Molecular Immunology 71 (2016) 123–130
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Hereditary angioedema in a Jordanian family with a novel missense mutation in the C1-inhibitor N-terminal domain Saied A Jaradat a,∗ , Sonia Caccia b,∗∗ , Rifaat Rawashdeh a , Motasem Melhem a , Ali Al-Hawamdeh c , Thomas Carzaniga b , Hazem Haddad a a
Princess Haya Biotechnology Center, Jordan University of Science and Technology, Irbid 22110, Jordan “L. Sacco” Department of Biomedical and Clinical Sciences, University of Milan, Milan 20133, Italy c Pediatric Department, King Hussein Medical Center, Amman 11855, Jordan b
a r t i c l e
i n f o
Article history: Received 18 July 2015 Received in revised form 1 February 2016 Accepted 5 February 2016 Keywords: C1-inhibitor SERPING1 gene Hereditary angioedema Jordan N-terminal domain
a b s t r a c t Hereditary angioedema due to C1-inhibitor deficiency (C1-INH-HAE) is an autosomal dominant disease caused by mutations in the SERPING1 gene. A Jordanian family, including 14 individuals with C1-INHHAE clinical symptoms, was studied. In the propositus and his parents, SERPING1 had four mutations leading to amino acid substitutions. Two are known polymorphic variants (c.167T>C; p.Val34Ala and c.1438G>A; p.Val458Met), the others are newly described. One (c.203C>T; p.Thr46Ile) is located in the N-terminal domain of the C1-inhibitor protein and segregates with angioedema symptoms in the family. The other (c.800C>T; p.Ala245Val) belongs to the serpin domain, and derives from the unaffected father. DNA from additional 24 family members were screened for c.203C>T mutation in the target gene. All individuals heterozygous for the c.203C>T mutation had antigenic and functional plasma levels of C1inhibitor below 50% of normal, confirming the diagnosis of type I C1-INH-HAE. Angioedema symptoms were present in 14 of 16 subjects carrier for the c.203T allele. Among these subjects, those carrying the c.800T variation had more severe and frequent symptoms than subjects without this mutation. This family-based study provides the first evidence that multiple amino acid substitutions in SERPING1 could influence C1-INH-HAE phenotype. © 2016 Elsevier Ltd. All rights reserved.
1. Introduction Hereditary angioedema with C1-inhibitor deficiency (C1-INHHAE) (OMIM 106100) is an autosomal dominant disease with a minimum prevalence of 1/65,000 (Zanichelli et al., 2015). It is caused by mutations in one of the two alleles of SERPING1, the gene that encodes C1-inhibitor (C1-INH), a 500 amino acid serine protease inhibitor (SerPIn) (Bock et al., 1986). C1-INH-HAE clinical manifestations include recurrent episodes of swelling, mainly in the face, limbs, gastrointestinal and upper airway mucosa. When edema affects larynx, the disease is life threatening (Caccia et al., 2014).
∗ Corresponding author at: Princess Haya Biotechnology Center, Jordan University of Science and Technology, P. O. Box 3030, Irbid 22110, Jordan. ∗∗ Corresponding author. E-mail addresses: [email protected], [email protected] (S.A. Jaradat), [email protected] (S. Caccia), [email protected] (R. Rawashdeh), [email protected] (M. Melhem), [email protected] (A. Al-Hawamdeh), [email protected] (T. Carzaniga), hazem [email protected] (H. Haddad). http://dx.doi.org/10.1016/j.molimm.2016.02.001 0161-5890/© 2016 Elsevier Ltd. All rights reserved.
Two phenotypic variants of C1-INH-HAE have been described: type I, which represents 85% of all C1-INH-HAE cases, presenting with low functional and antigenic levels, and type II, presenting with low functional levels but normal antigen. In both cases, the levels of the C4 complement component are decreased (Cicardi et al., 2014). The SERPING1 gene is located on chromosome 11 and consists of 8 exons (Bock et al., 1986). According to the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk/ac/index.php/, assessed Jan. 01, 2016), 489 SERPING1 different mutations have been characterized, the majority derived from European/North American studies. A few reports originated from Asia and Latin America, and only one report originated from the Middle East (Faiyaz-Ul-Haque et al., 2010; Ferraro et al., 2011). C1-INH is an atypical serpin, having a two-domain structure. Beside the characterizing serpin domain, C1-INH has a peculiar Nterminal domain, whose function and structure remain elusive. The most of the missense mutations that have been identified so far (161 according to the Human Gene Mutation Database) are located in the serpin domain. The crystal structure of this domain serves to address the interpretation of the corresponding amino acid sub-
124
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
stitutions (Beinrohr et al., 2007). On the other hand, only 1 amino acid substitution involving a residue located inside the N-terminal domain (Leu32Gln) is reported (Pappalardo et al., 2008), concerning a single patient (author personal communication). Here, we report the genetic study of a large Jordanian family with C1-INH-HAE. Besides the disease causing mutation located in the N-terminal portion of the protein, additional SERPING1 mutations leading to amino acid substitutions in C1-INH are present in this family with possible effect on the clinical phenotype. 2. Materials and methods 2.1. Subjects This family came to our attention when the propositus (III-4; Fig. 1), was visited our metabolic disorders clinic at Princess Haya Biotechnology Center due to frequent facial swelling and occasional pain in the abdominal area. We interviewed his parents, aunts and uncles and were able to construct an extended pedigree consisting of 38 family members based on their clinical history. All the patients and parents were interviewed at their home and answered the clinical severity scores questionnaire. The available medical records were also reviewed. According to Cicardi et al. 2014 and Cicardi and Zingale, 2004; disease was defined as mild, moderate or severe, taking into account of angioedema attacks per year impairing daily activities and the need for prophylaxis treatment. We also calculated the disease severity score as recommended by Bygum et al. 2011; where the scoring system taking into account the age at onset of disease, the clinical manifestation site and need for long-term prophylaxis. The study was approved by the joint institutional review board committee of the Jordan University of Science and Technology and King Abdullah University Hospital. Consent was obtained from all subjects or their parents. 2.2. Complement testing Serum and plasma were isolated from 18 family members with or without a clinical history of HAE. The serum antigenic level of C1-INH was determined using a radial immunodiffusion kit (The Binding Site, Birmingham, UK). In three samples, the C1-INH concentration fell below the detection limit of the methods (38 mg/L). Both the serum C3 and C4 levels were measured with an immunoturbidimetric assay on a HITACHI 912 analyzer (Hitachi Corp, Tokyo, Japan) using the Tina-quant C3 and C4 assay kits (Roche Diagnostics Indianapolis, IN, USA). C1-INH activity was measured using a colorimetric assay (Technochrome C1-INH, Technoclone GmbH, Vienna, Austria). Reference ranges were 7–130% of normal (100% corresponds to 1 IU C1-INH/ml calibrated against the WHO plasma standard 08/262). Normal values for C1-INH antigenic levels are in the 19.5–34.5 mg/dL range; for C3 and C4 90–180 mg/dL and 10–40 mg/dL, respectively; for C1-INH functional activity normal levels are greater than 70% of the WHO plasma standard. 2.3. Genetic testing Genomic DNA from 25 family members was extracted from whole blood using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA). All 8 exons of the SERPING1 gene were initially screened by direct sequencing in the propositus, his parents {II-(1, 1a)}, brothers and sisters {III-(1–3) and III-(5–7)} (Fig. 1). Forward and reverse PCR primers used to amplify SERPING1 exons 1–8 and the flanking sequences were designed using the Primer3 algorithm (http://frodo.wi.mit.edu/cgi-bin/primer3/ primer3 www.cgi) and the NC 000011.9 sequence as a template.
The primer sequences and PCR reaction conditions are available upon request. The resulting sequences were aligned against a reference sequence using the ChromasPro 1.34 software package (Technelysium Pty Ltd, Australia). An Amplification Refractory Mutation System PCR (ARMS-PCR) was used to detect the C>T variation at nucleotide c.203 (Newton et al., 1989) in 80 healthy control individuals. The primer sequences and ARMS-PCR reaction conditions are available upon request. A total of 130 unrelated healthy controls were recruited and screened for SERPING1 c.203C>T mutation: 50 of these individuals were tested by direct DNA sequencing, and 80 were tested by ARMS-PCR. The c.800C>T and c.167T>C variant alleles was tested in the DNA of 50 healthy Jordanian controls by direct DNA sequencing. Total RNA was extracted from 300 l of whole blood using E.Z.N.A. Total RNA Kit (Omega Biotech, Norcross, Ga). RNA from individuals carrying variants c.203C>T (exon 3) and/or c.800C>T (exon 5) was reverse transcribed (RT) with the ProtoScriptTM First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA) with random hexamer primers. Two rounds of cDNA PCR amplification were carried out with primers located in exon 3 and exon 4 (forward 5 - GTTTGCAAGACAGAGGCGAA −3 , reverse 5 - TGGGCTGTGGAAGATCTGAG −3 ) and in exon 4 and exon 7 (forward 5 - CTCAGATCTTCCACAGCCCA −3 , reverse 5 TCACTTTGATGCGGGGTAGT −3 ). RT-PCR products were run on 1% agarose gels and stained with ethidium bromide. The nucleotide nomenclature is given in accordance with the Human Genome Variation Society Nomenclature standards using cDNA sequence NM 000062.2. For amino acid numbering, we followed the traditional nomenclature that considers the first amino acid of the mature protein (without the 22 N-terminal signal peptide residues) as amino acid number 1 through the text except in Fig. 3 legend. 2.4. SDS-PAGE and western blotting For the immunoblotting of C1-INH in whole plasma, pooled normal human plasma (NHP) or patients plasma collected in sodium citrate was diluted 1:15 in PBS; 15 l aliquots were mixed with 5 l of 4X non-reducing Laemmli sample buffer, boiled for five minutes, and applied to the gel. Samples were analyzed by 7.5% sodium dodecyl sulfate (SDS)-PAGE under non-reducing conditions, which leaves disulphide bonds intact. Gels were blotted onto PVDF membranes using the Trans-Blot Turbo Blotting System (Bio-Rad Laboratories, Hercules, CA, USA) with Trans-Blot Transfer Pack consumables (Bio-Rad Laboratories, Hercules, CA, USA). After blocking, membranes were incubated with sheep polyclonal anti-C1 inhibitor (The Binding Site Ltd, Birmingham, UK) and the immune-complexes were reacted with an alkaline phosphatase conjugated donkey-anti-sheep-Ig and visualized with a colorimetric substrate system (Sigma–Aldrich Co., St. Louis, MO, USA). 2.5. In silico analysis of the C1-INH missense variants Pathogenicity prediction of the missense variants was performed using the PolyPhen2 (http://genetics.bwh.harvard.edu/ pph/), SIFT (http://sift.bii.a-star.edu.sg/), MutationTaster (http:// www.mutationtaster.org/) and MuPro (http://www.ics.uci.edu/ ∼baldig/mutation.html) software. The PolyPhen program utilizes both sequence alignments and the three-dimensional structure databases (Ramensky et al., 2002). A score of more than 1.5 suggests a probably damaging mutation. SIFT (Sorting Intolerant From Tolerant) uses both sequence homology and the physical properties of the substituted amino acids (Ng and Henikoff, 2003). A score less than 0.05 suggest intolerant substitutions. MUpro software uses support vector machines to predict the effects of amino acid substitution on the stability of the protein.
