in the catalytic cycle. All these facts are in agreement with those of native GPx.
The kinetic parameters of seleno-hGPx1Ser
kcat (min21)
H2 O 2 Km (M)
H2 O2 kcat/Km (M21min21)
3
283 6 45
(2.04 6 0.24) 3 1025
(1.39 6 0.41) 3 107
5
636 6 31
(4.58 6 0.21) 3 1025
(1.39 6 0.15) 3 107
8
2,460 6 103
(1.77 6 0.37) 3 1024
(1.39 6 0.28) 3 107
10
43,668 6 598
(3.14 6 0.26) 31023
(1.39 6 0.23) 3 107
[H2O2] (lM)
kcat (min21)
GSH Km (M)
GSH kcat/Km (M21min21)
30
291 6 23
(2.24 6 0.13) 3 1025
(1.30 6 0.18) 3 107
50
694 6 38
(5.30 6 0.21) 3 1025
(1.30 6 0.19) 3 107
80
13,386 6 624
(1.03 6 0.26) 3 1024
(1.30 6 0.24) 3 107
100
40,983 6 925
(3.12 6 0.25) 3 1023
(1.30 6 0.37) 3 107
Guo et al.
217
IUBMB LIFE
Double-reciprocal plots for the reduction of H2O2 by GSH catalyzed by seleno-hGPx1Ser. (A) [E]0/V0 versus 1/[H2O2] (mM21) at [GSH] 5 3 mM (black filled square), 5 mM (red filled circle), 8 mM (green filled triangle), 10 mM (blue filled down triangle). (B) [E]0/V0 versus 1/[GSH] (mM21) at [H2O2] 5 30 lM (black filled square), 50 lM (red filled circle), 80 lM (green filled triangle), 100 lM (blue filled down triangle). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]
FIG 3
V0 kcat ½GSH ½H2 O2 5 HO 2 2 GSH ½H O 1½GSH ½H O ½E0 Km ½GSH 1Km 2 2 2 2
(1)
In conclusion, we successfully cloned hGPx1 gene and expressed seleno-hGPx1 mutant proteins in E. coli using cysteine auxotrophic expression system. The enzymatic properties also have been characterized. Seleno-hGPx1Ser shows an excellent antioxidant capacity in the protection of hydrogen peroxide that could compare with other artificial selenoenzymes. This should be attributed to the structure of natural GPx, which contains a conserved catalytic center and the GSH binding site. We expect that this research would provide a suitable enzymatic model for a further studying of the relationships between structures and functions of GPx. In addition, seleno-hGPx1Ser will be a potential candidate as an oxidant for medical applications.
Acknowledgements €ck The authors thank Prof. Marie-Paule Strub and August Bo for providing the E. coli Cys auxotrophic strain, BL21(DE3)cys. This work is supported by the National Natural Science Funds, China (Nos. 30970633 and 31270851) and Doctoral Funding Grants, Norman Bethune Health Science Center of Jilin University (No. 2013B73333).
References [1] Ray, P. D., Huang, B. W., and Tsuji, Y. (2012) Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cell. Signal. 24, 981– 990. [2] Bachschmid, M. M., Schildknecht, S., Matsui, R., Zee, R., Haeussler, D., A. Cohen, R., et al. (2013) Vascular aging: chronic oxidative stress and impairment of redox signaling-consequences for vascular homeostasis and disease. Ann. Med. 45, 17–36. [3] Oliveira, B. F., Nogueira-Machado, J. A., and Chaves, M. M. (2010) The role of oxidative stress in the aging process. Sci World J. 10, 1121–1128. [4] Mugesh, G. and du Mont, W. W. (2001) Structure–activity correlation between natural glutathione peroxidase (GPx) and mimics: a biomimetic con-
218
cept for the design and synthesis of more efficient GPx mimics. Chem. A Eur. J. 7, 1365–1370. [5] Xu, H., Gao, J., Wang, Y., Wang, Z., Smet, M., et al. (2006) Hyperbranched polyselenides as glutathione peroxidase mimics. Chem. Commun. 7, 796–798. [6] de Haan, J. B., Bladier, C., Griffiths, P., Kelner, M., O’Shea, R. D., et al. (1998) Mice with a homozygous null mutation for the most abundant glutathione peroxidase, Gpx1, show increased susceptibility to the oxidative stressinducing agents paraquat and hydrogen peroxide. J. Biol. Chem. 273, 22528– 22536. [7] Arsova-Sarafinovska, Z., Matevska, N., Eken, A., Petrovski, D., Banev, S., et al. (2009) Glutathione peroxidase 1 (GPX1) genetic polymorphism, erythrocyte GPX activity, and prostate cancer risk. Int. Urol. Nephrol. 