Genetica (2014) 142:575–581 DOI 10.1007/s10709-014-9805-2

Heterochromatin and molecular characterization of DsmarMITE transposable element in the beetle Dichotomius schiffleri (Coleoptera: Scarabaeidae) Crislaine Xavier • Diogo Cavalcanti Cabral-de-Mello Rita Ca´ssia de Moura

•

Received: 28 May 2014 / Accepted: 26 November 2014 / Published online: 2 December 2014 Ó Springer International Publishing Switzerland 2014

Abstract Cytogenetic studies of the Neotropical beetle genus Dichotomius (Scarabaeinae, Coleoptera) have shown dynamism for centromeric constitutive heterochromatin sequences. In the present work we studied the chromosomes and isolated repetitive sequences of Dichotomius schiffleri aiming to contribute to the understanding of coleopteran genome/chromosomal organization. Dichotomius schiffleri presented a conserved karyotype and heterochromatin distribution in comparison to other species of the genus with 2n = 18, biarmed chromosomes, and pericentromeric C-positive blocks. Similarly to heterochromatin distributional patterns, the highly and moderately repetitive DNA fraction (C0t-1 DNA) was detected in pericentromeric areas, contrasting with the euchromatic mapping of an isolated TE (named DsmarMITE). After structural analyses, the DsmarMITE was classified as a non-autonomous element of the type miniature invertedrepeat transposable element (MITE) with terminal inverted repeats similar to Mariner elements of insects from different orders. The euchromatic distribution for

Electronic supplementary material The online version of this article (doi:10.1007/s10709-014-9805-2) contains supplementary material, which is available to authorized users. C. Xavier  R. C. de Moura (&) Laborato´rio de Biodiversidade e Gene´tica de Insetos, Instituto de Cieˆncias Biolo´gicas/ICB, Universidade de Pernambuco (UPE), Rua Arno´bio Marques 310, Santo Amaro, CEP 50100-130 Recife, PE, Brazil e-mail: [email protected] D. C. Cabral-de-Mello Departamento de Biologia, Instituto de Biocieˆncias/IB, Universidade Estadual Paulista (UNESP), Rio Claro, Sa˜o Paulo, Brazil

DsmarMITE indicates that it does not play a part in the dynamics of constitutive heterochromatin sequences. Keywords Beetle  Constitutive heterochromatin  Fluorescent in situ hybridization  Transposable element  Genome  Repetitive DNA

Introduction A large portion of eukaryotic genomes is composed of repeated DNA sequences that can be arranged in tandem, such as some multigene families and satellite DNAs, or scattered in the genome, like the transposable elements (TEs) (Charlesworth et al. 1994; Long and Dawid 1980). These repeated DNAs have been cytogenetically mapped through fluorescent in situ hybridization (FISH) in different insects and when combined with sequencing and in silico analysis can give detailed information on their genomic organization and evolution. Among Coleoptera (beetles), most of the molecular cytogenetic studies available focused on representatives of the suborders Adephaga and Polyphaga. Studies of these groups using multigene families as probes (i.e. rDNAs and histone genes), have shed light on their chromosomal evolution and genome organization, including autosomal complement, B chromosomes, and sex chromosomes (Cabral-de-Mello et al. 2010, 2011c; Martı´nez-Navarro et al. 2004; Oliveira et al. 2012b). Other repetitive sequences have been used to a lesser extent to address the chromosomal/genome structure of coleopterans, namely satellite DNAs, C0t-1 DNA fraction (DNA enriched with highly and moderately repeated sequences), telomeric repeats and TEs (Cabral-de-Mello et al. 2011b; Frydrychova´ and Marec 2002; Mravinac et al. 2011;

