Insect Science (2014) 00, 1–7, DOI 10.1111/1744-7917.12194
ORIGINAL ARTICLE
Heat-induced mortality and expression of heat shock proteins in Colorado potato beetles treated with imidacloprid Jie Chen† , Ai Kitazumi, Jasper Alpuerto, Andrei Alyokhin and Benildo de los Reyes School of Biology and Ecology, University of Maine, Orono, ME 04469, USA
Abstract The Colorado potato beetle is an important pest of solanaceous plants in the Northern Hemisphere. Better understanding of its physiological responses to temperature stress and their interactions with still-prevalent chemical control has important implications for the management of this insect. We measured mortality and expression of the Hsp70 heat shock proteins in the Colorado potato beetle larvae exposed to sublethal concentration of the commonly used insecticide imidacloprid, and to supraoptimal temperatures. Both turned out to be significant stress factors, although induction of Hsp70 by imidacloprid observed in the present study was low compared to its induction by the heat. The two factors also interacted with each other. At an extreme temperature of 43 °C, exposure to a sublethal dose of imidacloprid resulted in a significant rise in larval mortality, which was not observed at an optimal temperature of 25 °C. Heat-stressed larvae also failed to respond to imidacloprid by producing more Hsp70. These findings suggest that when field rates of insecticides become insufficient for killing the exposed beetles under optimal temperature conditions due to the evolution of resistance in beetle populations, they may still reduce the probability of resistant beetles surviving the heat shock created by using propane flamers as a rescue treatment. Key words chemical stress; climate change; heat stress; insecticide resistance; integrated pest management; Leptinotarsa decemlineata (Say)
Introduction The Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae), is an important pest of potatoes, Solanum tuberosum L., tomatoes, Solanum lycopersicum L., and eggplants, Solanum melongena L. in the Northern Hemisphere (Alyokhin et al., 2013). Chemical control is the most commonly used method to manage this insect on commercial fields, with imidacloprid and other neonicotinoids being chemicals of choice for most commercial growers. Other control methCorrespondence: Andrei Alyokhin, School of Biology and Ecology, University of Maine, 5722 Deering Hall, Orono, ME 04469-5722, USA. Tel: +1 207 581 2970; fax: +1 207 581 2969; email: [email protected] † Present address: Department of Entomology, Louisiana State University, Baton Rouge, LA 70803, USA.
ods, such as biological control, cultural control, and mechanical control, are available, but often not economically competitive with insecticides (Alyokhin et al., 2013). However, chemicals frequently fail due to the Colorado potato beetle’s impressive ability to evolve insecticide resistance, often within a relatively short period of time (Alyokhin et al., 2008). As developing replacement insecticides becomes increasingly expensive, nonchemical methods of control are likely to become more important in managing this pest. Heat treatment, usually employing propane flamers, is a nonchemical approach that can be incorporated into integrated pest management programs designed to control the Colorado potato beetles. Beetle mortality following exposure to this treatment ranges between 30% and 100% (Khelifi et al., 2007). Furthermore, sublethal injuries to surviving beetles often impair their movement and ability to feed (Pelletier et al., 1995). The window of opportunity 1
C 2014
Institute of Zoology, Chinese Academy of Sciences
2
J. Chen et al.
for using this approach is fairly narrow because potato plants above 10 cm in height sustain serious heat damage themselves (Khelifi et al., 2007). Nevertheless, it has been successfully employed by a considerable number of commercial growers in the early 1990s, when no effective insecticides were available in some areas due to resistance in beetle populations (Alyokhin et al., 2008). The optimal temperature range for all Colorado potato beetle life stages is between 25 and 32 °C, while the rates of development slow down more than expected from degree-day models when temperature is below 10 °C or above 35 °C (Ferro et al., 1985; Logan et al., 1985). Depending on population, supercooling points for the overwintering Colorado potato beetle adults had been reported to range from -6 °C to -17 °C (Hiiesaar et al., 2006; Lyytinen et al., 2012). On the other side of the spectrum, adult beetles reduced feeding and burrowed into the soil at 35 °C, while 100% mortality occurred within 24 h at 40 °C (Grafius, 1986). Insects respond to elevated temperatures by an increase in the expression of heat shock proteins that contribute to the thermotolerance of the organisms (Parsell & Lindquist, 1993). Despite their name, heat shock proteins can also protect an organism from cold damage, possibly indicating cross-adaptation to heat and cold (Chen et al., 1987; Burton et al., 1988; Denlinger et al., 1992). Furthermore, they can be induced by other factors, such as ultraviolet radiation, drought and dehydration, chemicals, hypoxia, and injury by predators or parasites; therefore, they could be more accurately defined as “stress proteins” (Parsell & Lindquist, 1993; Sørensen et al., 2003). There are several subgroups of heat shock proteins named according to their molecular weights. Of those, Hsp70 considered to be the most important family in many organisms. Acting as molecular chaperones, Hsp70 proteins are known to participate in translocation, folding of newly synthesized proteins, degradation of unstable and wrongly folded proteins, and prevention and dissolution of protein complexes (Sørensen et al., 2003). They are more frequently observed to be responsible for heat tolerance compared to other groups of heat shock proteins (Daugaard et al., 2007), and are also known to be induced by a number of different insecticides (Yoshimi et al., 2002; Lee et al., 2006; Sonoda & Tsumuki, 2007). Temperature may have a modulating effect on the toxicity of insecticides. In some cases, heat stress has been shown to increase the negative effect of insecticide by increasing insect sensitivity to the active ingredient (Sparks et al., 1982; Gbaye et al., 2011; Muturi et al., 2011). In other cases, elevated temperature has been reported to reduce insecticide impact (Guthrie, 1950;
Sparks et al., 1982, 1983, Patil et al., 1996) by expediting environmental degradation of insecticidal residues (Arias-Est´evez et al., 2008), increasing the metabolic rates of affected organisms (Mayer & Ellersieck, 1986), or inducing cross-tolerance mediated by Hsp70 proteins (Patil et al., 1996; Ge et al., 2013). Better understanding of the Colorado potato beetle’s physiological responses to temperature stress and their interactions with still-prevalent chemical control may have important implications for the management of this pest beyond using propane flamers. Due to the global climate change, some areas within current distribution range of the Colorado potato beetle may experience significantly higher temperature extremes in the not-so-distant future. Therefore, forecasting Colorado potato beetle damage under different global climate change scenarios is another reason to study heat stress responses in this insect.
Materials and methods Insect origin Eggs of the laboratory-maintained Colorado potato beetles were shipped overnight in a Styrofoam container with an ice pack (French Agricultural Research Inc., Lamberton, MN, USA). This strain was originally collected from New Jersey, but has been kept in the lab for over 20 years and commonly used as a standard insecticide-susceptible strain in a variety of studies (see Chen et al., 2014 for more details). Upon arrival, the eggs were incubated in the growth chamber (Percival Scientific, Perry, Iowa, USA) at 25 ± 1 °C and 18 L : 6 D photoperiod. After the eggs hatched, the larvae were transferred to new Petri dishes, with freshly excised foliage provided daily. Second instars weighing 6–8.5 mg were used in the experiment.
