J Antimicrob Chemother 2015; 70: 1993 – 2003 doi:10.1093/jac/dkv070 Advance Access publication 29 March 2015
The Rpd3/Hda1 family of histone deacetylases regulates azole resistance in Candida albicans Xiaofang Li1,2†, Qing Cai1–3†, Huan Mei1,2, Xiaowei Zhou1,2, Yongnian Shen1,2, Dongmei Li1,2,4 and Weida Liu1,2* 1
*Corresponding author. Tel: +86-025-85478982; Fax: +86-025-85414477; E-mail: [email protected] †These authors contributed equally to the article.
Received 25 October 2014; returned 6 January 2015; revised 9 February 2015; accepted 23 February 2015 Objectives: The histone deacetylase (HDAC) has recently been linked to the morphogenesis and virulence of yeast. However, the effects of HDAC on antifungal susceptibility are not well understood. We sought to characterize the action of histone deacetylation on azole resistance in Candida albicans and its possible mechanism of action. Methods: A total of 40 C. albicans strains were studied. Azole susceptibility with or without trichostatin A (TSA) was determined according to the CLSI microdilution method. The null mutants of HDA1 and RPD3 (genes targeted by TSA) were also investigated using drop-plate assays and a rapid acquisition of adaptation to the azole test. Transcriptional levels of HDAC genes and efflux genes were quantified using RT – PCR for both the basal and fluconazole-induced conditions. Results: The inhibition of HDACs by TSA (0.25 mg/L) markedly reduced the trailing growth and the growth of most C. albicans strains. Trailing growth for C. albicans strains was decreased from 2-fold to 256-fold at 48 h. The deletion of HDA1 or RPD3 increased the susceptibility to azoles compared with the WT strain. The expression of HDA1 and RPD3 was up-regulated to different levels, and returned to the level of the susceptible parental strain when stable resistance had formed during the course of acquired fluconazole resistance both in vitro and in vivo. Efflux genes were poorly expressed in mutant strains compared with those of the WT strain. Conclusions: Our results indicate the important role of the Rpd3/Hda1 family in the development of azole resistance in C. albicans. Histone deacetylation may govern the expression of genes related to the early stages of adaptation to azole stress, such as efflux pump genes. Keywords: C. albicans, histone deacetylation, histone deacetylase inhibitors, trichostatin A
Introduction Candida albicans is the most important pathogenic fungus seen in superficial and invasive infections. The mortality linked to invasive candidiasis remains very high, especially in immunocompromised patients such as ICU patients, AIDS patients or patients undergoing cancer therapy.1,2 Therapies for fungal diseases include, among others, azoles, echinocandins, allylamines and polyenes. Among these antifungals, azoles are the most commonly used in the management of candidiasis. As a result of the wide application of azoles as the sole agents of treatment, resistance is easily developed in clinical Candida isolates. It has been confirmed that resistance to first-line therapy is associated with higher mortality than susceptibility to first-line treatments.3 A number of physiological
attributes of yeast have been associated with azole resistance mechanisms, such as transport alterations (CDR, MDR and FLU), target alterations by mutations and gene up-regulation (ERG), the utilization of compensatory pathways and the presence of complex multicellular structures (biofilms). All of these are related to the abnormal expression of certain genes.4 – 6 One of the difficulties when working with fungistatic drugs, such as azoles, in vitro is the phenomenon of trailing growth. Trailing growth is defined as a reduced, but persistent, growth of some Candida isolates at higher drug concentrations, particularly with fluconazole and itraconazole. Drug concentrations for trailing growth can be exhibited over an extended concentration range.7 According to Lee et al.,8 only 0.35% (4/1137) of isolates presented with susceptible MICs after 24 h of incubation, but resistant MICs
# The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: [email protected]
1993
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
Department of Medical Mycology, Institute of Dermatology, Chinese Academy of Medical Science and Peking Union Medical College, Nanjing, Jiangsu, People’s Republic of China; 2Jiangsu Key Laboratory of Molecular Biology for Skin Diseases and STIs, Nanjing, Jiangsu, People’s Republic of China; 3Fungal Reference Laboratory, Shanghai Dermatology Hospital, Shanghai, People’s Republic of China; 4 Department of Microbiology & Immunology, Georgetown University Medical Center, Washington, DC, USA
Li et al.