123

576

Mravinac and Plohl 2010; Oliveira et al. 2013; Pons et al. 2004). Transposable elements are ubiquitous in eukaryotic genomes and due to their ability to move and replicate they can affect the genome by generating plasticity (Wicker et al. 2007). These elements can affect the control of gene expression (Lu et al. 2012), and act as telomere sequences in Drosophila (Abad et al. 2004). In addition, they have been reported to promote chromosomal rearrangements (Gray 2000), being one of the most important drivers of genome shaping (Alzohairy et al. 2013; Bie´mont 2010; Bie´mont and Vieira 2006). TEs of the Tc1/Mariner superfamily, which belong to the class II terminal inverted repeats (TIR), are ubiquitous in eukaryotes and present a simple structure with an open read frame (ORF) for transposase (Robertson 1995). Their numerous families have a preference for TA insertion sites, generating target site duplications (TSD) (Wicker et al. 2007). Elements from the Mariner family are often 1.3 kb long with TIRs of approximately 28 bp, and transpose by a ‘‘cut and paste’’ mechanism (Hartl 2001). This family comprises five major widely distributed subfamilies (cecropia, irritans, mauritiana, mellifera and capitata) (Robertson and MacLeod 1993) and other minor subfamilies with more limited taxon distribution (Rouault et al. 2009). The transposase is the only protein required for transposition, acting in cis or trans to recognize the element by sequence-specific TIRs through DNA binding domains and does not interact between elements derived from different subfamilies (Lampe et al. 2001; Zhang et al. 2001). Thus, a genome can harbor more than one Mariner subfamily and the lack of host factor-dependence for transposition allows horizontal transfer between many different organisms (Dupeyron et al. 2014; Lampe et al. 2003; Oliveira et al. 2012a; Robertson and Lampe 1995; Yoshiyama et al. 2001). Non-autonomous miniature inverted-repeat transposable elements (MITEs) form a heterogeneous group of DNA TEs with an average size of B800 bp often located near genes (Feschotte et al. 2002; Han and Wessler 2010). Because they do not present intact or remnants of transposase sequences, newly discovered elements are classified by similarities of TIRs and TSDs shared with autonomous elements (Feschotte et al. 2002; Hikosaka and Kawahara 2010). The genus Dichotomius (Scarabaeidae: Polyphaga) presents 161 endemic species in the Americas (ScarabNet Global Taxon Database, 2012). In Brazil 16 out of the 84 species have been cytogenetically analyzed (Cabral-deMello et al. 2010, 2011a, c; ScarabNet Global Taxon Database). The karyotype of most species are composed by 2n = 18, meta-submetacentric chromosomes and Xy (Xyp—parachute association) sex chromosomal system. The heterochromatin located in the pericentromeric region

123

Genetica (2014) 142:575–581

of autosomes is a conserved feature (Cabral-de-Mello et al. 2010, 2011a, b). Nevertheless, the mapping of the C0t-1 DNA fraction isolated from D. geminatus (component of the pericentromeric heterochromatin in the species) revealed non conservation of pericentromeric heterochromatin repeats in D. bos, D. laevicollis, D. nisus, D. semisquamosus and D. sericeus karyotypes, suggesting dynamism for these chromosomal regions in the genus (Cabral-de-Mello et al. 2011b). Taking into consideration the variability of the heterochromatin observed in Dichotomius, we aimed to expand the current knowledge of the repetitive DNA organization in the group. Therefore, we present cytogenetic analyses of D. schiffleri through conventional staining methods, C-banding and mapping of repeated DNAs, including C0t-1 DNA and an isolated TE (named DsmarMITE). Furthermore, we performed a comparative analysis of the DsmarMITE at a molecular level among Mariner elements from different insect taxa.