Insecticide treatment Technical-grade imidacloprid (Bayer CropScience, Research Triangle Park, NC, USA) was diluted in acetone (Fisher Scientific, Pittsburg, PA, USA) at the concentration of 0.13 × 10-6 g/mL that was previously determined to be the LD25 for the strain used in the present study (Chen et al., 2014). A 1 μL drop was applied topically to the abdomen of the larvae with a microapplicator single infusion pump (Model 100, Cole-Parmer Instrument Company, IL, USA). Half of the larvae were treated with imidacloprid, while the rest were treated with pure acetone and used as a control. C 2014 Institute of
Zoology, Chinese Academy of Sciences, 00, 1–7
Heat and imidacloprid on Colorado potato beetle
Thermal tolerance Immediately after the treatment, 10 imidaclopridtreated or control 2nd instars were placed in a plastic Petri dish with a freshly cut potato leaflet. Each dish was assigned at random to one of the three temperature treatments created inside environmental chambers (Percival Scientific): 4 h at 43 ± 1 °C, 5.2 h at 43 ± 1 °C, and 5.2 h at 25 ± 1 °C (control). Our previous study (Chen et al., 2014) identified 4 h at 43 °C as LT25 for this strain, and 5.2 h at 43 °C as LT50 . After the designated time periods, the larvae were transferred to the 25 ± 1 °C chamber for 1 h to recover from a possible heat-induced coma (Huang et al., 2009). Following the recovery period, the larvae were taken out of the chamber, and their mortality was recorded at room temperature as failure to move at least one leg after being placed on their backs for 10 sec (Baker et al., 2007). After that, all the larvae were transferred in liquid nitrogen to the -80 °C freezer for the future RNA extraction. The experiment was replicated 15 times, with 150 larvae per imidacloprid/heat treatment combination tested.
RNA extraction and real-time qPCR analysis Forty frozen larvae originating from 4 randomly selected Petri dishes for each imidacloprid/heat treatment combination were placed in a single centrifuge tube and ground with dry ice. The procedure was repeated twice, creating 2 biological replications. Ground larvae were then split among 3 separate centrifuge tubes. Two of those were assigned for reaction with gene-specific Hsp70 primers (see below). The third tube was assigned for reaction with continuously expressed housekeeping β-actin gene and used as a control (Jiang et al., 2012). Total RNA was isolated from frozen tissues with the mirVanaTM miRNA Isolation Kit (AM1560; Ambion, Austin, TX, USA) following the manufacturer’s protocol. Total RNA (2 μg) was reverse transcribed using oligo-dT and random primer cocktail and iScript cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA) following the manufacturer’s instructions. Gene-specific primers Ldec_HSP70_F1R1 and Ldec_HSP70_F2R2 were designed based on the sequences of the Colorado potato beetle HSP70 (Accession AF288978; Table 1) published by Yocum (2001). Ldec_ HSP70_F2R2 was designed as a backup primer on lowcomplexity region to accommodate as many orthologous genes as possible. Se_β-actin were originally designed for testing responses to extreme temperatures in Spodoptera C 2014
Institute of Zoology, Chinese Academy of Sciences, 00, 1–7
3
exigua (Lepidoptera: Noctuidae) by Jiang et al. (2012). To confirm the stability of this gene in the Colorado potato beetle, we quantified β-actin transcripts from our samples on 40 ng of cDNA each. CT values were consistent to concentration of given cDNA (16.64 ± 0.11) and melt curve confirmed a single peak (82.94 ± 0.02 °C). Quantitative RT-PCR (qPCR) analysis of the control (actin) and experimental genes were performed in 3 independent technical replicates from each tube. For statistical analysis, biological replications were considered to be blocks, and technical replications were considered to be observations within the blocks. A single color realtime PCR system with SYBR Green Supermix (Bio-Rad Laboratories) was used following the manufacturer’s instructions. The relative expression of the Hsp70 genes under different temperature regimes was obtained using CT values normalized against the reference β-actin gene (Livak & Schmittgen, 2001). Larvae kept at 25 ± 1 °C without exposure to imidacloprid were used as a control. The relative expression values were calculated as 2− CT (Livak & Schmittgen, 2001). Although this was not an absolute quantification of exact target transcripts, it reflected the relative increase in expression in response to different conditions within the given population of insects.
Statistical analyses Before the analyses, the data were tested for the normality by the Wilk–Shapiro test at P 0.05 (PROC UNIVARIATE, SAS Institute, 2012). Since their distribution was nonnormal, the mortality data were transformed by arcsine square root (PROC TRANSREG, SAS Institute, 2012; Zar, 1999), while the relative expression data were transformed by ranks (PROC RANK, SAS Institute, 2012; Conover & Iman, 1981). Effects of imidacloprid and heat stress were tested for significance by ANOVA (PROC GLM, SAS Institute, 2012). The interaction terms between those two factors were statistically significant (P < 0.05; see below); therefore, imidacloprid effects were also analyzed separately for each temperature treatment. Mortality data were analyzed by Student’s t-tests (PROC TTEST, SAS Institute, 2012) using the transformed data with pooled degrees of freedom. Because rank transformation is not recommended for t-tests when sample sizes are low (de Winters, 2013), Hsp70 expression data were analyzed using Wilcoxon signed rank tests (PROC UNIVARIATE, SAS Institute, 2012). Means and standard errors were reported using untransformed data.
4
J. Chen et al.
Table 1 Primer sequences used for quantitative RT-PCR analysis. Gene-specific primers were designed based on experimentally validated sequences of HSP70 accession AF288978.2. Primer Se_β-Actin-S Se_β-Actin-A Ldec_HSP70_F1 Ldec_HSP70_R1 Ldec_HSP70_F2 Ldec_HSP70_R2
Sequences (5 -> 3 )
Reference/sequence
tccagccttccttcttgggtat caggtccttacggatgtcaacg gacgagaagcaaaggcaaag tgagcggtctgtttgatctg ccaactcaaacaagctgttcagga ccaatgagttgctgtctaacca
Jiang et al. (2012) Jiang et al. (2012) AF288978.2 AF288978.2 AF288978.1 and AF288978.2 AF288978.1 and AF288978.2
Fig. 1 Mortality of Colorado potato beetle 2nd instars exposed to sublethal imidacloprid concentrations at different temperature regimes. **P < 0.01, ***P < 0.0001. Error bars indicate standard errors (n = 15).
Fig. 2 Relative expression of Hsp70 heat shock proteins in the Colorado potato beetle 2nd instars exposed to sublethal imidacloprid concentrations at different temperature regimes. Error bars indicate standard errors (n = 6).
RNA expression of Hsp70 Results Thermal tolerance Beetle mortality is presented in Fig. 1. Imidaclopridtreated larvae had significantly higher overall mortality than larvae treated with acetone (61% ± 45% vs. 44% ± 38%, respectively [mean ± SE]; F1,78 = 47.85, P < 0.0001). Exposure to 43 °C also significantly increased larval mortality from 1% ± 0.5% at 25 °C to 74% ± 5% when held at 43 °C for 4 h, and to 83% ± 4% when held at 43 °C for 5.2 h (F2,78 = 335.40, P < 0.0001). The interaction of insecticide and temperature was significant (F2,78 = 7.47, P = 0.0011). Imidacloprid-treated larvae had higher mortality than acetone-treated larvae both when kept at 43 °C for 4 h (t28 = −2.8, P = 0.0093) and for 5.2 h (t28 = 4.67, P < 0.0001). At 25 °C, the imidacloprid treatment did not significantly influence the mortality (t28 = -1.78, P = 0.0720).
Both Ldec_HSP70 primers detected induction of Hsp70; however, Hsp70 expression detected by Ldec_HSP70_F2R2 was very low ( 0.2).