Table 1. Genotypes of mutant strains used in this study Strain WO-1 HDho15 RPho3
Relevant genotype
Reference
WT ade2/ade2,Dura3::ADE2/Dura3::ADE2, Dhda1::CAT/Dhda1::hisG-URA3-hisG ade2/ade2,Dura3::ADE2/Dura3::ADE2, Drpd3::hisG/Drpd3::hisG-URA3-hisG
29 29 29
phenotype.23 Compared with the rapidly accumulating knowledge on the mechanisms of HDACs in cancer and cancer treatment, much less is known about their specific roles in fungal disease. Hst3p is a member of the sirtuin family whose inhibition by nicotinamide leads to cytotoxic effects in C. albicans. Wurtele et al. 24 have demonstrated in both molecular and in vivo experiments that an inhibition of Hst3p can sensitize C. albicans to antifungal agents by the deacetylation of H3K56ac. A few studies have shown that non-specific HDACIs against Class I and Class II HDACs can increase the activities of sterol biosynthesis inhibitors, such as TSA, apicidin and MGCD290, against C. albicans in vitro.25 – 27 However, the specific HDACs involved in azole resistance and the characteristics of their actions still need to be demonstrated. A similar picture exists for both fungi and cancer cells with regard to multidrug resistance mechanisms, for example the overexpression of efflux pumps.28 Given the results summarized from these previous studies, we hypothesized that HDACs were likely to govern drug resistance in C. albicans by regulating efflux pump functions or other as yet undefined mechanism(s). Here we attempt to discover the roles of histone deacetylation in the development of drug tolerance in C. albicans.
Materials and methods Strains and media Twenty-two clinical isolates of C. albicans were obtained from Institute of Dermatology, Chinese Academy of Medical Sciences, Jiangsu Province Hospital and Shandong Qilu Hospital. Among these strains, SRY535-60 was used to induce resistance in vitro. C. albicans ATCC 44505, ATCC 62342, ATCC 64550, ATCC 90028, Candida parapsilosis ATCC 22019 and Candida krusei ATCC 6258 were all obtained from the ATCC. WT strain WO-1 and HDAC mutant strains (HDho15 and RPho3) were gifts from D. R. Soll (Department of Biology, University of Iowa). HDho15 (hda1D_/D) and RPho3 (rpd3D_/D) were maintained on agar containing modified Lee’s medium. The phenotypic studies conducted by Dr Soll’s group indicated that HDho15 accelerated white-to-opaque switching, while RPho3 also increased opaque-to-white switching.29 The genotypes of these three strains are listed in Table 1. Strains Ca2-76, Ca2-79, Ca2-85, Ca8-44, Ca8-46 and Ca12-99 were obtained from T. White (School of Biological Sciences, Marion Merrell Dow, University of Missouri-Kansas City). These strains were isolated from an HIV patient with a 2 year history of fluconazole treatment. During the course of therapy, the patient experienced discontinuous oral candidiasis and was treated with increasing doses of fluconazole. Thus, these strains were considered as having acquired azole resistance in vivo.30,31 The azole susceptibilities and established resistance mechanisms of each strain are described in Table 2. The clinical isolates were all
Table 2. MICs for and resistance mechanism of White’s strains CLSI MICs (mg/L) Strain Ca2-76 Ca2-79 Ca2-85 Ca8-44 Ca8-46 Ca12-99
1994
fluconazole itraconazole voriconazole 0.25 1 8 16 16 .64
0.03 0.03 0.03 0.18 0.5 1
0.03 0.03 0.03 0.03 0.125 1
Resistance mechanism31,35 unknown unknown unknown R467K mutation; loss of allelic variation of ERG11(16); and ERG11(16) and MDR1 increased R467K mutation; loss of allelic variation of ERG11(16); and ERG11(16) and MDR1 increased R467K mutation; loss of allelic variation of ERG11(16); and ERG11(16), CDR1 and MDR1 increased
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