Materials and methods Male individuals from D. schiffleri Vaz-de-Mello, Louzada and Gavino were collected at the Private Reserve of Natural Patrimony Nossa Senhora do Outeiro de Maracaı´pe (08°310 4800 S e 35°010 0500 W), located in the city of Ipojuca, Pernambuco, Brazil. Sampling was performed in accordance to Brazilian laws of environmental protection, with the permit from IBAMA/SISBIO (No. 16278-1). The testicular follicles of studied specimens were fixed in Carnoy modified solution (3:1 ethanol:acetic acid) and stored at -20 °C. The genomic DNA was extracted using the phenol–chloroform procedure described by Sambrook and Russel (2001). A total of 12 specimens were analyzed through classical and molecular cytogenetic techniques. The C0t-1 DNA fraction was isolated as described by Zwick et al. (1997) with reassociation time of 3 min (Cabral-de-Mello et al. 2010). The sequence of the DsmarMITE transposable element was identified using a primer designed based on a conserved region of the terminal inverted repetitions of TEs from the Mariner family, 50 GTTGGCTGATAAGTCCCCGGT (Robertson and Lampe 1995). The PCR reactions were performed as follows: an initial denaturation of 5 min at 94 °C, followed by 30 cycles of 30 s at 94 °C, 30 s at 44.9 °C and 80 s at 72 °C, with a final extension of 5 min at 72 °C. Two subsequent rounds of PCR were performed until a smaller band than would be expected for a potentially entire length Mariner element was obtained. The PCR products were observed through electrophoresis in 1 % agarose gel. The band was isolated, purified (ZimocleanTM Gel DNA Recovery KitSinapse) and cloned into a pGEM-T Easy vector (Promega)

1239

1241

1243

1242

ACCGGGGACTTtTCAtCCggCCTGTTA ACtGGcGAtTTtTCAtCCggCCTGTTA ACCGGGGACTTtTCAtCCggCCTGT-ACCGGGGcCTTATCAGCCA-------ACCGGGGACTTATCAGCCA-------ACCGGGGACTTATCAGCCA-------1243

1242

ACCGGGGACTTATCAGCCAACCTGTTA ACCGGGGACTTATCAGCCAACCTGTTA ACCGGGGAaTTATCcaCtcgCCTGTTA 1243

1243

--ttAGGTcGGaTGAaAAGTCCCCGGT TAttAGGTcGGaTGAaAAGTCCCCGGT

------GTTGGCTGATAAGTCCCCGGT

TAttAGGTTGGCTGATAAGTCCCCGGT TAttAGGTTGGCTGATAAGTCCCCGGT gtgCtataTttaaGATAAtTCCCCGaT

TAACAGGccGGaTGAaAAGTCCCCGGT TtACAGGacGGaTGAaAAGTCCCCGGT --ACAGGccGGaTGAaAAGTCCCCGGT --------TGGCTGATAAGTCCCCGGT --------TGGCTGATAAGTCCCCGGT --------TGGCTGATAAGTCCCCGGT

AB020617.1 AB056896.1

KJ026520.1

L06041.1 U11652.1 U11649.1

AB056894.1 AB056895.1 AB020618.1 AY601745.1 AY601746.1 AY601747.1

225

1246

ACCGGGGACTTATCAGCCAAC------

ACCGGGGACTTtTCAtCCggCCTGT-1266

1244

1245

ACCGGGGACTTATCAGCCAACCTGTTA ACCGGGGACTTATCAGaCAACCTGTTA ACCGGGGACTTATCAGCCAACCTGTTA ACCGGGGACTTgTCAGCCAACCTGTTA 1242

1234

1210

TAACAGGTTGGCTGATAAGTCCCCGGT TAACAGGTTGGCTGATAAGTCCCCGGT TAACAGGTTGGCTGATAAGTCCCCGGT TAACAGGTTGGCTGATAAGTCCCCGGT

TIR 3’ Internal sequence (bp) TIR 5’