Discussion Exposure to imidacloprid and temperature were significant stress factors for the Colorado potato beetle larvae, as evidenced by both mortality and Hsp70 expression. The two factors also interacted with each other, with more larvae dying when the two were acting simultaneously. At the optimal temperature of 25 °C, imidacloprid exposure did not have a significant effect on larval mortality, confirming that the chemical was indeed applied at a sublethal concentration. Hsp70 expression in the treated larvae was elevated by about 2 fold, which might have been at least partially responsible for the lack of a detectable increase in mortality of exposed individuals under the optimal temperature conditions. Induction of Hp70 by a variety of toxins is fairly common among insects (Yoshimi et al., 2002; Lee et al., 2006; Sonoda & Tsumuki, 2007), and may be important for reducing their impacts on cell function (Sørensen et al., 2003). However, induction of Hsp70 by imidacloprid observed in the present study was very low compared to its induction by the heat (ca. 2 fold vs. ca. 900 fold; Fig. 2). At the extreme temperature of 43 °C, exposure to a sublethal dose of imidacloprid resulted in a significant rise in larval mortality, which was not observed at 25 °C. Heat-stressed larvae also failed to respond to imidacloprid by producing more Hsp70. On the contrary, Hsp70 expression in the treated larvae appeared to be reduced compared to the untreated larvae. Due to the high variation in protein expression, imidacloprid effects were not statistically significant when analyzed separately for each duration of exposure. Nevertheless, the numeric reduction in the relative expression values was almost 2 fold, from ca. 900 to ca. 500 (Fig. 2), suggesting that a combined action of the two stressors overwhelmed physiological defenses of the affected beetles. Alternatively, some of the decline could have been attributed to RNA degradation in larvae dying early during the exposure period. However, we were targeting short (80 bp) region located near 3 end of the transcript. Therefore, we are certain in robust detection of short fragments of transcripts even with partial degradation. Our findings are consistent with a number of earlier studies that investigated both potentiation of toxicity by ambient temperature, as well as effects of heat shock (sudden, temporary, and extreme temperature) on toxicity. For example, Muturi et al. (2011) reported the negative effects C 2014
Institute of Zoology, Chinese Academy of Sciences, 00, 1–7
5
of being reared at high temperature on the survivorship to adulthood in larvae of the Asian tiger mosquito, Aedes albopictus (Skuse) (Diptera: Culicidae) after treatment with a low concentration of an organophosphate insecticide malathion. For the light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), heat shock created by short-term increases in temperature from 20 to 45 °C had significant negative effects on the larval survivorship during the ethanol immersion (Dentener et al., 2000). Similarly, increasing temperature from 23 to 30 °C for 24 h resulted in a significantly higher mortality of the cowpea weevil, Callosobruchus maculates (Fabr.) (Coleoptera: Bruchidae) along the gradient of increasing malathion concentrations (Gbaye & Holloway, 2011; Gbaye et al., 2012). In the Colorado potato beetle, 4 different pyrethroid insecticides showed decreases in toxicity when the beetles were maintained between 14 and 30 °C, but increases between 30 and 35 °C (Grafius, 1986). As in this study, higher beetle mortality likely resulted from the simultaneous effects of two different stressors. The effects observed in our study were different from the effects reported in situations when chemical and thermal stressors were acting one after another. In the experiments by Patil et al. (1996), adaptive cross-tolerance to a carbamate insecticide propoxur was induced in 4thinstar larvae of mosquitoes Anopheles stephensi Liston and Aedes aegypti (L.) (Diptera: Culicidae) by preexposing them to high but sublethal temperatures. Preexposure to sublethal concentrations of propoxur was also found to confer cross-tolerance to heat, but to a lower extent. Similarly, Ge et al. (2013) reported enhanced thermotolerance and upregulation of Hsp70 in the brown planthoppers, Nilaparvata lugens St˚al (Hemiptera: Delphacidae), preexposed to sublethal concentrations of an organophosphate insecticide triazophos. So, while concurrent exposure to otherwise sublethal insecticides and heat may lead to a failure to maintain homeostasis and subsequent death of affected organisms, sequential exposure may result in the priming of physiological defenses and improved survivorship. However, exact outcomes are likely to vary depending on chemicals and species involved, as well as on potential mechanisms of resistance to insecticides. Higher susceptibility of heat-stressed beetles to insecticides generally supports using propane flamers as a rescue treatment when chemical control begins to fail due to resistance development. Although field rates of applied chemicals may no longer be sufficient to kill the exposed beetles under optimal temperature conditions, they may reduce the probability of resistant beetles surviving the heat shock. Our results also highlight the importance of taking environmental conditions into
6
J. Chen et al.
consideration when evaluating efficiency of chemical control. However, Petri dish confinement did not allow behavioral escape from unfavorable surroundings that is widely observed in the Colorado potato beetles in more natural settings (Alyokhin et al., 2013). Therefore, additional investigations are needed before developing practical control recommendations. Acknowledgments We thank Jonathon Bogacki, Victoria Calabrase, and Marina Mann for technical assistance, and Frank Drummond for providing advice on statistical analyses. The project was funded in part by the USDA-CSREES-NRI Award No. 2009–35505–06004.This is Publication No. 3399 of the Maine Agricultural and Forest Experiment Station. Disclosure The authors have no conflicts of interest.