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
125
Fig. 1. Phasing haplotypes for the four missense variants identified in a consanguineous portion of the family. Haplotypes were constructed using the four missense variants c.167T>C (p.Val34Ala), c.203C>T (p.Thr46Ile), c.800C>T (p.Ala245Val) and c.1438G>A (p.Val458Met). The c.203T mutant allele co-segregated with the phenotype in all members of the extended family tested for the mutation with exception of the asymptomatic III-5 and III-10. The disease-causing allele c.203T is transmitted in trans with either the c.800C (III-5) or the c.800T (III-6) alleles in the seven siblings.
A score less than 0 suggest a decrease in the stability of protein structure (Cheng et al., 2006). MutationTaster calculates the probability of DNA sequence variations to be either a disease causing mutation or a polymorphism (Schwarz et al., 2010). Probability close to 1 suggests strong prediction. 3. Results 3.1. Clinical and laboratory assessment We examined a Jordanian family consisting of 38 members, 14 of which presenting a clinical history of HAE, with a cumulative score of clinical severity ranging from 3 to 10 (Table 1), according to Bygum et al. 2011; considering age at onset of the disease, clinical manifestation sites and the need for long-term prophylaxis and from 1 to 250 (Table 2), according to Cicardi and Zingale, 2004; taking into account attacks frequency, severity degree and the treatment received. The score of the three patients of the consanguineous branch of the family that encountered their first episode at the age of 2 years were the highest among the family members using both scoring systems. Propositus III-4, who has a severity score of 9 and 250 (Tables 1 and 2), encountered 25 episodic angioedema and was hospitalized 15 times over a period of the last year at age 20 years. Most of his swelling attacks were in the face and to a less extent in the abdomen. In some patients abdominal attacks were always associated with vomiting (III-6 and II-7), in others with severe diarrhea (III-9) or constipation (II-4). Localization of the cutaneous angioedema was variable. Long-term prophylactic treatment with danazol was prescribed to patients that encountered severe and frequents attacks, however, parents refused the drug because of their fear the drug side effects. Detailed laboratory analyses of the complement system have been performed (Table 1). Angioedema clinical symptoms clearly segregate with low C1-INH antigenic and functional levels and low C4. Two C1-INH deficient subjects, aged 5 and 19 years were asymptomatic. Two women (II-2 and III-1), without c.203C > T mutation, had low C1-INH values, but no HAE clinical symptoms. The apparent discrepancy was ascribed to the fact that they were pregnant at blood drawing (Prof. Cicardi personal communication).
3.2. Genetic analysis The propositus and his parents {II-(1, 1a)} presented four heterozygous missense variants (Fig. 1). Variants c.167T>C; p.Val34Ala and c.1438G>A; p.Val458Met were already present in the NCBI Variation Database (http://www.ncbi.nlm.nih.gov/snp) with the following IDs: rs#11546660 and rs#4926, respectively. Val458 is a well-known polymorphism in the SERPING1 coding sequence (Cumming et al., 2003; Kalmár et al., 2003). The variants c.167T>C; p.Val34Ala was originally described in Chinese patients and control with “C” allele frequency 5.94% (Xu et al., 2012). Although, the c.167C allele was not found in 50 unaffected Jordanian individuals, however, the allele is not segregated with the clinical manifestations, implying that it is a polymorphism rather than a causative mutation. The other two variants c.203C>T; p.Thr46Ile (ss#1947221103) (Fig. 2A and B) and c.800C>T; p.Ala245Val (ss#1947221104) (Fig. 2C and D) were novel. All 8 exons of the SERPING1 gene were also screened in the propositus brothers and sisters (Fig. 1). Phasing haplotypes for the 4 variants identified showed that the c.203T allele segregated with low C1-INH plasma levels in all cases and with the angioedema clinical presentation in the mother and in 4 out of the 5 affected childrens (Fig. 1; Table 1). Therefore, all other members of the family for which DNA was available (16 individuals) were screened for the presence of the c.203T allele by direct DNA sequencing. Again, the c.203T allele segregated with the biochemical phenotype in the 14 family members with HAE clinical symptoms and 2 asymptomatics, but was absent in the other members tested. The c.203T mutant allele was not found in the DNA of 130 healthy Jordanian controls. The c.203C>T mutation located in exon 3 converts the Thr46 ACC codon into ATC Ile. The Thr46 residue is conserved in the C1-INH N-terminus of 10 species (Fig. 3). In silico analysis indicated that Thr46Ile is intolerant according to 2 out of 4 different programs (Table 3). Among the 9 family members for which we obtained the haplotype, we observed that the c.203T and c.800T alleles occurred as compound heterozygotes in 3 affected siblings {(III-(2–4–6)} (Fig. 1), having the highest severity scores. Individuals known to have just the c.800C>T variant (II-1a and III-7) do not have any
126
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
Table 1 Clinical and laboratory findings for 23 family members. Id
Age (years)
Age at onset
Painful abdominal edema
Skin edema
Laryngeal edema
Other manifestations
Long term prophylaxis
Severity score
C4 levels mg/dLa
C3 levels mg/dLa
C1-INH Ag mg/dLa
C1-INH function (%)a
II-1 II-1a II-2 III-1 III-2 III-3 III-4 III-5 III-6 III-7 III-8 II-4 II-4a III-9 III-10 II-5 III-11 III-12 II-7 III-15 III-17 III-18 III-21
32§ 55 28 24 23 11 21 19 11 22 7 39 33 10 5 36 6 10 44 10 23 17 17§
16 NA‡ NA NA 2 9 2 NA 2 NA NA 10 NA 10 NA 15 NA 9 17 8 9 17 9 months
Yes Unaffected Unaffected Unaffected Yes Yes Yes Asymptomatic Yes Unaffected Unaffected Yes Unaffected Yes Asymptomatic Yes Unaffected No Yes Yes Yes Yes Yes
Yes Unaffected Unaffected Unaffected Yes Yes Yes Asymptomatic Yes Unaffected Unaffected Yes Unaffected Yes Asymptomatic Yes Unaffected Yes Yes Yes Yes Yes Yes
Yes Unaffected Unaffected Unaffected Yes No Yes Asymptomatic Yes Unaffected Unaffected Yes Unaffected No Asymptomatic No Unaffected No Yes No No No Yes
Yes NA NA NA No No No No Yes NA NA Yes NA No No Yes NA No Yes No Yes No No
Yes∼ NA NA NA Yes+ ◦ No Yes+ ◦ No Yes+ ◦ NA NA No NA No No Yes∼ NA No Yes∼ No Yes∼ No No
8 NA NA NA 9 5 9 0 10 NA NA 8 NA 5 0 6 NA 3 8 5 7 4 7
ND† 19 27 ND 1.2 4.21 1 4.07 0.12 15.85 20 3.89 34 2.8 5.3 3.7 22.2 0.74 4.1 ND 1.86 ND ND
ND 88 128 ND 83 83.58 71 105.14 102 76.45 114 88 158 147 99 99 129 108 125 ND 113.69 ND ND
ND 18.7 16.5◦ 16.3 3.8 4.1 < 3.8 6.2 < 3.8 16.4 23 4.1 23 7.6 4.3 3.8 24.7 2.4 3.8 ND < 3.8 ND ND
ND 71 67 61 ND 11 ND 16 10 ND 82 17 ND T in exon 5: (C) homozygous wild type, (D) heterozygous. The solid arrows indicate the locations of the missense variants.