U11659.1 U11658.1 U11646.1 U11644.1

Diptera Anopheles gambiae Anopheles gambiae Drosophila ananassae Haematobia irritans Lepidoptera Adoxophyes honmai Adoxophyes honmai Coleoptera Dichotomius schiffleri Neuroptera Chrysoperla plorabunda Chrysoperla plorabunda Mantispa pulchella Hymenoptera Ascogaster reticulatus Ascogaster reticulatus Ascogaster reticulatus Diachasmimorpha longicaudata Psyttalia fletcheri Psyttalia fletcheri

The karyotype of D. schiffleri showed 2n = 18, sex Xy chromosome system (Xyr rod-shape association), metasubmetracentricchromosomes, and the presence of a large metacentricpair (pair 1) (Fig. 1a). C-positive blocks wereobserved in the pericentromericregion of all autosomes, in the long arm of the y, and in almost the entire length of the X chromosome (Fig. 1b). Mapping of the C0t-1 DNA fraction showed a similar pattern to the C-banding for all chromosomes, with the exception of the y chromosome, in which no hybridization signals were observed (Fig. 1c–e),

GenBank accession number

Results

Species

following manufacturer’s protocol. Positive clones were selected and directly amplified from the colonies using M13 universal primers (F 50 GTAAAACGACGGCCAG/R 50 CAGGAAACAGCATATGAC) with the following thermal profile: an initial denaturation of 5 min at 94 °C, followed by 30 cycles of 30 s at 95 °C, 1 min at 55 °C and 2 min at 72 °C, with a final extension of 5 min at 72 °C. Sequences were determined from eight clones through an automated DNA sequencer (MEGABACE 1000, GE Healthcare TM) and deposited in the NCBI database under the following access numbers: KJ026520.1-KJ026527.1. The sequences of each DsmarMITE clones were assembled using the Pregap4 software, STADEN package (Bonfield et al. 1995) and analyzed using the VecScreen program (www.ncbi.nlm.nih.gov/VecScreen/VecScreen. html) for the removal of corresponding regions of the plasmid used for cloning. The consensus for the eight sequences was generated using the CAP3 program (Huang and Madan 1999) and used as query in the GenBank and RepBase databases. The sequence was aligned with other Mariner TEs available in the literature and deposited in GenBank (www.ncbi.nlm.nih.gov) (Table 1) through the Clustal W (Thompson et al. 1994) implemented in the MEGA 5.05 (Tamura et al. 2011). The presence of ORFs was tested using StarORF (http://star.mit.edu/orf/index. html). Slides for conventional chromosome analysis were stained with 2 % Lacto-acetic orcein. C-banding was performed as described by Sumner (1972) with a 50 s BaOH exposure time. Fluorescent in situ hybridization was performed as described in Pinkel et al. (1986) with modifications (Cabral-de-Mello et al. 2010). The probes (DNA C0t-1 and PCR product of DsmarMITE) were labeled by Nick translation using biotin-14-dATP (Invitrogen, San Diego, CA, USA) and detected with avidin-FITC (fluorescein isothiocyanate). Images were captured using an epifluorescence Leica DM 2500 microscope and the brightness and contrast of the images were optimized using Photoshop CS5.

577

Table 1 Terminal inverted repeats (TIRs) of Mariner elements. Lower case letters represent mismatches in relation to the first sequence, dashes (-) correspond to absent bases

Genetica (2014) 142:575–581

123

578

Genetica (2014) 142:575–581

Fig. 1 Conventional staining (a), C-banding (b) and FISH with probes for C0t-1 DNA fraction (c–e) and the TE DsmarMITE (f–h) in chromosomes of D. schiffleri. Karyotype form a spermatogonial metaphase (a) and metaphases I (b–h). DAPI (c, f), signals(d, g), and merge (e, h). The arrows indicate the sexual bivalent Xyr and the inserts in (a) and (b) show the sexual bivalent in metaphase I and X and y chromosomes C-banded, respectively. Note the DAPI bright blocks in (c) and (f). Bar = 10 lm