after 48 h of incubation. The mechanism of trailing growth in C. albicans is still unknown, but the up-regulation of resistance genes on drug exposure has been suggested as a mechanism.9 Histone deacetylases (HDACs) are a family of significant enzymes that act to deacetylate lysines in histones, transcription factors, signal transduction proteins and other cellular proteins. This gene family is conserved between humans and yeast.10 – 12 HDACs can be grouped into the Rpd3/Hda1 family and the sirtuin family in yeast according to sequence homology and phylogenetic analysis. The Rpd3/Hda1 family belongs to the ‘classical’ zincdependent HDACs. Rpd3 and Hda1 are founding members of the Class I and Class II HDACs, respectively. Class I HDACs are mainly located within the nucleus and play an important role in cell survival and proliferation. Class II HDACs shuttle between the nucleus and the cytoplasm in response to certain cellular signals and possibly have tissue-specific roles. The sirtuin family, described in 2000, belongs to Class III HDACs and is NAD+ dependent. Inhibitors of ‘classical’ HDACs are commonly referred to as HDAC inhibitors (HDACIs). HDACIs can block angiogenesis, arrest cell growth and lead to differentiation and apoptosis in tumour cells.13,14 Class I and Class II HDACs (the Rpd3/Hda1 family) can be inhibited by the classical, non-selective inhibitor trichostatin A (TSA). This is the first natural product of hydroxamate and has the ability to directly inhibit HDACs in both mammalian and yeast cells in vitro.15 – 17 It has been recognized that HDACIs have great potential for treating cancers, immunological diseases and other conditions. A number of compounds that target the Rpd3/Hda1 family are currently under clinical evaluation or have been used in cancer therapy.18 – 21 A recent survey of drug resistance in cancer cells showed that an inhibition of HDAC activity could prevent the development of drug resistance.22 One study has also identified IGFR1 (insulin-like growth factor receptor 1) signalling and histone modification as being critical to the adoption of a drug-tolerant
JAC
Rpd3/Hda1 family regulates azole resistance
identified by standard mycological and molecular tests. All strains were typically preserved in and subsequently subcultured on yeast extract/peptone/ dextrose (YPD; 1% yeast extract/2% peptone/2% dextrose) broth.
HDACIs and antifungals TSA, fluconazole, itraconazole and voriconazole were all purchased from Sigma-Aldrich Co. LLC. These drugs were prepared following the manufacturer’s directions. TSA was diluted in ethanol to 1 mg/L. Fluconazole was diluted in sterile water to 1.28 mg/L. Itraconazole and voriconazole were diluted in DMSO and sterile water to 1.28 mg/L.
Azole susceptibilities without TSA for C. albicans clinical strains were determined following the CLSI M27-A3 method.32 Fresh overnight cultures were prepared in YPD medium and then diluted in RPMI-1640 and counted using a haemocytometer to 104 cells/mL. Final concentrations for each antifungal agent were as follows: for fluconazole, a range of 64 mg/L to 0.125 mg/L, and for itraconazole and voriconazole, a range of 16 mg/L to 0.03 mg/L. The plates were incubated at 358C in boxes to minimize evaporation. The MIC values for and growth of C. albicans were evaluated visually and by reading the absorbance at 630 nm in a microplate reader after both 24 and 48 h of incubation. The MIC was defined as the lowest concentration of drug that caused a prominent decrease (≥50% inhibition) in visible growth relative to that of the growth control. Trailing growth was defined as a reduced, but persistent, growth of Candida isolates at drug concentrations above the MIC after 48 h of incubation. Results for trailing growth were evaluated as the ratio of the highest concentration without fungal growth at 48 h to the MIC at 24 h. Interpretive breakpoints were determined in line with CLSI M27-S4.33 C. krusei ATCC 6258 and C. parapsilosis ATCC 22019 were used as quality controls. All tests were performed in triplicate and repeated on another day.