References Alyokhin, A., Baker, M., Mota-Sanchez, D., Dively, G. and Grafius, E. (2008) Colorado potato beetle resistance to pesticides. American Journal of Potato Research, 85, 395–413. Alyokhin, A., Udalov, M. and Benkovskaya, G. (2013) The Colorado potato beetle. Insect Pests of Potato: Global Perspectives on Biology and Management (eds. P. Giordanengo, C. Vincent & A. Alyokhin), pp. 11–29. Academic Press, Oxford, UK. Arias-Est´evez, M., L´opez-Periago, E., Mart´ınez-Carballo, E., Simal-G´andara, J., Mejuto, J.-C. and Garc´ıa-R´ıo, L. (2008) The mobility and degradation of pesticides in soils and the pollution of groundwater resources. Agriculture, Ecosystems & Environment, 123, 247–260. Baker, M.B., Alyokhin, A., Porter, A.H., Ferro, D.N., Dastur, S.R. and Galal, N. (2007) Persistence and inheritance of costs of resistance to imidacloprid in Colorado potato beetle. Journal of Economic Entomology, 100, 1871–1879. Burton, V., Miitchell, H.K., Young, P. and Petersen, N.S. (1988) Heat shock protection against cold stress of Drosophila melanogaster. Molecular and Cellular Biology, 8, 3350– 3552. Chen, C.P., Denlinger, D.L. and Lee, R.E. (1987) Cold-shock injury and rapid cold hardening in the flesh fly Sarcophaga crassipalpis. Physiological Zoology, 60, 297–304. Chen, J., Alyokhin, A., Mota-Sanchez, D., Baker, M. and Whalon, M. (2014) Variation in fitness among geographically isolated Colorado potato beetle (Coleoptera: Chrysomelidae)
populations. Annals of the Entomological Society of America, 107, 128–135. Conover, W.J. and Iman, R.L. (1981) Rank transformations as a bridge between parametric and nonparametric statistics. American Statistician, 35, 124–129. Daugaard, M., Rohde, M. and J¨aa¨ ttel¨a, M. (2007) The heat shock protein 70 family: highly homologous proteins with overlapping and distinct functions. FEBS Letters, 581, 3702– 3710. de Winter, J.C.F. (2013) Using the Student’s t-test with extremely small sample sizes. Practical Assessment, Research & Evaluation, 18(10), 1–12. Available online: http://pareonline.net/ getvn.asp?v=18&n=10. Accessed on June 17, 2014. Denlinger, D.L., Lee, R.E., Yocum, G.D. and Kukal, O. (1992) Role of chilling in the acquisition of cold tolerance and the capacitation to express stress proteins in diapausing pharate larvae of the gypsy moth, Lymantria dispar. Archives of Insect Biochemistry and Physiology, 21, 271–280. Dentener, P.R., Lewthwaite, S.E., Bennett, K.V., Maindonald, J.H. and Connolly, P.G. (2000) Effects of temperature and treatment conditions on the mortality of Epiphyas postvittana (Lepidoptera: Tortricidae) exposed to ethanol. Journal of Economic Entomology, 93, 519–525. Ferro, D.N., Logan, J.A., Voss, R.H. and Elkinton, J.S. (1985) Colorado potato beetle (Coleoptera: Chrysomelidae) temperature-dependent growth and feeding rates. Environmental Entomology, 14, 343–348. Gbaye, O.A. and Holloway, G.J. (2011) Varietal effects of cowpea, Vigna unguiculata, on tolerance to malathion in Callosobruchus maculatus (Coleoptera: Bruchidae). Journal of Stored Products Research, 47, 365–371. Gbaye, O.A., Millard, J.C. and Holloway, G.J. (2011) Legume type and temperature effects on the toxicity of insecticide to the genus Callosobruchus (Coleoptera: Bruchidae). Journal of Stored Products Research, 47, 8–12. Gbaye, O.A., Holloway, G.J. and Millard, J.C. (2012) Synergistic effects of geographical strain, temperature and larval food on insecticide tolerance in Callosobruchus maculatus (F.). Journal of Applied Entomology, 136, 282–291. Ge, L.Q., Huang, L.J., Yang, G.Q., Song, Q.S., Stanley, D., Gurr, G.M. and Wu, J.C. (2013) Molecular basis for insecticideenhanced thermotolerance in the brown planthopper Nilaparvata lugens St˚al (Hemiptera: Delphacidae). Molecular Ecology, 22, 5624–5634. Grafius, E. (1986) Effects of temperature on pyrethroid toxicity to Colorado potato beetle (Coleoptera: Chrysomelidae). Journal of Economic Entomology, 79, 588–591. Guthrie, F.E. (1950) Effect of temperature on toxicity of certain organic insecticides. Journal of Economic Entomology, 43, 559–560. Hiiesaar, K., Metspalu, L., Joudu, J. and Jogar, K. (2006) Over-wintering of the Colorado potato beetle (Leptinotarsa
C 2014 Institute of
Zoology, Chinese Academy of Sciences, 00, 1–7
Heat and imidacloprid on Colorado potato beetle decemlineata Say) in field conditions and factors affecting its population density in Estonia. Agronomy Research, 4, 21–30. Huang, L.H., Wang, C.Z. and Kang, L. (2009) Cloning and expression of five heat shock protein genes in relation to cold hardening and development in the leafminer, Liriomyza sativae. Journal of Insect Physiology, 55, 279–285. Jiang, X.F., Zhai, H.F., Wang, L., Luo, L.Z., Sappington, T.W. and Zhang, L. (2012) Cloning of the heat shock protein 90 and 70 genes from the beet armyworm, Spodoptera exigua, and expression characteristics in relation to thermal stress and development. Cell Stress and Chaperones, 17, 67–80. Khelifi, M., de Ladurantaye, Y. and Lague, C. (2007) Physical control of Colorado potato beetle: A review. Applied Engineering in Agriculture, 23, 557–569. Lee, S.-M., Lee, S.-B., Park, C.-H. and Choi, J. (2006) Expression of heat shock protein and hemoglobin genes in Chironomus tentans (Diptera, Chironomidae) larvae exposed to various environmental pollutants: A potential biomarker of freshwater monitoring. Chemosphere, 65, 1074–1081. Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2− CT method. Methods, 25, 402–408. Logan, P.A., Casagrande, R.A., Faubert, H.H. and Drummond, F.A. (1985) Temperature-dependent development and feeding of immature Colorado potato beetles, Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae). Environmental Entomology, 14, 275–283. Lyytinen, A., Mappes, J. and Lindstr¨om, L. (2012) Variation in Hsp70 levels after cold shock: Signs of evolutionary responses to thermal selection among Leptinotarsa decemlineata populations. PLoS ONE, 7(2), e31446. Mayer, F. and Ellersieck, M. (1986) Manual of Acute Toxicity: Interpretation and Data Base for 410 Chemicals and 66 Species of Freshwater Animals. U.S. Fish and Wildlife Service Research Publication, Washington, DC. Mururi, D.J., Lampman, R., Costanzo, K. and Alto, B.W. (2011) Effect of temperature and insecticide stress on life-history traits of Culex restuans and Aedes albopictus (Dipera: Culicidae). Journal of Medical Entomology, 48, 243–250. Parsell, D.A. and Lindquist, S. (1993) The function of heatshock protein in stress tolerance: degradation and reactivation
C 2014
Institute of Zoology, Chinese Academy of Sciences, 00, 1–7
7
of damaged proteins. Annual Review of Genetics, 27, 437– 496. Patil, N.S., Lole, K.S. and Deobagkar, D.N. (1996) Adaptive larval thermotolerance and induced cross-tolerance to propoxur insecticide in mosquitoes Anopheles stephensi and Aedes aegypti. Medical and Veterinary Entomology, 10, 277– 282. Pelletier, Y., Mcleod, C.D. and Bernard, G. (1995) Description of sublethal injuries caused to the Colorado potato beetle (Coleoptera: Chrysomelidae) by propane flamer treatment. Journal of Economic Entomology, 88, 1203–1205. SAS Institute (2012) SAS English version 9.3. SAS Institute Inc., Cary, NC. Sørensen, J.G., Kristensen, T.N. and Loeschcke, V. (2003) The evolutionary and ecological role of heat shock proteins. Ecology Letters, 6, 1025–1037. Sonoda, S. and Tsumuki, H. (2007) Induction of heat shock protein genes by chlorfenapyr in cultured cells of the cabbage armyworm, Mamestra brassicae. Pesticide Biochemistry and Physiology, 89, 185–189. Sparks, T.C., Shour, M.H. and Wellemeyer, E.G. (1982) Temperature toxicity relations of pyrethroids on three Lepidopterans. Journal of Economic Entomology, 75, 634–646. Sparks, T.C., Pavloff, A.M., Rose, R.L. and Clower, D.F. (1983) Temperature-toxicity relationships of pyrethroids on Heliothis virescens (F.) (Lepidoptera: Noctuidae) and Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae). Journal of Economic Entomology, 76, 243–246. Yocum, G.D. (2001) Differential expression of two HSP70 transcripts in response to cold shock thermoperiod and adult diapause in the Colorado potato beetle. Journal of Insect Physiology, 47, 1139–1145. Yoshimi, T., Minowa, K., Karouna-Renier, N.K., Watanabe, C., Sugaya, Y. and Miura, T. (2002) Activation of a stress-induced gene by insecticides in the midge, Chironomus yoshimatsui. Journal of Biochemical and Molecular Toxicology, 16, 10–17. Zar, J.H. (1999) Biostatistical analysis. Prentice Hall, Upper Saddle River, New Jersey.