Fig. 3. Multiple alignment of C1-INH protein sequences from various species. The Thr46 amino acid residue in the N-terminal domain affected by the mutation is shown in red. Cys residues at position 101 and 108 are used to anchor the alignments. Thr68 amino acid residue on the figure is the same Thr46 of the C1-INH traditional amino acid nomenclature. The alignments were generated by the CLUSTAL Omega program.
symptoms of HAE, and had circulating C1-INH values at the lower limit of the normal range (Table 1). The c.800T variant allele was not found in the DNA of 50 control samples. The variation results in the substitution of the Ala245 residue with Val. Ala residue at position 245 is conserved in all 10 C1-INH proteins aligned in this report (data not shown). In silico analysis indicated that Ala245Val is intolerant according to 3 out of 4 different programs (Table 3). Although 4 siblings were affected in generation II, the parents (I1 and I-2) were free of symptoms until they passed away at 63 and 73 years of age. Due to the incomplete penetrance of the c.203C>T mutation (see family members III-5 and III-10), we cannot exclude the possibility that one of the parents was an asymptomatic carrier for the c.203T allele. Moreover, they were likely wild-type for the c.800C allele, as their daughter (II-1). However, we cannot rule out a de novo mutation or gonadal mosaicism as a possible mechanism for C1-INH-HAE in this family (Pappalardo et al., 2000; Guarino et al., 2006).
3.3. Gene and protein expression To exclude the potential of any splicing error that might be introduced by the c.203C>T and c.800C>T variants, we performed RT-PCR analyses on total RNA from blood samples of several family members. All individuals tested showed only the fragment with
the size corresponding to the normally spliced mRNA (578 bp and 546 bp respectively) (Fig. 4). Western Blot analysis was thus performed to examine C1-INH in plasma (Fig. 5). Separation by SDS-page under non-reducing conditions, revealed the presence of an extra band in patients carrying the c.203C>T; p.Thr46Ile mutation, migrating faster (95 kDa) than the native form (with an apparent molecular weight of 105 kDa). The same band is faintly visible also in individual II-1a carrying the c.800C>T; p.Ala254Val variant.
4. Discussion We identified 4 genetic variations of the SERPING1 gene in a patient with type I C1-INH-HAE belonging to a Jordanian family. In this family, the mutation that segregates with the disease is a novel heterozygous nucleotide substitution, c.203C>T, causing a change from Thr to Ile at position 46 inside the N-terminal domain of the C1-INH protein. Indeed, mature C1-INH is a heavily glycosylated glycoprotein with a two-domain structure, consisting of a typical C-terminal serpin domain and a unique, exceptionally long (∼100 amino acids) N-terminal extension (Perkins et al., 1990). The two domains are linked by two disulfide bridges (Fig. 6). A reduction of these bonds causes a conformational change such that the molecule loses its inhibitory activity and is more readily poly-
128
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
Fig. 4. RT-PCR analyses of RNA extracted from 5 family members. Lanes numbered 1 and 2 are the PCR products for two rounds of c-DNA amplification using PCR primers flanking the c.800C>T and the c.203C>T variants, respectively. All individuals tested showed only the wild-type spliced fragments; 546 bp for the c.800C>T and 578 bp for the c.203C>T variants. N (negative control); II-1a (heterozygous for c.800C>T, wild-type for c.203C>T); III-1 (wild-type for c.800C>T, wild-type for c.203C>T); III-3 (wild-type for c.800C>T, heterozygous for c.203C>T); III-5 (wildtype for c.800C>T, heterozygous for c.203C>T); III-6 (heterozygous for c.800C>T, heterozygous for c.203C>T). Lanes labeled “M” is the 100-bp ladder DNA marker.
merized, indicating that the N-terminal domain is required for the correct folding and processing of the entire molecule (Bos et al., 2003; Simonovic and Patston, 2000; Kalmár et al., 2003). However, just one survey is present reporting a missense mutation in the Nterminal domain in an isolated individual affected by HAE type I (Pappalardo et al., 2008). The domain shows no significant homology with any known protein, and its structure remains elusive. The presence of short tandem repeats and the high number of glycosylation sites is reminiscent of mucins (Vinall et al., 1998). Its deep glycosylation, makes C1-INH the most heavily glycosylated plasma
Fig. 6. Structural localization of the newly identified missense variant in the C1INH serpin domain. The reactive center loop is depicted in black, as well as helix-F, hosting residue 245 (black sphere), substituted in compound heterozygosis with Ile46 in 3 affected siblings. The two Cys residues bonding the N-terminal domain are indicated with white spheres. Coordinates are from the homology model of the native C1-INH serpin domain (PDB entry 1M6Q).
protein, with multiple O-linked and 6 N-linked glycans (Bock et al., 1986; Strecker et al., 1985), although the role of carbohydrates in the function and conformational stability of C1-INH has still to be clarified (Davis et al., 2007; Caccia et al., 2011; Minta, 1981; Reboul et al., 1987). A study reporting a substitution in the serpin domain that abolished an N-oligosaccharide and dramatically decreased the expression of the recombinant protein suggests that specific carbohydrates may be crucial for the proper folding of the protein and its secretion from the cell of synthesis (Rossi et al., 2010). Residue Thr46 is adjacent to an Asn amino acid that is known to be N-glycosylated. When Thr46 is mutated to Ile, the calculated potential score for N-glycosylation prediction (http://www.cbs.dtu. dk/services/NetNGlyc/) is decreased (only 4 out of 9 neural networks support the prediction), suggesting that the mutation can impair Asn47 glycosylation. Indeed, mutation Thr46Ile could have
Fig. 5. SDS-PAGE and Western blotting analyses of plasma samples isolated from 5 individuals of family 2 using sheep polyclonal anti-C1-INH. “M” is the Molecular weight marker; NHP (Normal human plasma); III-6 (heterozygous for c.800C>T, heterozygous for c.203C>T); II-1a (heterozygous for c.800C>T, wild-type for c.203C>T); III-12 (wildtype for c.800C>T, heterozygous for c.203C>T); II-2 (wild-type for c.800C>T, wild-type for c.203C>T); III-1 (wild-type for c.800C>T, wild-type for c.203C>T). In lanes labeled III-6 and III-12, the C1-INH migrated as doublet compared to the pooled plasma. The upper band of the doublet appears the same size as normal C1-INH (105 kDa) and the lower is 95 kDa.
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
deleterious consequences for protein expression by impairing glycosylation and ultimately protein folding and secretion. This would decrease the circulating level of C1-INH, as seen in these patients. To distinguish among the different conformations of circulating C1-INH, Western Blot analysis of plasma samples were performed. Upon non-reducing SDS-PAGE, in patients carrying the Thr46Ile substitution an additional band of lower molecular weight (95 kDa) than the native form was more evident. Since the entity of this band increased incubating the plasma samples at 37 ◦ C, and being its migration consistent with cleaved C1-INH, we conclude that it was due to the intrinsic instability of plasma of patients with HAE, such that on prolonged incubation at 37 ◦ C, kallikrein activity evolves with concomitant C1-INH cleavage (Joseph et al., 2013). Together with the c.203T allele, the c.800T allele occurred as a compound heterozygous in 3 out of 5HAE siblings {III-(2, 4, 6)}, whereas the other 2 (III-3 and III-5) were wild-type for the second allele. Notably, the formers had very high severity scores, while III5 was asymptomatic, and III-3 suffered from milder edema attacks and had the lowest severity score among her siblings. II-1a and his son III-7, are carrier for the c.800T allele and are clinically normal; their circulating C1-INH levels are slightly below the normal range but still considerably higher than the levels of the affected family members. Variant c.800C>T causes an amino acid substitution from Ala to Val at position 245 (Fig. 6). Ala245 belongs to ␣-helix F, which has been demonstrated to be important for serpin activity and polymerization (Cabrita et al., 2004; Gettins, 2002). Taken together, these observations may suggest a recessive modifier role for the c.800T allele in this family. The identification of clinically normal individuals and carriers for the heterozygous mutations in a family with a strong history for C1-INH-HAE is vital, considering that the fatality rate of laryngeal attacks in asymptomatics is higher than in well diagnosed patients (Bork et al., 2012). To the best of our knowledge, there are no international guidelines thus far on the management of asymptomatic HAE patients with short-term prophylactic treatment preceding a triggering event such as dental procedure. However, recombinant C1-INH administered in 12 asymptomatic patients has been demonstrated to be safe and tolerated (van Doorn et al., 2005). In conclusion, we present a new SERPING1 mutation responsible for C1-INH-HAE, which is associated to other variants leading to amino acid substitutions, but not to the disease in an extended family. This study will help to