whereas the DsmarMITE was distributed on euchromatin (Fig. 1f–h). Sequences of the isolated TE appeared homogeneous, constituting a 267 bp consensus sequence and perfect terminal inverted repeats (TIR) of 21 bp (Supplementary material 1). This element did not present a coding sequence or significant similarity to other sequences when used as a query in GenBank or in RepBase databases. However, the alignment analysis of our consensus sequence to other described Mariner elements revealed TIR similarities to elements from the irritans subfamily isolated from a wide range of insect taxa (Fig. 1), namely Diptera (Anopheles gambiae, Drosophila ananassae, Haematobia irritans), Lepidoptera (Adoxophyes honmai), Neuroptera (Chrysoperla plorabunda and Mantispa pulchella), and Hymenoptera (Ascogaster reticulatus, Diachasmimorpha longicaudata and Psyttalia fletcheri) (Tables 1, 2, Supplementary material 2). None of the GenBank coleopteran Mariner sequences presented significant similarity to D.

123

schiffleri element, regardless of the TE subfamily. The lack of internal region similarity with other elements recovered from GenBank, the A?T richness (65.9 %), the size, and their distribution in euchromatic regions of all chromosomes allow us to classify the isolated TE as a nonautonomous transposable element of the MITE group from the Mariner family (Mariner-like), therefore called DsmarMITE.

Discussion Dichotomius schiffleri share the same diploid number and predominance of heterochromatin and C0t-1 DNA in pericentromeric regions with others species of the genus (Cabral-de-Mello et al. 2011b; Silva et al. 2009). Furthermore, although considered rare in Coleoptera and Dichotomius, the association of the sex bivalent Xy as a rod-shape (Xyr) was observed in D. schiffleri and is shared with its

Genetica (2014) 142:575–581

579

Table 2 Percentage of similarity between the TIRs of DsmarMITE and elements of irritans subfamily Species acession number

Similarities with DsmarMITE (%)

Anopheles gambiae U11659.1 U11658.1

100.0 97.62

Drosophila ananassae U11646.1

100.0

Haematobia irritans U11644.1 Adoxophyes honmai

97.62

AB020617.1

80.95

AB056896.1

66.67

Chrysoperla plorabunda L06041.1

100.0

U11652.1

100.0

Mantispa pulchella U11649.1

73.81

Ascogaster reticulatus AB056894.1

76.19

AB056895.1

69.05

AB020618.1

76.19

Diachasmimorpha longicaudata AY601745.1

97.37

Psyttalia fletcheri AY601746.1

100.0

AY601747.1

100.0

congeneric D. sericeus (Silva et al. 2009). The euchromatic distributional pattern of DsmarMITE on D. schiffleri chromosomes is consistent with that observed for other Mariner-like TEs identified in the grasshoppers Eyprepocnemis plorans (Montiel et al. 2012) and Abracris flavolineata (Palacios-Gimenez et al. 2014). Although usually dispersed in euchromatic regions, Mariner sequences can also be found concentrated in specific chromosomal regions in insects, i.e. centromeres and telomeres, as observed in the genomes of others beetles (Oliveira et al. 2013), the medfly Ceratitis capitata (Torti et al. 2000), the moth Mamestra brassicae (Mandrioli 2003) and the pufferfish Tetraodon uviatilis (Mandrioli 2000). Since TEs tend to accumulate in genomic regions with low gene density and low recombination rate, the enrichment of these sequences in euchromatin is less common (Kidwell 2005). The DsmarMITE element presents a high A?T content (65.9 %), similar to other MITEs previously isolated in beetle (Braquart et al. 1999), fly (Depra´ et al. 2012), frog (Hikosaka and Kawahara 2010) and rice (Lu et al. 2012). Despite the fact that the DsmarMITE is a non-autonomous element, the possibility that it can be mobilized cannot be