Drop-plate assays with azoles The susceptibilities of WT strain WO-1 and the mutant strains (HDho15 and RPho3) to azoles were also tested by drop-plate assays. C. albicans cells were obtained from fresh cultures in YPD medium and counted using a haemocytometer. We then plated 5 mL of serial dilutions of 1×105 to 1×100 cells onto YPD agar plates with or without an azole. The concentrations of fluconazole, itraconazole and voriconazole were 64 mg/L, 16 mg/L and 2 mg/L, respectively. The cultures were incubated at 308C for 48 h. The rapid acquisition of adaptation to azoles was also tested for the three strains mentioned above. Yeast cells were grown overnight in Sabouraud dextrose agar (SDA) medium and a colony was transferred into fresh YPD broth for an additional 4– 5 h of growth. Each 100 mL aliquot of fresh culture containing 104 cells was then plated onto YPD agar with or without azole. The final drug concentrations in the agar plates were 128 mg/L for fluconazole, 32 mg/L for itraconazole and 32 mg/L for voriconazole. The plates were incubated at 308C for 8 days and the colony counts for each strain were determined after 5 and 8 days.
Induction of resistant strains Induction of resistance was accomplished with an azole-susceptible C. albicans strain SRY535-60 by incrementally increasing the concentrations of fluconazole as previously described.34 The initial medium for induction contained twice the MIC of fluconazole for SRY535-60. The single colony of SRY535-60 was first incubated in SDA medium at 308C and yeast cells were transferred onto fresh medium when the cell density reached 108 cells/mL. Isolates from each passage were tested using CLSI
Primer
Sequence (5′ 3′ )
Origin
Product size (bp)
ACT1-F ACT1-R HDA1-F HDA1-R RPD3-F RPD3-R CDR1-F CDR1-R CDR2-F CDR2-R MDR1-F MDR1-R FLU1-F FLU1-R
ACTACCATGTTCCCAGGTATTG CCACCAATCCAGACAGAGTATT GCACGACGGTGATTATGTTTATG GCAGCATCAAATCCAGAACTAAC GAGTGCCCGTGATGGTATTAG CCATTGCAAACTCCGGTTTC ACTCCTGCTACCGTGTTGTTATTG ACCTGGACCACTTGGAACATATTG CTGTTACAACCACTATTGCTACTG TACCTTGGACAACTGTGCTTC GGTGCTGCTACTACTGCTTCTG TGATGAAACCCAACACGGAACTAC CGTCATTGGTGCTGCATTTG AGGCAGTGGCTGCATATAAC
XM_717118.1
122
XM_713178.1
102
XM_710672.1
88
Yu et al.50
192
Yu et al.50
297
Yu et al.50
226
XM_715807.1
101
methodology until resistance to fluconazole occurred. We then collected the series of isolates for further experiments.
Quantification of gene expression by RT– PCR One-step RT – PCR was performed on an Agilent MX3000P real-time PCR machine (Agilent, America) according to the manufacturer’s instructions. Primers were synthesized by Shanghai Samgon Biotech Co. Ltd and are listed in Table 3. The primers were tested to minimize primer-dimer and other PCR artefacts. Yeast cells were harvested from 24 h YPD cultures and total RNA was extracted using Trizol and acid-washed glass beads. The qRT – PCR was performed in 25 mL reaction volumes containing 500 ng of C. albicans RNA, 5 pmol of each forward and reverse primer, 0.375 mL of the reference dye, 1 mL of block enzyme mix and 12.5 mL of Brilliant SYBR Green qRT– PCR Mix (Agilent). Amplification was carried out under the following conditions: 508C for 30 min, 958C for 10 min, 40 cycles of 958C for 30 s, followed by 608C for 1 min. The dissociation curves were produced as follows: the temperature was elevated to 958C for 1 min, ramped down to 558C, and then ramped up again to 958C, and fluorescence data were continuously collected during the ramp from 558C to 958C. The dissociation curves were analysed to ensure that there was no non-target amplification. Gene expression was analysed using the 2-△△Ct method, with ACT1 as the reference gene.