evaluate the effective penetrance of disease-causing mutations in C1-INH-HAE and to reveal the incidence of alleles with a modifier role. The c.800T allele in a consanguineous branch of the family appears to modify C1-INH-HAE symptoms, frequency and severity. This kind of analysis has rarely been feasible in HAE. Indeed, HAE is frequently characterized by private mutations and limited relatives. Furthermore, this study is the first to provide family-based evidence linking a missense mutation inside the N-terminal domain of C1-INH to HAE. Only one previous study associated an aminoacid substitution in the N-terminal domain with C1-INH-HAE type I in an isolated case (Pappalardo et al., 2008). Proof of a strong linkage between a specific mutation and a disease should be obtained by segregation studies of large related cohorts, especially when the mutation is subtle, such as in this case. Therefore, our survey should contribute to a better understanding of this obscure protein domain. Finally, this report is the first to describe SERPING1 gene mutations in C1-INH-HAE patients of Jordanian origin and the second investigation of this disease in the Middle Eastern Arabian area (Faiyaz-Ul-Haque et al., 2010). The results will facilitate the molecular genetic diagnosis of C1-INH-HAE in Jordan, thereby improving early detection and the management of affected patients. These outcomes are especially important because 7 individuals from this
129
family underwent unnecessary appendectomies due to overlapping symptoms. Conflict of interest The authors declare no conflict of interest. Acknowledgements We are thankful to the patients and family members for their participation in the study. We are grateful to Batool Alzoubi, Sarah Shooter and Shereen Issa at Princess Haya Biotechnology Center for assistance with DNA sequencing. We also acknowledge the financial support from the Fondazione Cariplo, Milano, Italy (Grant no. 2013-0967). References Beinrohr, L., Harmat, V., Dobó, J., Lörincz, Z., Gál, P., Závodszky, P., 2007. C1 inhibitor serpin domain structure reveals the likely mechanism of heparin potentiation and conformational disease. J. Biol. Chem. 282, 21100–21109. Bock, S.C., Skriver, K., Nielsen, E., Thøgersen, H.C., Wiman, B., Donaldson, V.H., Eddy, R.L., Marrinan, J., Radziejewska, E., Huber, R., Shows, T.B., Magnusson, S., 1986. Human C1 inhibitor: primary structure, cDNA cloning, and chromosomal localization. Biochemistry 25, 4292–4301. Bork, K., Hardt, J., Witzke, G., 2012. Fatal laryngeal attacks and mortality in hereditary angioedema due to C1-INH deficiency. J. Allergy Clin. Immunol. 130, 692–697. Bos, I.G., Lubbers, Y.T., Roem, D., Abrahams, J.P., Hack, C.E., Eldering, E., 2003. The functional integrity of the serpin domain of C1-inhibitor depends on the unique N-terminal domain, as revealed by a pathological mutant. J. Biol. Chem. 278, 29463–29470. Bygum, A., Fagerberg, C.R., Ponard, D., Monnier, N., Lunardi, J., Drouet, C., 2011. Mutational spectrum and phenotypes in Danish families with hereditary angioedema because of C1 inhibitor deficiency. Allergy 66, 76–84. Cabrita, L.D., Dai, W., Bottomley, S.P., 2004. Different conformational changes within the F-helix occur during serpin folding, polymerization, and proteinase inhibition. Biochemistry 43, 9834–9839. Caccia, S., Castelli, R., Maiocchi, D., Bergamaschini, L., Cugno, M., 2011. Interaction of C1 inhibitor with thrombin on the endothelial surface. Blood Coagul. Fibrinolysis 22, 571–575. Caccia, S., Suffritti, C., Cicardi, M., 2014. Pathophysiology of hereditary angioedema. Pediatr. Allergy Immunol. Pulmonol. 27, 159–163. Cheng, J., Randall, A., Baldi, P., 2006. Prediction of protein stability changes for single-site mutations using support vector machines. Proteins 62, 1125–1132. Cicardi, M., Zingale, L., 2004. Clinical manifestations of hereditary angioedema. J. Allergy Clin. Immunol. 114, S55–S59. Cicardi, M., Aberer, W., Banerji, A., Bas, M., Bernstein, J.A., Bork, K., Caballero, T., Farkas, H., Grumach, A., Kaplan, A.P., Riedl, M.A., Triggiani, M., Zanichelli, A., Zuraw, B., 2014. Classification, diagnosis, and approach to treatment for angioedema: consensus report from the Hereditary Angioedema International Working Group. Allergy 69, 602–616. Cumming, S.A., Halsall, D.J., Ewan, P.W., Lomas, D.A., 2003. The effect of sequence variations within the coding region of the C1 inhibitor gene on disease expression and protein function in families with hereditary angio-oedema. J. Med. Genet. 40, e114. Davis 3rd, A.E., Cai, S., Liu, D., 2007. C1 inhibitor: biologic activities that are independent of protease inhibition. Immunobiology 212, 313–323. Faiyaz-Ul-Haque, M., Al-Gazlan, S., Abalkhail, H.A., Al-Abdulatif, A., Toulimat, M., Peltekova, I., Khaliq, A.M., Al-Dayel, F., Zaidi, S.H., 2010. Novel and recurrent mutations in the C1NH gene of Arab patients affected with hereditary angioedema. Int. Arch. Allergy Immunol. 151, 149–154. Ferraro, M.F., Moreno, A.S., Castelli, E.C., Donadi, E.A., Palma, M.S., Arcuri, H.A., Lange, A.P., Bork, K., Sarti, W., Arruda, L.K., 2011. A single nucleotide deletion at the C1 inhibitor gene as the cause of hereditary angioedema: insights from a Brazilian family. Allergy 66, 1384–1390. Gettins, P.G., 2002. The F-helix of serpins plays an essential: active role in the proteinase inhibition mechanism. FEBS Lett. 523, 2–6. Guarino, S., Perricone, C., Guarino, M.D., Giardina, E., Gambardella, S., Rosaria DApice, M., 2006. Gonadal mosaicism in hereditary angioedema. Clin. Genet. 70, 83–85. Joseph, K., Tholanikunnel, B.G., Bygum, A., Ghebrehiwet, B., Kaplan, A.P., 2013. Factor XII independent activation of the bradykinin-forming cascade: implications for the pathogenesis of hereditary angioedema types I and II. J. Allergy Clin. Immunol. 132, 470–475. Kalmár, L., Bors, A., Farkas, H., Vas, S., Fandl, B., Varga, L., Füst, G., Tordai, A., 2003. Mutation screening of the C1 inhibitor gene among Hungarian patients with hereditary angioedema. Hum. Mutat. 22, 498. Minta, J.O., 1981. The role of sialic acid in the functional activity and the hepatic clearance of C1-INH. J. Immunol. 126, 245–249.
130
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C., Markham, A.F., 1989. Analysis of any point mutation in DNA: the amplification refractory mutation system (ARMS). Nucleic Acids Res. 17, 2503–2516. Ng, P.C., Henikoff, S., 2003. SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res. 31, 3812–3814. Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A., Choquet, S., Agostoni, A., Tosi, M., 2000. Frequent de novo mutations and exon deletions in the C1inhibitor gene of patients with angioedema. J. Allergy Clin. Immunol. 106, 1147–1154. Pappalardo, E., Caccia, S., Suffritti, C., Tordai, A., Zingale, L.C., Cicardi, M., 2008. Mutation screening of C1 inhibitor gene in 108 unrelated families with hereditary angioedema: functional and structural correlates. Mol. Immunol. 45, 3536–3544. Perkins, S.J., Smith, K.F., Amatayakul, S., Ashford, D., Rademacher, T.W., Dwek, R.A., Lachmann, P.J., Harrison, R.A., 1990. Two-domain structure of the native and reactive centre cleaved forms of C1 inhibitor of human complement by neutron scattering. J. Mol. Biol. 214, 751–763. Ramensky, V., Bork, P., Sunyaev, S., 2002. Human non-synonymous SNPs: server and survey. Nucleic Acids Res. 30, 3894–3900. Reboul, A., Prandini, M.H., Colomb, M.G., 1987. Proteolysis and deglycosylation of human C1 inhibitor: effect on functional properties. Biochem. J. 244, 117–121. Rossi, V., Bally, I., Ancelet, S., Xu, Y., Frémeaux-Bacchi, V., Vivès, R.R., Sadir, R., Thielens, N., Arlaud, G.J., 2010. Functional characterization of the recombinant human C1 inhibitor serpin domain: insights into heparin binding. J. Immunol. 184, 4982–4989.
Schwarz, J.M., Rödelsperger, C., Schuelke, M., Seelow, D., 2010. MutationTaster evaluates disease-causing potential of sequence alterations. Nat. Methods 7, 575–576. Simonovic, I., Patston, P.A., 2000. The native metastable fold of C1-inhibitor is stabilized by disulfide bonds. Biochim. Biophys. Acta 1481, 97–102. Strecker, G., Ollier-Hartmann, M.P., van Halbeek, H., Vliegenthart, J.F., Montreuil, J., Hartmann, L., 1985. Primary structure of the glycan chains of normal C 1 esterase inhibitor (C 1-INH) after NMR analysis at 400MHz. C. R. Acad. Sci. III 301, 571–576, Vie. Vinall, L.E., Hill, A.S., Pigny, P., Pratt, W.S., Toribara, N., Gum, J.R., Kim, Y.S., Porchet, N., Aubert, J.P., Swallow, D.M., 1998. Variable number tandem repeat polymorphism of the mucin genes located in the complex on 11p15.5. Hum. Genet. 102, 357–366. Xu, Y.Y., Zhi, Y.X., Yin, J., Wang, L.L., Wen, L.P., Gu, J.Q., Guan, K., Craig, T., Zhang, H.Y., 2012. Mutational spectrum and geno-phenotype correlation in Chinese families with hereditary angioedema. Allergy 67, 1430–1436. Zanichelli, A., Mansi, M., Azin, G.M., Wu, M.A., Periti, G., Casazza, G., Vacchini, R., Suffritti, C., Cicardi, M., 2015. Efficacy of on-demand treatment in reducing morbidity in patients with hereditary angioedema due to C1 inhibitor deficiency. Allergy., http://dx.doi.org/10.1111/all.12731. van Doorn, M.B., Burggraaf, J., van Dam, T., Eerenberg, A., Levi, M., Hack, C.E., Schoemaker, R.C., Cohen, A.F., Nuijens, J., 2005. A phase I study of recombinant human C1 inhibitor in asymptomatic patients with hereditary angioedema. J. Allergy Clin. Immunol. 116, 876–883.