Accepted November 12, 2014
ORIGINAL ARTICLE
Heat-induced mortality and expression of heat shock proteins in Colorado potato beetles treated with imidacloprid Jie Chen† , Ai Kitazumi, Jasper Alpuerto, Andrei Alyokhin and Benildo de los Reyes School of Biology and Ecology, University of Maine, Orono, ME 04469, USA
Abstract The Colorado potato beetle is an important pest of solanaceous plants in the Northern Hemisphere. Better understanding of its physiological responses to temperature stress and their interactions with still-prevalent chemical control has important implications for the management of this insect. We measured mortality and expression of the Hsp70 heat shock proteins in the Colorado potato beetle larvae exposed to sublethal concentration of the commonly used insecticide imidacloprid, and to supraoptimal temperatures. Both turned out to be significant stress factors, although induction of Hsp70 by imidacloprid observed in the present study was low compared to its induction by the heat. The two factors also interacted with each other. At an extreme temperature of 43 °C, exposure to a sublethal dose of imidacloprid resulted in a significant rise in larval mortality, which was not observed at an optimal temperature of 25 °C. Heat-stressed larvae also failed to respond to imidacloprid by producing more Hsp70. These findings suggest that when field rates of insecticides become insufficient for killing the exposed beetles under optimal temperature conditions due to the evolution of resistance in beetle populations, they may still reduce the probability of resistant beetles surviving the heat shock created by using propane flamers as a rescue treatment. Key words chemical stress; climate change; heat stress; insecticide resistance; integrated pest management; Leptinotarsa decemlineata (Say)
Introduction The Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae), is an important pest of potatoes, Solanum tuberosum L., tomatoes, Solanum lycopersicum L., and eggplants, Solanum melongena L. in the Northern Hemisphere (Alyokhin et al., 2013). Chemical control is the most commonly used method to manage this insect on commercial fields, with imidacloprid and other neonicotinoids being chemicals of choice for most commercial growers. Other control methCorrespondence: Andrei Alyokhin, School of Biology and Ecology, University of Maine, 5722 Deering Hall, Orono, ME 04469-5722, USA. Tel: +1 207 581 2970; fax: +1 207 581 2969; email: [email protected] † Present address: Department of Entomology, Louisiana State University, Baton Rouge, LA 70803, USA.
ods, such as biological control, cultural control, and mechanical control, are available, but often not economically competitive with insecticides (Alyokhin et al., 2013). However, chemicals frequently fail due to the Colorado potato beetle’s impressive ability to evolve insecticide resistance, often within a relatively short period of time (Alyokhin et al., 2008). As developing replacement insecticides becomes increasingly expensive, nonchemical methods of control are likely to become more important in managing this pest. Heat treatment, usually employing propane flamers, is a nonchemical approach that can be incorporated into integrated pest management programs designed to control the Colorado potato beetles. Beetle mortality following exposure to this treatment ranges between 30% and 100% (Khelifi et al., 2007). Furthermore, sublethal injuries to surviving beetles often impair their movement and ability to feed (Pelletier et al., 1995). The window of opportunity 1
C 2014
Institute of Zoology, Chinese Academy of Sciences
2
J. Chen et al.
for using this approach is fairly narrow because potato plants above 10 cm in height sustain serious heat damage themselves (Khelifi et al., 2007). Nevertheless, it has been successfully employed by a considerable number of commercial growers in the early 1990s, when no effective insecticides were available in some areas due to resistance in beetle populations (Alyokhin et al., 2008). The optimal temperature range for all Colorado potato beetle life stages is between 25 and 32 °C, while the rates of development slow down more than expected from degree-day models when temperature is below 10 °C or above 35 °C (Ferro et al., 1985; Logan et al., 1985). Depending on population, supercooling points for the overwintering Colorado potato beetle adults had been reported to range from -6 °C to -17 °C (Hiiesaar et al., 2006; Lyytinen et al., 2012). On the other side of the spectrum, adult beetles reduced feeding and burrowed into the soil at 35 °C, while 100% mortality occurred within 24 h at 40 °C (Grafius, 1986). Insects respond to elevated temperatures by an increase in the expression of heat shock proteins that contribute to the thermotolerance of the organisms (Parsell & Lindquist, 1993). Despite their name, heat shock proteins can also protect an organism from cold damage, possibly indicating cross-adaptation to heat and cold (Chen et al., 1987; Burton et al., 1988; Denlinger et al., 1992). Furthermore, they can be induced by other factors, such as ultraviolet radiation, drought and dehydration, chemicals, hypoxia, and injury by predators or parasites; therefore, they could be more accurately defined as “stress proteins” (Parsell & Lindquist, 1993; Sørensen et al., 2003). There are several subgroups of heat shock proteins named according to their molecular weights. Of those, Hsp70 considered to be the most important family in many organisms. Acting as molecular chaperones, Hsp70 proteins are known to participate in translocation, folding of newly synthesized proteins, degradation of unstable and wrongly folded proteins, and prevention and dissolution of protein complexes (Sørensen et al., 2003). They are more frequently observed to be responsible for heat tolerance compared to other groups of heat shock proteins (Daugaard et al., 2007), and are also known to be induced by a number of different insecticides (Yoshimi et al., 2002; Lee et al., 2006; Sonoda & Tsumuki, 2007). Temperature may have a modulating effect on the toxicity of insecticides. In some cases, heat stress has been shown to increase the negative effect of insecticide by increasing insect sensitivity to the active ingredient (Sparks et al., 1982; Gbaye et al., 2011; Muturi et al., 2011). In other cases, elevated temperature has been reported to reduce insecticide impact (Guthrie, 1950;
Sparks et al., 1982, 1983, Patil et al., 1996) by expediting environmental degradation of insecticidal residues (Arias-Est´evez et al., 2008), increasing the metabolic rates of affected organisms (Mayer & Ellersieck, 1986), or inducing cross-tolerance mediated by Hsp70 proteins (Patil et al., 1996; Ge et al., 2013). Better understanding of the Colorado potato beetle’s physiological responses to temperature stress and their interactions with still-prevalent chemical control may have important implications for the management of this pest beyond using propane flamers. Due to the global climate change, some areas within current distribution range of the Colorado potato beetle may experience significantly higher temperature extremes in the not-so-distant future. Therefore, forecasting Colorado potato beetle damage under different global climate change scenarios is another reason to study heat stress responses in this insect.
Materials and methods Insect origin Eggs of the laboratory-maintained Colorado potato beetles were shipped overnight in a Styrofoam container with an ice pack (French Agricultural Research Inc., Lamberton, MN, USA). This strain was originally collected from New Jersey, but has been kept in the lab for over 20 years and commonly used as a standard insecticide-susceptible strain in a variety of studies (see Chen et al., 2014 for more details). Upon arrival, the eggs were incubated in the growth chamber (Percival Scientific, Perry, Iowa, USA) at 25 ± 1 °C and 18 L : 6 D photoperiod. After the eggs hatched, the larvae were transferred to new Petri dishes, with freshly excised foliage provided daily. Second instars weighing 6–8.5 mg were used in the experiment.