Statistical analysis In vitro susceptibility tests involving azoles alone were compared with tests involving azoles plus TSA using the Student’s t-test. All tests were two-tailed and P≤ 0.05 was considered statistically significant. The SPSS statistical software program (version 13.0 for Windows; SPSS Inc., Chicago, IL, USA) was used to perform all the analyses.
Results Susceptibility of C. albicans to azole antifungals and effects of TSA on azole activities against C. albicans First, we determined the susceptibility baselines of all C. albicans strains to three azoles in vitro. According to the CLSI M27-S4 breakpoints for the yeast microdilution method, of the 26 C. albicans strains (the clinical and ATCC strains mentioned
1995
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
Antifungal susceptibility testing
Table 3. Primers for qRT–PCR analysis
Li et al.
Fluconazole
Table 4. Susceptibility of C. albicans to azoles (mg/L) Itraconazole
Voriconazole
0.5 4 32 0.125 0.125 4 32 1 0.125 2 1 0.5 0.5 0.125 1 0.5 1 0.5 1 0.5 0.5 1 0.125 0.125 0.125 0.25
0.03 0.25 1 0.03 0.03 0.25 1.41 0.125 0.06 0.125 0.03 0.25 0.25 0.03 0.25 0.25 0.25 0.125 0.125 0.25 0.03 0.125 0.03 0.03 0.03 0.03
0.03 0.25 0.25 0.03 0.03 0.25 1.41 0.125 0.03 0.25 0.25 0.06 0.06 0.03 0.125 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03
0.8
0.6
0.4
0.2
0.0 0 0.125 0.25 0.5
1
2
4
8
16
32
64
Fluconazole concentration (mg/L) Itraconazole (b) 1.0
0.8
0.6
0.4
0.2
a
Twenty-two clinical strains (including the original isolate of SRY535-60) and four ATCC strains.
0.0 0
1996
1
2
4
8
16
8
16
Itraconazole concentration (mg/L) Voriconazole (c) 1.0
0.8 Absorbance (630 nm)
above), 15 strains were susceptible to all three azoles, 6 strains were dose-dependently susceptible to itraconazole, 1 strain was dose-dependently susceptible to voriconazole and 3 strains were dose-dependently susceptible to all three azoles. As shown in Table 4, the resistant controls ATCC 64550 and PYS2958 were resistant to fluconazole (MICs of 32 mg/L and 32 mg/L, respectively), resistant to itraconazole (MICs of 1.0 mg/L and 1.41 mg/L, respectively) and dose-dependently resistant to voriconazole, respectively (MICs of 0.25 mg/L and 1.41 mg/L, respectively). All the C. albicans strains tested in this study exhibited variable degrees of trailing growth in azole concentrations above the MICs, as previously reported. Representative of this, the trailing growth of PYS2958 is shown in Figure 1, in which the absorbance values of this strain were seen to increase at 48 h compared with the results at 24 h, even above the MIC values. We next tested whether the inhibition of HDAC functions by TSA would reduce azole resistance in C. albicans. For TSA-treated cultures, the final concentration of TSA (0.25 mg/L) was determined by the microdilution method in our preliminary experiment. At this concentration, each C. albicans strain that was tested retained over 90% of its yeast cell growth. There was no significant difference between two groups in terms of CLSI MIC results (P .0.05). However, the inhibition of HDACs with TSA markedly reduced the trailing growth (P, 0.05) and inhibited cell growth for most strains at 48 h. The effects of the inhibition of trailing growth by TSA for all
0.03 0.06 0.125 0.25 0.5
0.6
0.4
0.2
0.0 0
0.03 0.06 0.125 0.25 0.5
1
2
4
Voriconazole concentration (mg/L) Figure 1. Effects of TSA on azole activities and growth of the resistant strain PYS2958 determined by the broth microdilution method. (a) Fluconazole, (b) itraconazole or (c) voriconazole with (triangles) or without (squares) 0.25 mg/L TSA. Candida cells were incubated for 24 h (open symbols) or 48 h (filled symbols).