Contents lists available at ScienceDirect
Molecular Immunology journal homepage: www.elsevier.com/locate/molimm
Hereditary angioedema in a Jordanian family with a novel missense mutation in the C1-inhibitor N-terminal domain Saied A Jaradat a,∗ , Sonia Caccia b,∗∗ , Rifaat Rawashdeh a , Motasem Melhem a , Ali Al-Hawamdeh c , Thomas Carzaniga b , Hazem Haddad a a
Princess Haya Biotechnology Center, Jordan University of Science and Technology, Irbid 22110, Jordan “L. Sacco” Department of Biomedical and Clinical Sciences, University of Milan, Milan 20133, Italy c Pediatric Department, King Hussein Medical Center, Amman 11855, Jordan b
a r t i c l e
i n f o
Article history: Received 18 July 2015 Received in revised form 1 February 2016 Accepted 5 February 2016 Keywords: C1-inhibitor SERPING1 gene Hereditary angioedema Jordan N-terminal domain
a b s t r a c t Hereditary angioedema due to C1-inhibitor deficiency (C1-INH-HAE) is an autosomal dominant disease caused by mutations in the SERPING1 gene. A Jordanian family, including 14 individuals with C1-INHHAE clinical symptoms, was studied. In the propositus and his parents, SERPING1 had four mutations leading to amino acid substitutions. Two are known polymorphic variants (c.167T>C; p.Val34Ala and c.1438G>A; p.Val458Met), the others are newly described. One (c.203C>T; p.Thr46Ile) is located in the N-terminal domain of the C1-inhibitor protein and segregates with angioedema symptoms in the family. The other (c.800C>T; p.Ala245Val) belongs to the serpin domain, and derives from the unaffected father. DNA from additional 24 family members were screened for c.203C>T mutation in the target gene. All individuals heterozygous for the c.203C>T mutation had antigenic and functional plasma levels of C1inhibitor below 50% of normal, confirming the diagnosis of type I C1-INH-HAE. Angioedema symptoms were present in 14 of 16 subjects carrier for the c.203T allele. Among these subjects, those carrying the c.800T variation had more severe and frequent symptoms than subjects without this mutation. This family-based study provides the first evidence that multiple amino acid substitutions in SERPING1 could influence C1-INH-HAE phenotype. © 2016 Elsevier Ltd. All rights reserved.
1. Introduction Hereditary angioedema with C1-inhibitor deficiency (C1-INHHAE) (OMIM 106100) is an autosomal dominant disease with a minimum prevalence of 1/65,000 (Zanichelli et al., 2015). It is caused by mutations in one of the two alleles of SERPING1, the gene that encodes C1-inhibitor (C1-INH), a 500 amino acid serine protease inhibitor (SerPIn) (Bock et al., 1986). C1-INH-HAE clinical manifestations include recurrent episodes of swelling, mainly in the face, limbs, gastrointestinal and upper airway mucosa. When edema affects larynx, the disease is life threatening (Caccia et al., 2014).
∗ Corresponding author at: Princess Haya Biotechnology Center, Jordan University of Science and Technology, P. O. Box 3030, Irbid 22110, Jordan. ∗∗ Corresponding author. E-mail addresses: [email protected], [email protected] (S.A. Jaradat), [email protected] (S. Caccia), [email protected] (R. Rawashdeh), [email protected] (M. Melhem), [email protected] (A. Al-Hawamdeh), [email protected] (T. Carzaniga), hazem [email protected] (H. Haddad). http://dx.doi.org/10.1016/j.molimm.2016.02.001 0161-5890/© 2016 Elsevier Ltd. All rights reserved.
Two phenotypic variants of C1-INH-HAE have been described: type I, which represents 85% of all C1-INH-HAE cases, presenting with low functional and antigenic levels, and type II, presenting with low functional levels but normal antigen. In both cases, the levels of the C4 complement component are decreased (Cicardi et al., 2014). The SERPING1 gene is located on chromosome 11 and consists of 8 exons (Bock et al., 1986). According to the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk/ac/index.php/, assessed Jan. 01, 2016), 489 SERPING1 different mutations have been characterized, the majority derived from European/North American studies. A few reports originated from Asia and Latin America, and only one report originated from the Middle East (Faiyaz-Ul-Haque et al., 2010; Ferraro et al., 2011). C1-INH is an atypical serpin, having a two-domain structure. Beside the characterizing serpin domain, C1-INH has a peculiar Nterminal domain, whose function and structure remain elusive. The most of the missense mutations that have been identified so far (161 according to the Human Gene Mutation Database) are located in the serpin domain. The crystal structure of this domain serves to address the interpretation of the corresponding amino acid sub-
124
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
stitutions (Beinrohr et al., 2007). On the other hand, only 1 amino acid substitution involving a residue located inside the N-terminal domain (Leu32Gln) is reported (Pappalardo et al., 2008), concerning a single patient (author personal communication). Here, we report the genetic study of a large Jordanian family with C1-INH-HAE. Besides the disease causing mutation located in the N-terminal portion of the protein, additional SERPING1 mutations leading to amino acid substitutions in C1-INH are present in this family with possible effect on the clinical phenotype. 2. Materials and methods 2.1. Subjects This family came to our attention when the propositus (III-4; Fig. 1), was visited our metabolic disorders clinic at Princess Haya Biotechnology Center due to frequent facial swelling and occasional pain in the abdominal area. We interviewed his parents, aunts and uncles and were able to construct an extended pedigree consisting of 38 family members based on their clinical history. All the patients and parents were interviewed at their home and answered the clinical severity scores questionnaire. The available medical records were also reviewed. According to Cicardi et al. 2014 and Cicardi and Zingale, 2004; disease was defined as mild, moderate or severe, taking into account of angioedema attacks per year impairing daily activities and the need for prophylaxis treatment. We also calculated the disease severity score as recommended by Bygum et al. 2011; where the scoring system taking into account the age at onset of disease, the clinical manifestation site and need for long-term prophylaxis. The study was approved by the joint institutional review board committee of the Jordan University of Science and Technology and King Abdullah University Hospital. Consent was obtained from all subjects or their parents. 2.2. Complement testing Serum and plasma were isolated from 18 family members with or without a clinical history of HAE. The serum antigenic level of C1-INH was determined using a radial immunodiffusion kit (The Binding Site, Birmingham, UK). In three samples, the C1-INH concentration fell below the detection limit of the methods (38 mg/L). Both the serum C3 and C4 levels were measured with an immunoturbidimetric assay on a HITACHI 912 analyzer (Hitachi Corp, Tokyo, Japan) using the Tina-quant C3 and C4 assay kits (Roche Diagnostics Indianapolis, IN, USA). C1-INH activity was measured using a colorimetric assay (Technochrome C1-INH, Technoclone GmbH, Vienna, Austria). Reference ranges were 7–130% of normal (100% corresponds to 1 IU C1-INH/ml calibrated against the WHO plasma standard 08/262). Normal values for C1-INH antigenic levels are in the 19.5–34.5 mg/dL range; for C3 and C4 90–180 mg/dL and 10–40 mg/dL, respectively; for C1-INH functional activity normal levels are greater than 70% of the WHO plasma standard. 2.3. Genetic testing Genomic DNA from 25 family members was extracted from whole blood using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA). All 8 exons of the SERPING1 gene were initially screened by direct sequencing in the propositus, his parents {II-(1, 1a)}, brothers and sisters {III-(1–3) and III-(5–7)} (Fig. 1). Forward and reverse PCR primers used to amplify SERPING1 exons 1–8 and the flanking sequences were designed using the Primer3 algorithm (http://frodo.wi.mit.edu/cgi-bin/primer3/ primer3 www.cgi) and the NC 000011.9 sequence as a template.
The primer sequences and PCR reaction conditions are available upon request. The resulting sequences were aligned against a reference sequence using the ChromasPro 1.34 software package (Technelysium Pty Ltd, Australia). An Amplification Refractory Mutation System PCR (ARMS-PCR) was used to detect the C>T variation at nucleotide c.203 (Newton et al., 1989) in 80 healthy control individuals. The primer sequences and ARMS-PCR reaction conditions are available upon request. A total of 130 unrelated healthy controls were recruited and screened for SERPING1 c.203C>T mutation: 50 of these individuals were tested by direct DNA sequencing, and 80 were tested by ARMS-PCR. The c.800C>T and c.167T>C variant alleles was tested in the DNA of 50 healthy Jordanian controls by direct DNA sequencing. Total RNA was extracted from 300 l of whole blood using E.Z.N.A. Total RNA Kit (Omega Biotech, Norcross, Ga). RNA from individuals carrying variants c.203C>T (exon 3) and/or c.800C>T (exon 5) was reverse transcribed (RT) with the ProtoScriptTM First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA) with random hexamer primers. Two rounds of cDNA PCR amplification were carried out with primers located in exon 3 and exon 4 (forward 5 - GTTTGCAAGACAGAGGCGAA −3 , reverse 5 - TGGGCTGTGGAAGATCTGAG −3 ) and in exon 4 and exon 7 (forward 5 - CTCAGATCTTCCACAGCCCA −3 , reverse 5 TCACTTTGATGCGGGGTAGT −3 ). RT-PCR products were run on 1% agarose gels and stained with ethidium bromide. The nucleotide nomenclature is given in accordance with the Human Genome Variation Society Nomenclature standards using cDNA sequence NM 000062.2. For amino acid numbering, we followed the traditional nomenclature that considers the first amino acid of the mature protein (without the 22 N-terminal signal peptide residues) as amino acid number 1 through the text except in Fig. 3 legend. 2.4. SDS-PAGE and western blotting For the immunoblotting of C1-INH in whole plasma, pooled normal human plasma (NHP) or patients plasma collected in sodium citrate was diluted 1:15 in PBS; 15 l aliquots were mixed with 5 l of 4X non-reducing Laemmli sample buffer, boiled for five minutes, and applied to the gel. Samples were analyzed by 7.5% sodium dodecyl sulfate (SDS)-PAGE under non-reducing conditions, which leaves disulphide bonds intact. Gels were blotted onto PVDF membranes using the Trans-Blot Turbo Blotting System (Bio-Rad Laboratories, Hercules, CA, USA) with Trans-Blot Transfer Pack consumables (Bio-Rad Laboratories, Hercules, CA, USA). After blocking, membranes were incubated with sheep polyclonal anti-C1 inhibitor (The Binding Site Ltd, Birmingham, UK) and the immune-complexes were reacted with an alkaline phosphatase conjugated donkey-anti-sheep-Ig and visualized with a colorimetric substrate system (Sigma–Aldrich Co., St. Louis, MO, USA). 2.5. In silico analysis of the C1-INH missense variants Pathogenicity prediction of the missense variants was performed using the PolyPhen2 (http://genetics.bwh.harvard.edu/ pph/), SIFT (http://sift.bii.a-star.edu.sg/), MutationTaster (http:// www.mutationtaster.org/) and MuPro (http://www.ics.uci.edu/ ∼baldig/mutation.html) software. The PolyPhen program utilizes both sequence alignments and the three-dimensional structure databases (Ramensky et al., 2002). A score of more than 1.5 suggests a probably damaging mutation. SIFT (Sorting Intolerant From Tolerant) uses both sequence homology and the physical properties of the substituted amino acids (Ng and Henikoff, 2003). A score less than 0.05 suggest intolerant substitutions. MUpro software uses support vector machines to predict the effects of amino acid substitution on the stability of the protein.