Insecticide treatment Technical-grade imidacloprid (Bayer CropScience, Research Triangle Park, NC, USA) was diluted in acetone (Fisher Scientific, Pittsburg, PA, USA) at the concentration of 0.13 × 10-6 g/mL that was previously determined to be the LD25 for the strain used in the present study (Chen et al., 2014). A 1 μL drop was applied topically to the abdomen of the larvae with a microapplicator single infusion pump (Model 100, Cole-Parmer Instrument Company, IL, USA). Half of the larvae were treated with imidacloprid, while the rest were treated with pure acetone and used as a control. C 2014 Institute of
Zoology, Chinese Academy of Sciences, 00, 1–7
Heat and imidacloprid on Colorado potato beetle
Thermal tolerance Immediately after the treatment, 10 imidaclopridtreated or control 2nd instars were placed in a plastic Petri dish with a freshly cut potato leaflet. Each dish was assigned at random to one of the three temperature treatments created inside environmental chambers (Percival Scientific): 4 h at 43 ± 1 °C, 5.2 h at 43 ± 1 °C, and 5.2 h at 25 ± 1 °C (control). Our previous study (Chen et al., 2014) identified 4 h at 43 °C as LT25 for this strain, and 5.2 h at 43 °C as LT50 . After the designated time periods, the larvae were transferred to the 25 ± 1 °C chamber for 1 h to recover from a possible heat-induced coma (Huang et al., 2009). Following the recovery period, the larvae were taken out of the chamber, and their mortality was recorded at room temperature as failure to move at least one leg after being placed on their backs for 10 sec (Baker et al., 2007). After that, all the larvae were transferred in liquid nitrogen to the -80 °C freezer for the future RNA extraction. The experiment was replicated 15 times, with 150 larvae per imidacloprid/heat treatment combination tested.
RNA extraction and real-time qPCR analysis Forty frozen larvae originating from 4 randomly selected Petri dishes for each imidacloprid/heat treatment combination were placed in a single centrifuge tube and ground with dry ice. The procedure was repeated twice, creating 2 biological replications. Ground larvae were then split among 3 separate centrifuge tubes. Two of those were assigned for reaction with gene-specific Hsp70 primers (see below). The third tube was assigned for reaction with continuously expressed housekeeping β-actin gene and used as a control (Jiang et al., 2012). Total RNA was isolated from frozen tissues with the mirVanaTM miRNA Isolation Kit (AM1560; Ambion, Austin, TX, USA) following the manufacturer’s protocol. Total RNA (2 μg) was reverse transcribed using oligo-dT and random primer cocktail and iScript cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA) following the manufacturer’s instructions. Gene-specific primers Ldec_HSP70_F1R1 and Ldec_HSP70_F2R2 were designed based on the sequences of the Colorado potato beetle HSP70 (Accession AF288978; Table 1) published by Yocum (2001). Ldec_ HSP70_F2R2 was designed as a backup primer on lowcomplexity region to accommodate as many orthologous genes as possible. Se_β-actin were originally designed for testing responses to extreme temperatures in Spodoptera C 2014
Institute of Zoology, Chinese Academy of Sciences, 00, 1–7
3
exigua (Lepidoptera: Noctuidae) by Jiang et al. (2012). To confirm the stability of this gene in the Colorado potato beetle, we quantified β-actin transcripts from our samples on 40 ng of cDNA each. CT values were consistent to concentration of given cDNA (16.64 ± 0.11) and melt curve confirmed a single peak (82.94 ± 0.02 °C). Quantitative RT-PCR (qPCR) analysis of the control (actin) and experimental genes were performed in 3 independent technical replicates from each tube. For statistical analysis, biological replications were considered to be blocks, and technical replications were considered to be observations within the blocks. A single color realtime PCR system with SYBR Green Supermix (Bio-Rad Laboratories) was used following the manufacturer’s instructions. The relative expression of the Hsp70 genes under different temperature regimes was obtained using CT values normalized against the reference β-actin gene (Livak & Schmittgen, 2001). Larvae kept at 25 ± 1 °C without exposure to imidacloprid were used as a control. The relative expression values were calculated as 2− CT (Livak & Schmittgen, 2001). Although this was not an absolute quantification of exact target transcripts, it reflected the relative increase in expression in response to different conditions within the given population of insects.
Statistical analyses Before the analyses, the data were tested for the normality by the Wilk–Shapiro test at P 0.05 (PROC UNIVARIATE, SAS Institute, 2012). Since their distribution was nonnormal, the mortality data were transformed by arcsine square root (PROC TRANSREG, SAS Institute, 2012; Zar, 1999), while the relative expression data were transformed by ranks (PROC RANK, SAS Institute, 2012; Conover & Iman, 1981). Effects of imidacloprid and heat stress were tested for significance by ANOVA (PROC GLM, SAS Institute, 2012). The interaction terms between those two factors were statistically significant (P < 0.05; see below); therefore, imidacloprid effects were also analyzed separately for each temperature treatment. Mortality data were analyzed by Student’s t-tests (PROC TTEST, SAS Institute, 2012) using the transformed data with pooled degrees of freedom. Because rank transformation is not recommended for t-tests when sample sizes are low (de Winters, 2013), Hsp70 expression data were analyzed using Wilcoxon signed rank tests (PROC UNIVARIATE, SAS Institute, 2012). Means and standard errors were reported using untransformed data.
4
J. Chen et al.
Table 1 Primer sequences used for quantitative RT-PCR analysis. Gene-specific primers were designed based on experimentally validated sequences of HSP70 accession AF288978.2. Primer Se_β-Actin-S Se_β-Actin-A Ldec_HSP70_F1 Ldec_HSP70_R1 Ldec_HSP70_F2 Ldec_HSP70_R2
Sequences (5 -> 3 )
Reference/sequence
tccagccttccttcttgggtat caggtccttacggatgtcaacg gacgagaagcaaaggcaaag tgagcggtctgtttgatctg ccaactcaaacaagctgttcagga ccaatgagttgctgtctaacca
Jiang et al. (2012) Jiang et al. (2012) AF288978.2 AF288978.2 AF288978.1 and AF288978.2 AF288978.1 and AF288978.2
Fig. 1 Mortality of Colorado potato beetle 2nd instars exposed to sublethal imidacloprid concentrations at different temperature regimes. **P < 0.01, ***P < 0.0001. Error bars indicate standard errors (n = 15).
Fig. 2 Relative expression of Hsp70 heat shock proteins in the Colorado potato beetle 2nd instars exposed to sublethal imidacloprid concentrations at different temperature regimes. Error bars indicate standard errors (n = 6).
RNA expression of Hsp70 Results Thermal tolerance Beetle mortality is presented in Fig. 1. Imidaclopridtreated larvae had significantly higher overall mortality than larvae treated with acetone (61% ± 45% vs. 44% ± 38%, respectively [mean ± SE]; F1,78 = 47.85, P < 0.0001). Exposure to 43 °C also significantly increased larval mortality from 1% ± 0.5% at 25 °C to 74% ± 5% when held at 43 °C for 4 h, and to 83% ± 4% when held at 43 °C for 5.2 h (F2,78 = 335.40, P < 0.0001). The interaction of insecticide and temperature was significant (F2,78 = 7.47, P = 0.0011). Imidacloprid-treated larvae had higher mortality than acetone-treated larvae both when kept at 43 °C for 4 h (t28 = −2.8, P = 0.0093) and for 5.2 h (t28 = 4.67, P < 0.0001). At 25 °C, the imidacloprid treatment did not significantly influence the mortality (t28 = -1.78, P = 0.0720).
Both Ldec_HSP70 primers detected induction of Hsp70; however, Hsp70 expression detected by Ldec_HSP70_F2R2 was very low ( 0.2).