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
ATCC 44505 ATCC 62342 ATCC 64550 ATCC 90028 PYS2270 PYS2825 PYS2958 PYS3061 PYS3066 PYS3089 PYS3161 PYS3216 PYS3248 PYS3313 PYS3315 PYS3343 PYS7807 SD4263 SD4266 SD592 SDGZ03 SDGZ15 SRY547-57 SRY551-57 SRY554-72 SRY535-60 (535-1)
Fluconazole
Absorbance (630 nm)
Isolatea
Absorbance (630 nm)
(a) 1.0
JAC
Rpd3/Hda1 family regulates azole resistance
Effects of HDA1 and RPD3 deletion on activities of azoles against C. albicans In order to further clarify the roles of HDAC genes in azole susceptibility, the WT strain and mutant strains were analysed by dropplate assays and rapid adaptation tests. In comparison with the WT strain WO-1, HDho15 and RPho3 were hypersensitive on drop-assay plates supplemented with 64 mg/L fluconazole, 16 mg/L itraconazole and 2 mg/L voriconazole, respectively (Figure 3). The C. albicans WT strain and HDA1 and RPD3 deletion mutant strains were also tested in vitro for their susceptibilities to fluconazole, itraconazole and voriconazole using the M27-A3 method. The mutant strains with a deletion of HDA1 or RPD3 showed reduced cell growth at 24 and 48 h. Compared with the WT strain, the deletion of HDA1 resulted in a 16-fold reduction of trailing growth with fluconazole, a 267-fold reduction with itraconazole and a 128-fold reduction with voriconazole. The deletion of RPD3 resulted in a 267-fold reduction in trailing growth with itraconazole and a 128-fold reduction with voriconazole (data not shown). A rapid acquisition of adaptation has been detected in WT C. albicans when a great number of yeast cells were cultured in high concentrations of azoles. In contrast, this adaptability to azoles was markedly reduced in HDAC gene mutant strains. At a high concentration of fluconazole (128 mg/L), itraconazole (32 mg/L) or voriconazole (32 mg/L), adaptation occurred by 5 – 8 days in WO-1. However, HDho15 and RPho3 mutants failed to grow in the presence of high azole concentrations in the same cycle (Figure 4). These results imply that the HDAC genes HDA1 and RPD3 may regulate azole resistance in C. albicans.
Gene expression of clinical C. albicans and mutant strains The expression levels of the HDAC genes (HDA1 and RPD3) and efflux genes (CDR1, CDR2, MDR1 and FLU1) were determined by RT–PCR. There was no correlation between the basal expression
of the HDAC genes and the susceptibilities of C. albicans in terms of either the type of azole or the enhancing effects of TSA on inhibition (data not shown). However, the efflux genes CDR1, CDR2, MDR1 and FLU1 were poorly expressed in the HDho15 and RPho3 strains, with expression levels that were typically ,50% that of the WT strain (Figure 5).