excluded, especially because of the homogeneity presented by the eight distinct copies, as well as their perfect TIRs. Besides revealing clues about the possible origins of MITEs, shared TIRs among potentially active elements are fundamental for the transposition of autonomous and nonautonomous elements (Auge´-Gouillou et al. 2001; Sundararajan et al. 1999; Yang et al. 2009). Studies reveal that despite not encoding a transposase, MITEs can be crossmobilized using enzymes coded by related elements. Moreover, characteristics present in the internal sequence such as subterminal domains can represent a functional advantage in relation to the autonomous element (Auge´Gouillou et al. 2001; Yang et al. 2009). The similarity of DsmarMITE with Mariner TEs of others insects, but not to those from coleopterans is not surprising since these elements possess a wide taxonomic distribution among insects, with reported cases of horizontal transfer (Robertson and Lampe 1995). Furthermore, most of the coleopteran transposon sequences reported so far correspond to partial transposase sequences (Oliveira et al. 2013), which prevents comparison to DsmarMITE. Additionally, beetle complete retrieved sequences belong to the mellifera transposon subfamily, but not to irritans, which DsmarMITE is related (Robertson and Lampe 1995). Our results provide information concerning the structure of Dichotomius chromosomes and organization/evolution of a MITE in the genus. Dichotomius is an interesting group for studies of repetitive sequences due heterochromatin variability previously reported (Cabral-de-Mello et al. 2011b). Acknowledgments We are grateful to Cristiane Maria Queiroz da Costa for the collection and identification of specimens, and to the anonymous reviews for the comments. This study was supported by Fundac¸a˜o de Amparo a` Cieˆncia e Tecnologia de Pernambuco-FACEPE (APQ-0464-2.02/10; IBPG-1079-2.02/10; AMD-0127.02/11), Fundac¸a˜o de Amparo a` Cieˆncia do Estado de Sa˜o Paulo—FAPESP (2011/19481-3) and the Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico-CNPq-Brazil (scholarship of PW of RCM). Conflict of interest of interest.

The authors declare that they have no conflict

References Abad JP, Pablos B, Osoegawa K et al (2004) TAHRE, a novel telomeric retrotransposon from drosophila melanogaster, reveals the origin of Drosophila telomeres. Mol Biol Evol 21:1620–1624 Alzohairy AM, Gyulai G, Jansen RK, Bahieldin A (2013) Transposable elements domesticated and neofunctionalized by eukaryotic genomes. Plasmid 69:1–15 Auge´-Gouillou C, Hamelin MH, Dematei MV et al (2001) The ITR binding domain of the Mariner Mos-1 transposase. Mol Genet Genomics 265:58–65 Bie´mont C (2010) A brief history of the status of transposable elements: from Junk DNA to major players in evolution. Genetics 186:1085–1093