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
125
Fig. 1. Phasing haplotypes for the four missense variants identified in a consanguineous portion of the family. Haplotypes were constructed using the four missense variants c.167T>C (p.Val34Ala), c.203C>T (p.Thr46Ile), c.800C>T (p.Ala245Val) and c.1438G>A (p.Val458Met). The c.203T mutant allele co-segregated with the phenotype in all members of the extended family tested for the mutation with exception of the asymptomatic III-5 and III-10. The disease-causing allele c.203T is transmitted in trans with either the c.800C (III-5) or the c.800T (III-6) alleles in the seven siblings.
A score less than 0 suggest a decrease in the stability of protein structure (Cheng et al., 2006). MutationTaster calculates the probability of DNA sequence variations to be either a disease causing mutation or a polymorphism (Schwarz et al., 2010). Probability close to 1 suggests strong prediction. 3. Results 3.1. Clinical and laboratory assessment We examined a Jordanian family consisting of 38 members, 14 of which presenting a clinical history of HAE, with a cumulative score of clinical severity ranging from 3 to 10 (Table 1), according to Bygum et al. 2011; considering age at onset of the disease, clinical manifestation sites and the need for long-term prophylaxis and from 1 to 250 (Table 2), according to Cicardi and Zingale, 2004; taking into account attacks frequency, severity degree and the treatment received. The score of the three patients of the consanguineous branch of the family that encountered their first episode at the age of 2 years were the highest among the family members using both scoring systems. Propositus III-4, who has a severity score of 9 and 250 (Tables 1 and 2), encountered 25 episodic angioedema and was hospitalized 15 times over a period of the last year at age 20 years. Most of his swelling attacks were in the face and to a less extent in the abdomen. In some patients abdominal attacks were always associated with vomiting (III-6 and II-7), in others with severe diarrhea (III-9) or constipation (II-4). Localization of the cutaneous angioedema was variable. Long-term prophylactic treatment with danazol was prescribed to patients that encountered severe and frequents attacks, however, parents refused the drug because of their fear the drug side effects. Detailed laboratory analyses of the complement system have been performed (Table 1). Angioedema clinical symptoms clearly segregate with low C1-INH antigenic and functional levels and low C4. Two C1-INH deficient subjects, aged 5 and 19 years were asymptomatic. Two women (II-2 and III-1), without c.203C > T mutation, had low C1-INH values, but no HAE clinical symptoms. The apparent discrepancy was ascribed to the fact that they were pregnant at blood drawing (Prof. Cicardi personal communication).
3.2. Genetic analysis The propositus and his parents {II-(1, 1a)} presented four heterozygous missense variants (Fig. 1). Variants c.167T>C; p.Val34Ala and c.1438G>A; p.Val458Met were already present in the NCBI Variation Database (http://www.ncbi.nlm.nih.gov/snp) with the following IDs: rs#11546660 and rs#4926, respectively. Val458 is a well-known polymorphism in the SERPING1 coding sequence (Cumming et al., 2003; Kalmár et al., 2003). The variants c.167T>C; p.Val34Ala was originally described in Chinese patients and control with “C” allele frequency 5.94% (Xu et al., 2012). Although, the c.167C allele was not found in 50 unaffected Jordanian individuals, however, the allele is not segregated with the clinical manifestations, implying that it is a polymorphism rather than a causative mutation. The other two variants c.203C>T; p.Thr46Ile (ss#1947221103) (Fig. 2A and B) and c.800C>T; p.Ala245Val (ss#1947221104) (Fig. 2C and D) were novel. All 8 exons of the SERPING1 gene were also screened in the propositus brothers and sisters (Fig. 1). Phasing haplotypes for the 4 variants identified showed that the c.203T allele segregated with low C1-INH plasma levels in all cases and with the angioedema clinical presentation in the mother and in 4 out of the 5 affected childrens (Fig. 1; Table 1). Therefore, all other members of the family for which DNA was available (16 individuals) were screened for the presence of the c.203T allele by direct DNA sequencing. Again, the c.203T allele segregated with the biochemical phenotype in the 14 family members with HAE clinical symptoms and 2 asymptomatics, but was absent in the other members tested. The c.203T mutant allele was not found in the DNA of 130 healthy Jordanian controls. The c.203C>T mutation located in exon 3 converts the Thr46 ACC codon into ATC Ile. The Thr46 residue is conserved in the C1-INH N-terminus of 10 species (Fig. 3). In silico analysis indicated that Thr46Ile is intolerant according to 2 out of 4 different programs (Table 3). Among the 9 family members for which we obtained the haplotype, we observed that the c.203T and c.800T alleles occurred as compound heterozygotes in 3 affected siblings {(III-(2–4–6)} (Fig. 1), having the highest severity scores. Individuals known to have just the c.800C>T variant (II-1a and III-7) do not have any
126
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
Table 1 Clinical and laboratory findings for 23 family members. Id
Age (years)
Age at onset
Painful abdominal edema
Skin edema
Laryngeal edema
Other manifestations
Long term prophylaxis
Severity score
C4 levels mg/dLa
C3 levels mg/dLa
C1-INH Ag mg/dLa
C1-INH function (%)a
II-1 II-1a II-2 III-1 III-2 III-3 III-4 III-5 III-6 III-7 III-8 II-4 II-4a III-9 III-10 II-5 III-11 III-12 II-7 III-15 III-17 III-18 III-21
32§ 55 28 24 23 11 21 19 11 22 7 39 33 10 5 36 6 10 44 10 23 17 17§
16 NA‡ NA NA 2 9 2 NA 2 NA NA 10 NA 10 NA 15 NA 9 17 8 9 17 9 months
Yes Unaffected Unaffected Unaffected Yes Yes Yes Asymptomatic Yes Unaffected Unaffected Yes Unaffected Yes Asymptomatic Yes Unaffected No Yes Yes Yes Yes Yes
Yes Unaffected Unaffected Unaffected Yes Yes Yes Asymptomatic Yes Unaffected Unaffected Yes Unaffected Yes Asymptomatic Yes Unaffected Yes Yes Yes Yes Yes Yes
Yes Unaffected Unaffected Unaffected Yes No Yes Asymptomatic Yes Unaffected Unaffected Yes Unaffected No Asymptomatic No Unaffected No Yes No No No Yes
Yes NA NA NA No No No No Yes NA NA Yes NA No No Yes NA No Yes No Yes No No
Yes∼ NA NA NA Yes+ ◦ No Yes+ ◦ No Yes+ ◦ NA NA No NA No No Yes∼ NA No Yes∼ No Yes∼ No No
8 NA NA NA 9 5 9 0 10 NA NA 8 NA 5 0 6 NA 3 8 5 7 4 7
ND† 19 27 ND 1.2 4.21 1 4.07 0.12 15.85 20 3.89 34 2.8 5.3 3.7 22.2 0.74 4.1 ND 1.86 ND ND
ND 88 128 ND 83 83.58 71 105.14 102 76.45 114 88 158 147 99 99 129 108 125 ND 113.69 ND ND
ND 18.7 16.5◦ 16.3 3.8 4.1 < 3.8 6.2 < 3.8 16.4 23 4.1 23 7.6 4.3 3.8 24.7 2.4 3.8 ND < 3.8 ND ND
ND 71 67 61 ND 11 ND 16 10 ND 82 17 ND T in exon 5: (C) homozygous wild type, (D) heterozygous. The solid arrows indicate the locations of the missense variants.