Analysis of HDAC genes and efflux genes in induced C. albicans strains Given the enhanced inhibitory effects of TSA on C. albicans strains, we next tested changes in the expression of HDA1 and RPD3 during the development of acquired azole resistance. A series of fluconazole-resistant strains, which were obtained from a fluconazole-susceptible strain SRY535-60 through serial cultures with inhibitory concentrations of fluconazole, was evaluated for the expression of both HDAC and efflux genes. As shown in Figure 6, the expressions of HDA1 and RPD3 were up-regulated to various levels with increased MICs, but returned to the level seen in the susceptible parental strain as stable resistance formed during the course of acquired fluconazole resistance. The highest expression levels were observed in the early or middle stage of induction of resistance; e.g. HDA1 was induced 5-fold in the presence of fluconazole when the MIC increased to 8-fold that for the original parental strain, and RPD3 was induced 10-fold when the MIC increased 16-fold (Figure 6). Of the efflux genes, CDR2 and MDR1 were up-regulated to different levels by fluconazole exposure when compared with the susceptible parental strain, but the transcription levels of CDR1 and FLU1 showed no obvious changes (Figure 6). The gene expressions of HDA1 and RPD3 were also assessed in a series of in vivo isolates with acquired resistance that were collected from clinical specimens of a single HIV patient who was treated with fluconazole for 2 years. Genetic studies had confirmed that the MICs for these strains increased in correlation to the overexpression of ERG11(16), CDR and MDR1.35 The mutation in ERG11(16) and loss of heterozygosity were also linked to their modes of resistance within this group of resistant strains.31 We found similar changes in the levels of expression of the HDAC genes HDA1 and RPD3 in these strains when compared with induced SRY535-60 strains (Figure 6). The levels of expression of HDA1 increased 7-fold as the MIC increased to 32-fold that for the original parental strain. Similarly, RPD3 was induced 4-fold when the MIC increased 64-fold (Figure 7). Interestingly, an earlier peak of HDA1 was observed in both series of C. albicans strains compared with RPD3.
Discussion Epigenetics is defined as heritable changes in gene expression that are not based on alterations in the DNA sequence. The major mechanisms involved in epigenetics are histone acetylation and deacetylation, which are reversible processes controlled by histone acetyltransferase and HDAC. Epigenetics plays an important role in eukaryotic gene regulation. High HDAC activity could result in transcriptional repression and gene silence.36 – 38 A number of studies have indicated that epigenetics has an indispensable role in the virulence and morphogenesis of yeast. Rpd3, Hda1 and Set3/Hos2 have been linked to the modulation of
1997
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
the tested strains (WT and mutant strains were excluded) are presented in Figure 2. Eighteen strains showed enhancing effects of TSA when tested with fluconazole, 15 with itraconazole and 14 with voriconazole (mutant and induction strains were not included). Based upon the degree of trailing growth, we divided the 26 strains into two groups. Strains in Group A (16 strains) exhibited trailing growth over the highest drug concentration, whereas Group B (10 strains) exhibited trailing growth in the concentration range that was tested. Enhancing effects of inhibition were shown in both groups, particularly in Group A. In Group A, the addition of TSA lessened the trailing growth of C. albicans strains even at 256-fold the MIC at 48 h (Figure 2). The series of C. albicans isolates collected from a single patient with HIV were also tested for the effectiveness of TSA. Using the CLSI M27-S4 method, Ca2-76 and Ca2-79 were fluconazolesusceptible strains and Ca2-85, Ca8-44, Ca8-46 and Ca12-99 were fluconazole-resistant strains with gradually increasing MICs. Increasing effects in terms of inhibition were observed only in azolesusceptible strains, but not in persistently resistant strains even if the concentration of TSA rose to 1 mg/L (Figure 2). The azole-resistant strains PYS2958 and ATCC 64550 showed no inhibition of trailing growth, but a clear reduction in cell growth occurred after the addition of TSA (Figure 1).
Li et al.
FLC
FLC + TSA
ITC
ITC + TSA
VRC
VRC + TSA
ATCC 64550
Clinical azole-resistant strains of group Aa
PYS2958 PYS3161 PYS3248
Clinical azole-dose-dependent strains of group A
PYS3343 PYS7807 SD592
ATCC 90028 PYS2270 SD4263
Clinical azole-susceptible strains of group A
SD4266 SDGZ03 SDGZ15 SRY547-57 SRY551-57 ATCC 62342 PYS2825
Clinical azole-dose-dependent strains of group Bb
PYS3216 PYS3315 PYS3061 PYS3066 PYS3089
Clinical azole-susceptible strains of group B
PYS3313 SRY554-72 535-1(SRY535-60) 535-2 535-3
The series of strains induced in vitro
535-4 535-5 535-6 Ca2-76 Ca2-79 Ca2-85
The series of strains from an HIV-infected patient
Ca8-44 Ca8-46 Ca12-99 1
512
Trailingc Figure 2. Effects of TSA (0.25 mg/L) on trailing growth with azoles. The addition of TSA reduced the trailing growth of C. albicans strains from 2-fold to 256-fold at 48 h in different groups. aStrains in group A exhibited trailing growth above the highest drug concentration used in the study. bStrains in group B exhibited trailing growth in the drug ranges tested. cThe inhibition of trailing growth was evaluated by the ratio of the highest concentration with no sign of growth at 48 h to the MIC value at 24 h. FLC, fluconazole; ITC, itraconazole; VRC, voriconazole.