123

580 Bie´mont C, Vieira C (2006) Junk DNA as an evolutionary force. Nature 443:521–524 Bonfield JK, Smith KF, Staden R (1995) A new DNA sequence assembly program. Nucleic Acids Res 24:4992–4999 Braquart C, Royer V, Bouhin H (1999) DEC : a new miniature inverted-repeat transposable element from the genome of the beetle Tenebrio molitor. Insect Mol Biol 8:571–574 Cabral-de-Mello DC, Moura RC, Martins C (2010) Chromosomal mapping of repetitive DNAs in the beetle Dichotomius geminatus provides the first evidence for an association of 5S rRNA and histone H3 genes in insects, and repetitive DNA similarity between the B chromosome and A complement. Heredity 104:393–400 Cabral-de-Mello DC, Moura RC, Martins C (2011a) Cytogenetic mapping of rRNAs and histone H3 genes in 14 species of Dichotomius (Coleoptera, Scarabaeidae, Scarabaeinae) beetles. Cytogenet Genome Res 134:127–135 Cabral-de-Mello DC, de Moura RDC, de Melo AS, Martins C (2011b) Evolutionary dynamics of heterochromatin in the genome of Dichotomius beetles based on chromosomal analysis. Genetica 139:315–325 Cabral-de-Mello DC, Oliveira SG, de Moura RC, Martins C (2011c) Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin. BMC Genet 12:88 Charlesworth B, Sniegowski P, Wolfgang S (1994) The evolutinary dynamics of repetitive DNA in eukaryotes. Nature 371:215–220 Depra´ M, Ludwig A, Valente VLS, Loreto ELS (2012) Mar, a MITE family of hAT transposons in Drosophila. Mobile DNA 3:13 Dupeyron M, Leclercq S, Cerveau N et al (2014) Horizontal transfer of transposons between and within crustaceans and insects. Mobile DNA 5:1–10 Feschotte C, Zhang X, Wessler S (2002) Miniature inverted-repeat transposable elements and their relationship to established DNA transposons. In: Craig NL et al (eds) Mobile DNA II. ASM Press, Washington, pp 1147–1158 Frydrychova´ R, Marec F (2002) Repeated losses of TTAGG telomere repeats in evolution of beetles (Coleoptera). Genetica 115:179– 187 Gray YHM (2000) It takes two transposons to tango. Mol Genet Evol 16:461–468 Han Y, Wessler SR (2010) MITE-Hunter: a program for discovering miniature inverted-repeat transposable elements from genomic sequences. Nucleic Acids Res 38:e199 Hartl DL (2001) Discovery of the Transposable Element Mariner. Genetics 157:471–476 Hikosaka A, Kawahara A (2010) A systematic search and classification of T2 family miniature inverted-repeat transposable elements (MITEs) in Xenopus tropicalis suggests the existence of recently active MITE subfamilies. Mol Genet Genomics MGG 283:49–62 Huang X, Madan A (1999) CAP3: a DNA sequence assembly program. Genome Res 9:868–877 Kidwell M (2005) Transposable elements. In: Gregory TR (ed) The evolution of the genome. Elsevier, San Diego, pp 165–221 Lampe DJ, Walden KKO, Robertson HM (2001) Loss of transposaseDNA interaction may underlie the divergence of Mariner family transposable elements and the ability of more than one Mariner to occupy the same genome. Mol Biol Evol 18:954–961 Lampe DJ, Witherspoon DJ, Soto-Adames FN, Robertson HM (2003) Recent horizontal transfer of mellifera subfamily Mariner transposons into insect lineages representing four different orders shows that selection acts only during horizontal transfer. Mol Biol Evol 20:554–562