Fig. 3. Multiple alignment of C1-INH protein sequences from various species. The Thr46 amino acid residue in the N-terminal domain affected by the mutation is shown in red. Cys residues at position 101 and 108 are used to anchor the alignments. Thr68 amino acid residue on the figure is the same Thr46 of the C1-INH traditional amino acid nomenclature. The alignments were generated by the CLUSTAL Omega program.
symptoms of HAE, and had circulating C1-INH values at the lower limit of the normal range (Table 1). The c.800T variant allele was not found in the DNA of 50 control samples. The variation results in the substitution of the Ala245 residue with Val. Ala residue at position 245 is conserved in all 10 C1-INH proteins aligned in this report (data not shown). In silico analysis indicated that Ala245Val is intolerant according to 3 out of 4 different programs (Table 3). Although 4 siblings were affected in generation II, the parents (I1 and I-2) were free of symptoms until they passed away at 63 and 73 years of age. Due to the incomplete penetrance of the c.203C>T mutation (see family members III-5 and III-10), we cannot exclude the possibility that one of the parents was an asymptomatic carrier for the c.203T allele. Moreover, they were likely wild-type for the c.800C allele, as their daughter (II-1). However, we cannot rule out a de novo mutation or gonadal mosaicism as a possible mechanism for C1-INH-HAE in this family (Pappalardo et al., 2000; Guarino et al., 2006).
3.3. Gene and protein expression To exclude the potential of any splicing error that might be introduced by the c.203C>T and c.800C>T variants, we performed RT-PCR analyses on total RNA from blood samples of several family members. All individuals tested showed only the fragment with
the size corresponding to the normally spliced mRNA (578 bp and 546 bp respectively) (Fig. 4). Western Blot analysis was thus performed to examine C1-INH in plasma (Fig. 5). Separation by SDS-page under non-reducing conditions, revealed the presence of an extra band in patients carrying the c.203C>T; p.Thr46Ile mutation, migrating faster (95 kDa) than the native form (with an apparent molecular weight of 105 kDa). The same band is faintly visible also in individual II-1a carrying the c.800C>T; p.Ala254Val variant.
4. Discussion We identified 4 genetic variations of the SERPING1 gene in a patient with type I C1-INH-HAE belonging to a Jordanian family. In this family, the mutation that segregates with the disease is a novel heterozygous nucleotide substitution, c.203C>T, causing a change from Thr to Ile at position 46 inside the N-terminal domain of the C1-INH protein. Indeed, mature C1-INH is a heavily glycosylated glycoprotein with a two-domain structure, consisting of a typical C-terminal serpin domain and a unique, exceptionally long (∼100 amino acids) N-terminal extension (Perkins et al., 1990). The two domains are linked by two disulfide bridges (Fig. 6). A reduction of these bonds causes a conformational change such that the molecule loses its inhibitory activity and is more readily poly-
128
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
Fig. 4. RT-PCR analyses of RNA extracted from 5 family members. Lanes numbered 1 and 2 are the PCR products for two rounds of c-DNA amplification using PCR primers flanking the c.800C>T and the c.203C>T variants, respectively. All individuals tested showed only the wild-type spliced fragments; 546 bp for the c.800C>T and 578 bp for the c.203C>T variants. N (negative control); II-1a (heterozygous for c.800C>T, wild-type for c.203C>T); III-1 (wild-type for c.800C>T, wild-type for c.203C>T); III-3 (wild-type for c.800C>T, heterozygous for c.203C>T); III-5 (wildtype for c.800C>T, heterozygous for c.203C>T); III-6 (heterozygous for c.800C>T, heterozygous for c.203C>T). Lanes labeled “M” is the 100-bp ladder DNA marker.
merized, indicating that the N-terminal domain is required for the correct folding and processing of the entire molecule (Bos et al., 2003; Simonovic and Patston, 2000; Kalmár et al., 2003). However, just one survey is present reporting a missense mutation in the Nterminal domain in an isolated individual affected by HAE type I (Pappalardo et al., 2008). The domain shows no significant homology with any known protein, and its structure remains elusive. The presence of short tandem repeats and the high number of glycosylation sites is reminiscent of mucins (Vinall et al., 1998). Its deep glycosylation, makes C1-INH the most heavily glycosylated plasma
Fig. 6. Structural localization of the newly identified missense variant in the C1INH serpin domain. The reactive center loop is depicted in black, as well as helix-F, hosting residue 245 (black sphere), substituted in compound heterozygosis with Ile46 in 3 affected siblings. The two Cys residues bonding the N-terminal domain are indicated with white spheres. Coordinates are from the homology model of the native C1-INH serpin domain (PDB entry 1M6Q).
protein, with multiple O-linked and 6 N-linked glycans (Bock et al., 1986; Strecker et al., 1985), although the role of carbohydrates in the function and conformational stability of C1-INH has still to be clarified (Davis et al., 2007; Caccia et al., 2011; Minta, 1981; Reboul et al., 1987). A study reporting a substitution in the serpin domain that abolished an N-oligosaccharide and dramatically decreased the expression of the recombinant protein suggests that specific carbohydrates may be crucial for the proper folding of the protein and its secretion from the cell of synthesis (Rossi et al., 2010). Residue Thr46 is adjacent to an Asn amino acid that is known to be N-glycosylated. When Thr46 is mutated to Ile, the calculated potential score for N-glycosylation prediction (http://www.cbs.dtu. dk/services/NetNGlyc/) is decreased (only 4 out of 9 neural networks support the prediction), suggesting that the mutation can impair Asn47 glycosylation. Indeed, mutation Thr46Ile could have
Fig. 5. SDS-PAGE and Western blotting analyses of plasma samples isolated from 5 individuals of family 2 using sheep polyclonal anti-C1-INH. “M” is the Molecular weight marker; NHP (Normal human plasma); III-6 (heterozygous for c.800C>T, heterozygous for c.203C>T); II-1a (heterozygous for c.800C>T, wild-type for c.203C>T); III-12 (wildtype for c.800C>T, heterozygous for c.203C>T); II-2 (wild-type for c.800C>T, wild-type for c.203C>T); III-1 (wild-type for c.800C>T, wild-type for c.203C>T). In lanes labeled III-6 and III-12, the C1-INH migrated as doublet compared to the pooled plasma. The upper band of the doublet appears the same size as normal C1-INH (105 kDa) and the lower is 95 kDa.
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
deleterious consequences for protein expression by impairing glycosylation and ultimately protein folding and secretion. This would decrease the circulating level of C1-INH, as seen in these patients. To distinguish among the different conformations of circulating C1-INH, Western Blot analysis of plasma samples were performed. Upon non-reducing SDS-PAGE, in patients carrying the Thr46Ile substitution an additional band of lower molecular weight (95 kDa) than the native form was more evident. Since the entity of this band increased incubating the plasma samples at 37 ◦ C, and being its migration consistent with cleaved C1-INH, we conclude that it was due to the intrinsic instability of plasma of patients with HAE, such that on prolonged incubation at 37 ◦ C, kallikrein activity evolves with concomitant C1-INH cleavage (Joseph et al., 2013). Together with the c.203T allele, the c.800T allele occurred as a compound heterozygous in 3 out of 5HAE siblings {III-(2, 4, 6)}, whereas the other 2 (III-3 and III-5) were wild-type for the second allele. Notably, the formers had very high severity scores, while III5 was asymptomatic, and III-3 suffered from milder edema attacks and had the lowest severity score among her siblings. II-1a and his son III-7, are carrier for the c.800T allele and are clinically normal; their circulating C1-INH levels are slightly below the normal range but still considerably higher than the levels of the affected family members. Variant c.800C>T causes an amino acid substitution from Ala to Val at position 245 (Fig. 6). Ala245 belongs to ␣-helix F, which has been demonstrated to be important for serpin activity and polymerization (Cabrita et al., 2004; Gettins, 2002). Taken together, these observations may suggest a recessive modifier role for the c.800T allele in this family. The identification of clinically normal individuals and carriers for the heterozygous mutations in a family with a strong history for C1-INH-HAE is vital, considering that the fatality rate of laryngeal attacks in asymptomatics is higher than in well diagnosed patients (Bork et al., 2012). To the best of our knowledge, there are no international guidelines thus far on the management of asymptomatic HAE patients with short-term prophylactic treatment preceding a triggering event such as dental procedure. However, recombinant C1-INH administered in 12 asymptomatic patients has been demonstrated to be safe and tolerated (van Doorn et al., 2005). In conclusion, we present a new SERPING1 mutation responsible for C1-INH-HAE, which is associated to other variants leading to amino acid substitutions, but not to the disease in an extended family. This study will help to evaluate the effective penetrance of disease-causing mutations in C1-INH-HAE and to reveal the incidence of alleles with a modifier role. The c.800T allele in a consanguineous branch of the family appears to modify C1-INH-HAE symptoms, frequency and severity. This kind of analysis has rarely been feasible in HAE. Indeed, HAE is frequently characterized by private mutations and limited relatives. Furthermore, this study is the first to provide family-based evidence linking a missense mutation inside the N-terminal domain of C1-INH to HAE. Only one previous study associated an aminoacid substitution in the N-terminal domain with C1-INH-HAE type I in an isolated case (Pappalardo et al., 2008). Proof of a strong linkage between a specific mutation and a disease should be obtained by segregation studies of large related cohorts, especially when the mutation is subtle, such as in this case. Therefore, our survey should contribute to a better understanding of this obscure protein domain. Finally, this report is the first to describe SERPING1 gene mutations in C1-INH-HAE patients of Jordanian origin and the second investigation of this disease in the Middle Eastern Arabian area (Faiyaz-Ul-Haque et al., 2010). The results will facilitate the molecular genetic diagnosis of C1-INH-HAE in Jordan, thereby improving early detection and the management of affected patients. These outcomes are especially important because 7 individuals from this