41, 63–70. [8] Hayes, J. D. and McLellan, L. I. (1999) Glutathione and glutathione-dependent enzymes represent a co-ordinately regulated defence against oxidative stress. Free Radic. Res. 31, 273–300. [9] Hu, Y., Benya, R. V., Carroll, R. E., and Diamond, A. M. (2005) Allelic loss of the gene for the GPX1 selenium-containing protein is a common event in cancer. J. Nutr. 135, 3021S–3024S. [10] Lei, X. G. and Cheng, W. H. (2005) New roles for an old selenoenzyme: evidence from glutathione peroxidase-1 null and overexpressing mice. J. Nutr. 135, 2295–2298. [11] Cao, C., Leng, Y., Huang, W., Liu, X., and Kufe, D. (2003) Glutathione peroxidase 1 is regulated by the c-Abl and Arg tyrosine kinases. J. Biol. Chem. 278, 39609–39614. [12] Cheng, F., Torzewski, M., Degreif, A., Rossmann, H., Canisius, A., et al. (2013) Impact of glutathione peroxidase-1 deficiency on macrophage foam cell formation and proliferation: implications for atherogenesis. PloS One 8, e72063. [13] Epp, O., Ladenstein, R., and Wendel, A. (1983) The refined structure of the selenoenzyme glutathione peroxidase at 0.2-nm resolution. Eur. J. Biochem. 133, 51–69. [14] Latre`che, L., Duhieu, S., Touat-Hamici, Z., Jean-Jean, O., and Chavatte, L. (2012) The differential expression of glutathione peroxidase 1 and 4 depends on the nature of the SECIS element. RNA Biol. 9, 681–690. [15] Ogawa, A., Yoshimoto, T., Kikuchi, H., Sano, K., Saito, I., et al. (1999) Ebselen in acute middle cerebral artery occlusion: a placebo-controlled, doubleblind clinical trial. Cerebrovasc. Dis. 9, 112–118. [16] Singh, V. P., Singh, H. B., and Butcher, R. J. (2011) Synthesis and glutathione peroxidase-like activities of isoselenazolines. Eur. J. Org. Chem. 28, 5485–5497. [17] Messali, M., Abboudi, M., Aouad, M. R., Rezki, N., and Christiaens, L. E. (2012) Synthesis and characterization of a new five and six membered selenoheterocyclic compounds homologues of ebselen. Org. Chem. Int. 2011.
Expression and Characterization of hGPx1 Mutants
[18] Zhang, W., Luo, Q., Wang, X., Zhang, D., Miao, L., et al. (2012) Engineering human seleno-glutaredoxin containing consecutive rare codons as an artificial glutathione peroxidase. Chin. Sci. Bull. 57, 25–32. [19] Yin, L., Song, J., Board, P. G., Yu, Y., Han, X., et al. (2013) Characterization of selenium-containing glutathione transferase zeta1-1 with high GPX activity prepared in eukaryotic cells. J. Mol. Recogn. 26, 38–45. [20] Xu, J. J., Song, J., Su, J. M., Wei, J. Y., Yu, Y., et al. (2010) A new human catalytic antibody Se-scFv-2D8 and its selenium-containing single domains with high GPX activity. J. Mol. Recogn. 23, 352–359. [21] Xu, J. J., Song, J., Yan, F., Chu, H. Y., Luo, J. X., et al. (2009) Improving GPX activity of selenium-containing human single-chain Fv antibody by site-directed mutation based on the structural analysis. J. Mol. Recogn. 22, 293–300. [22] Yu, Y., Song, J., Song, Y., Guo, X., Han, Y. D., et al. (2013) Characterization of catalytic activity and structure of selenocysteine-containing hGSTZ1c-1c based on site-directed mutagenesis and computational analysis. IUBMB Life 65, 163–170. [23] Sanchez, J. F., Hoh, F., Strub, M. P., Aumelas, A., and Dumas, C. (2002). Structure of the cathelicidin motif of protegrin-3 precursor: structural insights into the activation mechanism of an antimicrobial protein. Structure 10, 1363 – 1370. € ck, A., et al. (2003) Sele[24] Strub, M. P., Hoh, F., Sanchez, J. F., Strub, J. M., Bo nomethionine and selenocysteine double labeling strategy for crystallographic phasing. Structure 11, 1359–1367. [25] Mueller, S., Senn, H., Gsell, B., Vetter, W., Baron, C., et al. (1994) The formation of diselenide bridges in proteins by incorporation of selenocysteine residues: biosynthesis and characterization of (Se) 2-thioredoxin. Biochemistry 33, 3404–3412. [26] Wilson, S. R., Zucker, P. A., Huang, R. R. C., and Spector, A. (1989) Development of synthetic compounds with glutathione peroxidase activity. J. Am. Chem. Soc. 111, 5936–5939. [27] Won, H. Y., Sohn, J. H., Min, H. J., Lee, K., Woo, H. A., et al. (2010) Glutathione peroxidase 1 deficiency attenuates allergen-induced airway inflammation by suppressing Th2 and Th17 cell development. Antioxidants Redox Signal. 13, 575–587.