123

Genetica (2014) 142:575–581 Long EO, Dawid IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49:727–764 Lu C, Chen J, Zhang Y et al (2012) Miniature inverted—repeat transposable elements (MITEs) have been accumulated through amplification bursts and play important roles in gene expression and species diversity in Oryza sativa. Mol Biol Evol 29:1005–1017 Mandrioli M (2000) Mariner-like transposable elements are interspersed within the rDNA-associated heterochromatin of the pufferfish Tetraodon uviatilis (Osteichthyes). Chromosome Res 8:177–179 Mandrioli M (2003) Identification and chromosomal localization of mariner-like elements in the cabbage moth Mamestra brassicae (Lepidoptera). Chromome Res 11:319–322 Martı´nez-Navarro EM, Serrano J, Galia´n J (2004) Chromosome evolution in ground beetles: localization of the rDNA loci in the tribe Harpalini (Coleoptera, Carabidae). J Zool Syst Evol Res 42:38–43 Montiel EE, Cabrero J, Camacho JPM, Lo´pez-Leo´n DM (2012) Gypsy, RTE and Mariner transposable elements populate Eyprepocnemis plorans genome. Genetica 140:365–374 Mravinac B, Plohl M (2010) Parallelism in evolution of highly repetitive DNAs in sibling species. Mol Biol Evol 27:1857–1867 Mravinac B, Mesˇtrovic´ N, Cavrak VV, Plohl M (2011) TCAGG, an alternative telomeric sequence in insects. Chromosoma 120:367–376 Oliveira SG, Bao W, Martins C, Jurka J (2012a) Horizontal transfers of Mariner transposons between mammals and insects. Mobile DNA 3:1–6 Oliveira SG, de Moura RC, Martins C (2012b) B chromosome in the beetle Coprophanaeus cyanescens (Scarabaeidae): emphasis in the organization of repetitive DNA sequences. BMC Genet 13:96 Oliveira SG, Cabral-de-mello DC, Moura RC, Martins C (2013) Chromosomal organization and evolutionary history of Mariner transposable elements in Scarabaeinae coleopterans. Mol Cytogenet 6:54 Palacios-Gimenez OM, Bueno D, Cabral-de-Mello DC (2014) Chromosomal mapping of two Mariner-like elements in the grasshopper Abracris flavolineata (Orthoptera: Acrididae) reveals enrichment in euchromatin. Eur J Entomol 111(3): 329–334 Pinkel D, Straume T, Gray JW (1986) Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. P Natl Acad Sci Biol 83:2934–2938 Pons J, Bruvo B, Petitpierre E et al (2004) Complex structural features of satellite DNA sequences in the genus Pimelia (Coleoptera: Tenebrionidae): random differential amplification from a common ‘‘satellite DNA library’’. Heredity 92:418–427 Robertson HM (1995) The Tc1-Mariner Superfamily Transposons in Animals. J Insect Physiol 41:99–105 Robertson H, Lampe DJ (1995) Recent horizontal transfer of a Mariner transposable element among and between Diptera and Neuroptera. Mol Biol Evol 12:850–862 Robertson HM, MacLeod EG (1993) Five major subfamilies of Mariner transposable elements in insects, including the Mediterranean fruit fly, and related arthropods. Insect Mol Biol 2:125–139 Rouault J-D, Casse N, Che´nais B et al (2009) Automatic classification within families of transposable elements : application to the Mariner family. Gene 448:227–232 Sambrook J, Russel DW (2001) Molecular cloning. A laboratory manual, 3rd edn. Cold Spring Harbor, New York ScarabNet Global Taxon Database SCARABNET 2012. www. scarabnet.org. Accessed 29 Dec 2012

Genetica (2014) 142:575–581 Silva GM, Bione EG, Cabral-de-Mello DC et al (2009) Comparative cytogenetics of three species of Dichotomius (Coleoptera, Scarabaeidae). Gen Mol Biol 32:276–280 Sumner AT (1972) A simple technique for demonstrating centromeric heterochromatin. Exp Cell Res 75:304–306 Sundararajan P, Atkinson PW, Brochta DAO (1999) Transposable element interactions in insects: crossmobilization of hobo and Hermes. Insect Mol Biol 8:359–368 Tamura K, Peterson D, Peterson N et al (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Torti C, Gomulski LM, Moralli D et al (2000) Evolution of different subfamilies of Mariner elements within the medfly genome

581 inferred from abundance and chromosomal distribution. Chromosoma 108:523–532 Wicker T, Sabot F, Hua-Van A et al (2007) A unified classification system for eukaryotic transposable elements. Nat Rev Genet 8:973–982 Yang G, Nagel DH, Feschotte C et al (2009) Tuned for transposition: molecular determinants underlying the hiperactivity of a Stowaway MITE. Science 325:1391–1394 Yoshiyama M, Tu Z, Kainoh Y et al (2001) Possible horizontal transfer of a transposable element from host to parasitoid. Mol Biol Evol 18:1952–1958 Zhang L, Dawson A, Finnegan DJ (2001) DNA-binding activity and subunit interaction of the Mariner transposase. Nucleic Acids Res 29:3566–3575 Zwick MS, Hanson RE, Mcknight TD et al (1997) A rapid procedure for the isolation of C0t-1 DNA from plants. Genome 40:138–142

123