Discussion Exposure to imidacloprid and temperature were significant stress factors for the Colorado potato beetle larvae, as evidenced by both mortality and Hsp70 expression. The two factors also interacted with each other, with more larvae dying when the two were acting simultaneously. At the optimal temperature of 25 °C, imidacloprid exposure did not have a significant effect on larval mortality, confirming that the chemical was indeed applied at a sublethal concentration. Hsp70 expression in the treated larvae was elevated by about 2 fold, which might have been at least partially responsible for the lack of a detectable increase in mortality of exposed individuals under the optimal temperature conditions. Induction of Hp70 by a variety of toxins is fairly common among insects (Yoshimi et al., 2002; Lee et al., 2006; Sonoda & Tsumuki, 2007), and may be important for reducing their impacts on cell function (Sørensen et al., 2003). However, induction of Hsp70 by imidacloprid observed in the present study was very low compared to its induction by the heat (ca. 2 fold vs. ca. 900 fold; Fig. 2). At the extreme temperature of 43 °C, exposure to a sublethal dose of imidacloprid resulted in a significant rise in larval mortality, which was not observed at 25 °C. Heat-stressed larvae also failed to respond to imidacloprid by producing more Hsp70. On the contrary, Hsp70 expression in the treated larvae appeared to be reduced compared to the untreated larvae. Due to the high variation in protein expression, imidacloprid effects were not statistically significant when analyzed separately for each duration of exposure. Nevertheless, the numeric reduction in the relative expression values was almost 2 fold, from ca. 900 to ca. 500 (Fig. 2), suggesting that a combined action of the two stressors overwhelmed physiological defenses of the affected beetles. Alternatively, some of the decline could have been attributed to RNA degradation in larvae dying early during the exposure period. However, we were targeting short (80 bp) region located near 3 end of the transcript. Therefore, we are certain in robust detection of short fragments of transcripts even with partial degradation. Our findings are consistent with a number of earlier studies that investigated both potentiation of toxicity by ambient temperature, as well as effects of heat shock (sudden, temporary, and extreme temperature) on toxicity. For example, Muturi et al. (2011) reported the negative effects C 2014
Institute of Zoology, Chinese Academy of Sciences, 00, 1–7
5
of being reared at high temperature on the survivorship to adulthood in larvae of the Asian tiger mosquito, Aedes albopictus (Skuse) (Diptera: Culicidae) after treatment with a low concentration of an organophosphate insecticide malathion. For the light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), heat shock created by short-term increases in temperature from 20 to 45 °C had significant negative effects on the larval survivorship during the ethanol immersion (Dentener et al., 2000). Similarly, increasing temperature from 23 to 30 °C for 24 h resulted in a significantly higher mortality of the cowpea weevil, Callosobruchus maculates (Fabr.) (Coleoptera: Bruchidae) along the gradient of increasing malathion concentrations (Gbaye & Holloway, 2011; Gbaye et al., 2012). In the Colorado potato beetle, 4 different pyrethroid insecticides showed decreases in toxicity when the beetles were maintained between 14 and 30 °C, but increases between 30 and 35 °C (Grafius, 1986). As in this study, higher beetle mortality likely resulted from the simultaneous effects of two different stressors. The effects observed in our study were different from the effects reported in situations when chemical and thermal stressors were acting one after another. In the experiments by Patil et al. (1996), adaptive cross-tolerance to a carbamate insecticide propoxur was induced in 4thinstar larvae of mosquitoes Anopheles stephensi Liston and Aedes aegypti (L.) (Diptera: Culicidae) by preexposing them to high but sublethal temperatures. Preexposure to sublethal concentrations of propoxur was also found to confer cross-tolerance to heat, but to a lower extent. Similarly, Ge et al. (2013) reported enhanced thermotolerance and upregulation of Hsp70 in the brown planthoppers, Nilaparvata lugens St˚al (Hemiptera: Delphacidae), preexposed to sublethal concentrations of an organophosphate insecticide triazophos. So, while concurrent exposure to otherwise sublethal insecticides and heat may lead to a failure to maintain homeostasis and subsequent death of affected organisms, sequential exposure may result in the priming of physiological defenses and improved survivorship. However, exact outcomes are likely to vary depending on chemicals and species involved, as well as on potential mechanisms of resistance to insecticides. Higher susceptibility of heat-stressed beetles to insecticides generally supports using propane flamers as a rescue treatment when chemical control begins to fail due to resistance development. Although field rates of applied chemicals may no longer be sufficient to kill the exposed beetles under optimal temperature conditions, they may reduce the probability of resistant beetles surviving the heat shock. Our results also highlight the importance of taking environmental conditions into
6
J. Chen et al.
consideration when evaluating efficiency of chemical control. However, Petri dish confinement did not allow behavioral escape from unfavorable surroundings that is widely observed in the Colorado potato beetles in more natural settings (Alyokhin et al., 2013). Therefore, additional investigations are needed before developing practical control recommendations. Acknowledgments We thank Jonathon Bogacki, Victoria Calabrase, and Marina Mann for technical assistance, and Frank Drummond for providing advice on statistical analyses. The project was funded in part by the USDA-CSREES-NRI Award No. 2009–35505–06004.This is Publication No. 3399 of the Maine Agricultural and Forest Experiment Station. Disclosure The authors have no conflicts of interest.