Guo et al.
[28] Guo, X., Song, J., Yu, Y., and Wei, J. Y. (2014) Can recombinant human glutathione peroxidase 1 with high activity be efficiently produced in Escherichia coli? Antioxidants Redox Signal. 20, 1524–1530. € ck, A., Li, J., Luo, G. M., et al. (2005) Engineering glu[29] Yu, H. J., Liu, J. Q., Bo tathione transferase to a novel glutathione peroxidase mimic with high catalytic efficiency. J. Biol. Chem. 280, 11930–11935. [30] Sakurai, T., Kanayama, M., Shibata, T., Itoh, K., Kobayashi, A., et al. (2006) Ebselen, a seleno-organic antioxidant, as an electrophile. Chem. Res. Toxicol. 19, 1196–1204. [31] Han, X., Fan, Z. L., Yu, Y., Liu, S. L., Hao, Y. Z., et al. (2013) Expression and characterization of recombinant human phospholipid hydroperoxide glutathione peroxidase. IUBMB Life 65, 951–956. [32] Yamamoto, Y. and Takahashi, K. (1993) Glutathione peroxidase isolated from plasma reduces phospholipid hydroperoxides. Arch. Biochem. Biophys. 305, 541–545. [33] Thompson, K. G., Fraser, A. J., Harrop, B. M., and Kirk, J. A. (1980) Glutathione peroxidase activity in bovine serum and erythrocytes in relation to selenium concentrations of blood, serum and liver. Res. Vet. Sci. 28, 321–324. [34] Manneervik, B. (1985) Glutathione peroxidase. Method Enzymol. 113, 490– 495. , L., Toppo, S., Cozza, G., and Ursini, F. (2011) A comparison of thiol [35] Flohe peroxidase mechanisms. Antioxidants Redox Signal. 15, 763–780. [36] Toshinobu, M., Tetsuo, A., Yoshimasa, I., Kazuyuki, H., and Mamoru, S. (1983) Purification and properties of glutathione peroxidase from human liver. Chem. Pharm. Bull. 31, 179–185. [37] Wendel, A. (1981) Glutathione peroxidase. In Methods Enzymol, pp. 325– 333, Academic Press, New York. [38] Takebe, G., Yarimizu, J., Saito, Y., Hayashi, T., Nakamura, H., et al. (2002) A comparative study on the hydroperoxide and thiol specificity of the glutathione peroxidase family and selenoprotein P. J. Biol. Chem. 277, 41254– 41258. [39] Ren, X. J., Gao, S. J., You, D. L., Huang, H. L., Liu, Z., et al. (2001) Cloning and expression of a single-chain catalytic antibody that acts as a glutathione peroxidase mimic with high catalytic efficiency. Biochem. J. 359, 369–374. , L., Ursini, F., Vanin, S., and Maiorino, M. (2009) Catalytic [40] Toppo, S., Flohe mechanisms and specificities of glutathione peroxidases: variations of a basic scheme. Biochim. Biophys. Acta Gen. Subjects. 1790, 1486–1500.
219