129
family underwent unnecessary appendectomies due to overlapping symptoms. Conflict of interest The authors declare no conflict of interest. Acknowledgements We are thankful to the patients and family members for their participation in the study. We are grateful to Batool Alzoubi, Sarah Shooter and Shereen Issa at Princess Haya Biotechnology Center for assistance with DNA sequencing. We also acknowledge the financial support from the Fondazione Cariplo, Milano, Italy (Grant no. 2013-0967). References Beinrohr, L., Harmat, V., Dobó, J., Lörincz, Z., Gál, P., Závodszky, P., 2007. C1 inhibitor serpin domain structure reveals the likely mechanism of heparin potentiation and conformational disease. J. Biol. Chem. 282, 21100–21109. Bock, S.C., Skriver, K., Nielsen, E., Thøgersen, H.C., Wiman, B., Donaldson, V.H., Eddy, R.L., Marrinan, J., Radziejewska, E., Huber, R., Shows, T.B., Magnusson, S., 1986. Human C1 inhibitor: primary structure, cDNA cloning, and chromosomal localization. Biochemistry 25, 4292–4301. Bork, K., Hardt, J., Witzke, G., 2012. Fatal laryngeal attacks and mortality in hereditary angioedema due to C1-INH deficiency. J. Allergy Clin. Immunol. 130, 692–697. Bos, I.G., Lubbers, Y.T., Roem, D., Abrahams, J.P., Hack, C.E., Eldering, E., 2003. The functional integrity of the serpin domain of C1-inhibitor depends on the unique N-terminal domain, as revealed by a pathological mutant. J. Biol. Chem. 278, 29463–29470. Bygum, A., Fagerberg, C.R., Ponard, D., Monnier, N., Lunardi, J., Drouet, C., 2011. Mutational spectrum and phenotypes in Danish families with hereditary angioedema because of C1 inhibitor deficiency. Allergy 66, 76–84. Cabrita, L.D., Dai, W., Bottomley, S.P., 2004. Different conformational changes within the F-helix occur during serpin folding, polymerization, and proteinase inhibition. Biochemistry 43, 9834–9839. Caccia, S., Castelli, R., Maiocchi, D., Bergamaschini, L., Cugno, M., 2011. Interaction of C1 inhibitor with thrombin on the endothelial surface. Blood Coagul. Fibrinolysis 22, 571–575. Caccia, S., Suffritti, C., Cicardi, M., 2014. Pathophysiology of hereditary angioedema. Pediatr. Allergy Immunol. Pulmonol. 27, 159–163. Cheng, J., Randall, A., Baldi, P., 2006. Prediction of protein stability changes for single-site mutations using support vector machines. Proteins 62, 1125–1132. Cicardi, M., Zingale, L., 2004. Clinical manifestations of hereditary angioedema. J. Allergy Clin. Immunol. 114, S55–S59. Cicardi, M., Aberer, W., Banerji, A., Bas, M., Bernstein, J.A., Bork, K., Caballero, T., Farkas, H., Grumach, A., Kaplan, A.P., Riedl, M.A., Triggiani, M., Zanichelli, A., Zuraw, B., 2014. Classification, diagnosis, and approach to treatment for angioedema: consensus report from the Hereditary Angioedema International Working Group. Allergy 69, 602–616. Cumming, S.A., Halsall, D.J., Ewan, P.W., Lomas, D.A., 2003. The effect of sequence variations within the coding region of the C1 inhibitor gene on disease expression and protein function in families with hereditary angio-oedema. J. Med. Genet. 40, e114. Davis 3rd, A.E., Cai, S., Liu, D., 2007. C1 inhibitor: biologic activities that are independent of protease inhibition. Immunobiology 212, 313–323. Faiyaz-Ul-Haque, M., Al-Gazlan, S., Abalkhail, H.A., Al-Abdulatif, A., Toulimat, M., Peltekova, I., Khaliq, A.M., Al-Dayel, F., Zaidi, S.H., 2010. Novel and recurrent mutations in the C1NH gene of Arab patients affected with hereditary angioedema. Int. Arch. Allergy Immunol. 151, 149–154. Ferraro, M.F., Moreno, A.S., Castelli, E.C., Donadi, E.A., Palma, M.S., Arcuri, H.A., Lange, A.P., Bork, K., Sarti, W., Arruda, L.K., 2011. A single nucleotide deletion at the C1 inhibitor gene as the cause of hereditary angioedema: insights from a Brazilian family. Allergy 66, 1384–1390. Gettins, P.G., 2002. The F-helix of serpins plays an essential: active role in the proteinase inhibition mechanism. FEBS Lett. 523, 2–6. Guarino, S., Perricone, C., Guarino, M.D., Giardina, E., Gambardella, S., Rosaria DApice, M., 2006. Gonadal mosaicism in hereditary angioedema. Clin. Genet. 70, 83–85. Joseph, K., Tholanikunnel, B.G., Bygum, A., Ghebrehiwet, B., Kaplan, A.P., 2013. Factor XII independent activation of the bradykinin-forming cascade: implications for the pathogenesis of hereditary angioedema types I and II. J. Allergy Clin. Immunol. 132, 470–475. Kalmár, L., Bors, A., Farkas, H., Vas, S., Fandl, B., Varga, L., Füst, G., Tordai, A., 2003. Mutation screening of the C1 inhibitor gene among Hungarian patients with hereditary angioedema. Hum. Mutat. 22, 498. Minta, J.O., 1981. The role of sialic acid in the functional activity and the hepatic clearance of C1-INH. J. Immunol. 126, 245–249.
130
S.A. Jaradat et al. / Molecular Immunology 71 (2016) 123–130
Newton, C.R., Graham, A., Heptinstall, L.E., Powell, S.J., Summers, C., Kalsheker, N., Smith, J.C., Markham, A.F., 1989. Analysis of any point mutation in DNA: the amplification refractory mutation system (ARMS). Nucleic Acids Res. 17, 2503–2516. Ng, P.C., Henikoff, S., 2003. SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res. 31, 3812–3814. Pappalardo, E., Cicardi, M., Duponchel, C., Carugati, A., Choquet, S., Agostoni, A., Tosi, M., 2000. Frequent de novo mutations and exon deletions in the C1inhibitor gene of patients with angioedema. J. Allergy Clin. Immunol. 106, 1147–1154. Pappalardo, E., Caccia, S., Suffritti, C., Tordai, A., Zingale, L.C., Cicardi, M., 2008. Mutation screening of C1 inhibitor gene in 108 unrelated families with hereditary angioedema: functional and structural correlates. Mol. Immunol. 45, 3536–3544. Perkins, S.J., Smith, K.F., Amatayakul, S., Ashford, D., Rademacher, T.W., Dwek, R.A., Lachmann, P.J., Harrison, R.A., 1990. Two-domain structure of the native and reactive centre cleaved forms of C1 inhibitor of human complement by neutron scattering. J. Mol. Biol. 214, 751–763. Ramensky, V., Bork, P., Sunyaev, S., 2002. Human non-synonymous SNPs: server and survey. Nucleic Acids Res. 30, 3894–3900. Reboul, A., Prandini, M.H., Colomb, M.G., 1987. Proteolysis and deglycosylation of human C1 inhibitor: effect on functional properties. Biochem. J. 244, 117–121. Rossi, V., Bally, I., Ancelet, S., Xu, Y., Frémeaux-Bacchi, V., Vivès, R.R., Sadir, R., Thielens, N., Arlaud, G.J., 2010. Functional characterization of the recombinant human C1 inhibitor serpin domain: insights into heparin binding. J. Immunol. 184, 4982–4989.
Schwarz, J.M., Rödelsperger, C., Schuelke, M., Seelow, D., 2010. MutationTaster evaluates disease-causing potential of sequence alterations. Nat. Methods 7, 575–576. Simonovic, I., Patston, P.A., 2000. The native metastable fold of C1-inhibitor is stabilized by disulfide bonds. Biochim. Biophys. Acta 1481, 97–102. Strecker, G., Ollier-Hartmann, M.P., van Halbeek, H., Vliegenthart, J.F., Montreuil, J., Hartmann, L., 1985. Primary structure of the glycan chains of normal C 1 esterase inhibitor (C 1-INH) after NMR analysis at 400MHz. C. R. Acad. Sci. III 301, 571–576, Vie. Vinall, L.E., Hill, A.S., Pigny, P., Pratt, W.S., Toribara, N., Gum, J.R., Kim, Y.S., Porchet, N., Aubert, J.P., Swallow, D.M., 1998. Variable number tandem repeat polymorphism of the mucin genes located in the complex on 11p15.5. Hum. Genet. 102, 357–366. Xu, Y.Y., Zhi, Y.X., Yin, J., Wang, L.L., Wen, L.P., Gu, J.Q., Guan, K., Craig, T., Zhang, H.Y., 2012. Mutational spectrum and geno-phenotype correlation in Chinese families with hereditary angioedema. Allergy 67, 1430–1436. Zanichelli, A., Mansi, M., Azin, G.M., Wu, M.A., Periti, G., Casazza, G., Vacchini, R., Suffritti, C., Cicardi, M., 2015. Efficacy of on-demand treatment in reducing morbidity in patients with hereditary angioedema due to C1 inhibitor deficiency. Allergy., http://dx.doi.org/10.1111/all.12731. van Doorn, M.B., Burggraaf, J., van Dam, T., Eerenberg, A., Levi, M., Hack, C.E., Schoemaker, R.C., Cohen, A.F., Nuijens, J., 2005. A phase I study of recombinant human C1 inhibitor in asymptomatic patients with hereditary angioedema. J. Allergy Clin. Immunol. 116, 876–883.