References Alyokhin, A., Baker, M., Mota-Sanchez, D., Dively, G. and Grafius, E. (2008) Colorado potato beetle resistance to pesticides. American Journal of Potato Research, 85, 395–413. Alyokhin, A., Udalov, M. and Benkovskaya, G. (2013) The Colorado potato beetle. Insect Pests of Potato: Global Perspectives on Biology and Management (eds. P. Giordanengo, C. Vincent & A. Alyokhin), pp. 11–29. Academic Press, Oxford, UK. Arias-Est´evez, M., L´opez-Periago, E., Mart´ınez-Carballo, E., Simal-G´andara, J., Mejuto, J.-C. and Garc´ıa-R´ıo, L. (2008) The mobility and degradation of pesticides in soils and the pollution of groundwater resources. Agriculture, Ecosystems & Environment, 123, 247–260. Baker, M.B., Alyokhin, A., Porter, A.H., Ferro, D.N., Dastur, S.R. and Galal, N. (2007) Persistence and inheritance of costs of resistance to imidacloprid in Colorado potato beetle. Journal of Economic Entomology, 100, 1871–1879. Burton, V., Miitchell, H.K., Young, P. and Petersen, N.S. (1988) Heat shock protection against cold stress of Drosophila melanogaster. Molecular and Cellular Biology, 8, 3350– 3552. Chen, C.P., Denlinger, D.L. and Lee, R.E. (1987) Cold-shock injury and rapid cold hardening in the flesh fly Sarcophaga crassipalpis. Physiological Zoology, 60, 297–304. Chen, J., Alyokhin, A., Mota-Sanchez, D., Baker, M. and Whalon, M. (2014) Variation in fitness among geographically isolated Colorado potato beetle (Coleoptera: Chrysomelidae)
populations. Annals of the Entomological Society of America, 107, 128–135. Conover, W.J. and Iman, R.L. (1981) Rank transformations as a bridge between parametric and nonparametric statistics. American Statistician, 35, 124–129. Daugaard, M., Rohde, M. and J¨aa¨ ttel¨a, M. (2007) The heat shock protein 70 family: highly homologous proteins with overlapping and distinct functions. FEBS Letters, 581, 3702– 3710. de Winter, J.C.F. (2013) Using the Student’s t-test with extremely small sample sizes. Practical Assessment, Research & Evaluation, 18(10), 1–12. Available online: http://pareonline.net/ getvn.asp?v=18&n=10. Accessed on June 17, 2014. Denlinger, D.L., Lee, R.E., Yocum, G.D. and Kukal, O. (1992) Role of chilling in the acquisition of cold tolerance and the capacitation to express stress proteins in diapausing pharate larvae of the gypsy moth, Lymantria dispar. Archives of Insect Biochemistry and Physiology, 21, 271–280. Dentener, P.R., Lewthwaite, S.E., Bennett, K.V., Maindonald, J.H. and Connolly, P.G. (2000) Effects of temperature and treatment conditions on the mortality of Epiphyas postvittana (Lepidoptera: Tortricidae) exposed to ethanol. Journal of Economic Entomology, 93, 519–525. Ferro, D.N., Logan, J.A., Voss, R.H. and Elkinton, J.S. (1985) Colorado potato beetle (Coleoptera: Chrysomelidae) temperature-dependent growth and feeding rates. Environmental Entomology, 14, 343–348. Gbaye, O.A. and Holloway, G.J. (2011) Varietal effects of cowpea, Vigna unguiculata, on tolerance to malathion in Callosobruchus maculatus (Coleoptera: Bruchidae). Journal of Stored Products Research, 47, 365–371. Gbaye, O.A., Millard, J.C. and Holloway, G.J. (2011) Legume type and temperature effects on the toxicity of insecticide to the genus Callosobruchus (Coleoptera: Bruchidae). Journal of Stored Products Research, 47, 8–12. Gbaye, O.A., Holloway, G.J. and Millard, J.C. (2012) Synergistic effects of geographical strain, temperature and larval food on insecticide tolerance in Callosobruchus maculatus (F.). Journal of Applied Entomology, 136, 282–291. Ge, L.Q., Huang, L.J., Yang, G.Q., Song, Q.S., Stanley, D., Gurr, G.M. and Wu, J.C. (2013) Molecular basis for insecticideenhanced thermotolerance in the brown planthopper Nilaparvata lugens St˚al (Hemiptera: Delphacidae). Molecular Ecology, 22, 5624–5634. Grafius, E. (1986) Effects of temperature on pyrethroid toxicity to Colorado potato beetle (Coleoptera: Chrysomelidae). Journal of Economic Entomology, 79, 588–591. Guthrie, F.E. (1950) Effect of temperature on toxicity of certain organic insecticides. Journal of Economic Entomology, 43, 559–560. Hiiesaar, K., Metspalu, L., Joudu, J. and Jogar, K. (2006) Over-wintering of the Colorado potato beetle (Leptinotarsa
C 2014 Institute of
Zoology, Chinese Academy of Sciences, 00, 1–7
Heat and imidacloprid on Colorado potato beetle decemlineata Say) in field conditions and factors affecting its population density in Estonia. Agronomy Research, 4, 21–30. Huang, L.H., Wang, C.Z. and Kang, L. (2009) Cloning and expression of five heat shock protein genes in relation to cold hardening and development in the leafminer, Liriomyza sativae. Journal of Insect Physiology, 55, 279–285. Jiang, X.F., Zhai, H.F., Wang, L., Luo, L.Z., Sappington, T.W. and Zhang, L. (2012) Cloning of the heat shock protein 90 and 70 genes from the beet armyworm, Spodoptera exigua, and expression characteristics in relation to thermal stress and development. Cell Stress and Chaperones, 17, 67–80. Khelifi, M., de Ladurantaye, Y. and Lague, C. (2007) Physical control of Colorado potato beetle: A review. Applied Engineering in Agriculture, 23, 557–569. Lee, S.-M., Lee, S.-B., Park, C.-H. and Choi, J. (2006) Expression of heat shock protein and hemoglobin genes in Chironomus tentans (Diptera, Chironomidae) larvae exposed to various environmental pollutants: A potential biomarker of freshwater monitoring. Chemosphere, 65, 1074–1081. Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2− CT method. Methods, 25, 402–408. Logan, P.A., Casagrande, R.A., Faubert, H.H. and Drummond, F.A. (1985) Temperature-dependent development and feeding of immature Colorado potato beetles, Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae). Environmental Entomology, 14, 275–283. Lyytinen, A., Mappes, J. and Lindstr¨om, L. (2012) Variation in Hsp70 levels after cold shock: Signs of evolutionary responses to thermal selection among Leptinotarsa decemlineata populations. PLoS ONE, 7(2), e31446. Mayer, F. and Ellersieck, M. (1986) Manual of Acute Toxicity: Interpretation and Data Base for 410 Chemicals and 66 Species of Freshwater Animals. U.S. Fish and Wildlife Service Research Publication, Washington, DC. Mururi, D.J., Lampman, R., Costanzo, K. and Alto, B.W. (2011) Effect of temperature and insecticide stress on life-history traits of Culex restuans and Aedes albopictus (Dipera: Culicidae). Journal of Medical Entomology, 48, 243–250. Parsell, D.A. and Lindquist, S. (1993) The function of heatshock protein in stress tolerance: degradation and reactivation
C 2014
Institute of Zoology, Chinese Academy of Sciences, 00, 1–7
7
of damaged proteins. Annual Review of Genetics, 27, 437– 496. Patil, N.S., Lole, K.S. and Deobagkar, D.N. (1996) Adaptive larval thermotolerance and induced cross-tolerance to propoxur insecticide in mosquitoes Anopheles stephensi and Aedes aegypti. Medical and Veterinary Entomology, 10, 277– 282. Pelletier, Y., Mcleod, C.D. and Bernard, G. (1995) Description of sublethal injuries caused to the Colorado potato beetle (Coleoptera: Chrysomelidae) by propane flamer treatment. Journal of Economic Entomology, 88, 1203–1205. SAS Institute (2012) SAS English version 9.3. SAS Institute Inc., Cary, NC. Sørensen, J.G., Kristensen, T.N. and Loeschcke, V. (2003) The evolutionary and ecological role of heat shock proteins. Ecology Letters, 6, 1025–1037. Sonoda, S. and Tsumuki, H. (2007) Induction of heat shock protein genes by chlorfenapyr in cultured cells of the cabbage armyworm, Mamestra brassicae. Pesticide Biochemistry and Physiology, 89, 185–189. Sparks, T.C., Shour, M.H. and Wellemeyer, E.G. (1982) Temperature toxicity relations of pyrethroids on three Lepidopterans. Journal of Economic Entomology, 75, 634–646. Sparks, T.C., Pavloff, A.M., Rose, R.L. and Clower, D.F. (1983) Temperature-toxicity relationships of pyrethroids on Heliothis virescens (F.) (Lepidoptera: Noctuidae) and Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae). Journal of Economic Entomology, 76, 243–246. Yocum, G.D. (2001) Differential expression of two HSP70 transcripts in response to cold shock thermoperiod and adult diapause in the Colorado potato beetle. Journal of Insect Physiology, 47, 1139–1145. Yoshimi, T., Minowa, K., Karouna-Renier, N.K., Watanabe, C., Sugaya, Y. and Miura, T. (2002) Activation of a stress-induced gene by insecticides in the midge, Chironomus yoshimatsui. Journal of Biochemical and Molecular Toxicology, 16, 10–17. Zar, J.H. (1999) Biostatistical analysis. Prentice Hall, Upper Saddle River, New Jersey.
Accepted November 12, 2014