1998
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
ATCC 44505
JAC
Rpd3/Hda1 family regulates azole resistance
105
104
103
102
105
10
104
103
102
10
WO-1
HDho15
YPD medium
Fluconazole (64 mg/L)
Itraconazole (16 mg/L)
Voriconazole (2 mg/L)
WO-1
HDho15
RPho3
Figure 3. Azole susceptibility profiles of C. albicans WT WO-1 and mutant strains HDho15 (hda1D_/D) and RPho3 (rpd3D_/D) in drop-plate assays. Compared with WO-1, both mutants were more susceptible to fluconazole, itraconazole and voriconazole. The drug concentrations used are indicated in each panel.
200
Day 5 Day 8 Colony number (>1 mm)
150
100
50
0 WO-1
HDho15 FLC
RPho3
WO-1
HDho15 ITC
RPho3
WO-1
HDho15
RPho3
VRC
Figure 4. Rapid acquisition of adaptation to azoles in C. albicans strains. The mutant strain HDho15 was unable to grow in the presence of fluconazole and voriconazole, but was able to grow a few colonies in the presence of itraconazole by 8 days. The mutant RPho3 was unable to grow in the presence of itraconazole and voriconazole, but grew a small number of colonies in the presence of fluconazole by 8 days. The WT strain WO-1 acquired adaptation by 5 and 8 days following incubation for all three azoles. FLC, fluconazole; ITC, itraconazole; VRC, voriconazole.
1999
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
RPho3
Li et al.
Ca2-76 (0.25 mg/L)
WO-1
2.0
HDho15
Ca2-79 (1 mg/L) Ca2-85 (8 mg/L)
1.5
Ca8-44 (16 mg/L)
10
Ca8-46 (16 mg/L)
1.0
Ca12-99 (>64 mg/L)
8
0.0
CDR1
CDR2
MDR1
FLU1
Figure 5. Real-time PCR of efflux genes (CDR1, CDR2, MDR1 and FLU1) is shown for the WT and mutant strains. The expression levels of these genes were significantly reduced in both mutant strains HDho15 and RPho3, but not in the WT strain WO-1.
6
4
2
0
Relative expression
3
2
HDA1
535-1 (0.25 mg/L) 535-2 (2 mg/L) 535-3 (4 mg/L) 535-4 (16 mg/L) 535-5 (64 mg/L) 535-6 (64 mg/L)
Figure 7. Expression of the HDAC genes HDA1 and RPD3 during the course of acquired fluconazole resistance in vivo, with the MIC for each strain given in brackets. The series of C. albicans isolates came from an HIV-infected patient.
1
0
HDA1
RPD3
CDR1
CDR2
MDR1
FLU1
Figure 6. Expression of HDAC genes (HDA1 and RPD3) and efflux genes (CDR1, CDR2, MDR1 and FLU1) during the course of acquired fluconazole resistance in vitro, with the MIC for each strain given in brackets. The series of SRY535-60 isolates was induced using fluconazole in vitro.
spontaneous white and opaque switching frequencies in C. albicans. The evidence for this shows a dramatic increase in the frequency of switching from white to opaque in the absence of the HDA1/RPD3 gene or after the treatment of yeast cells with TSA. The involvement of HDACs in the pathogenicity of C. albicans has been hypothesized since reports that the adhesion of the fungus to epithelial cells and the transition from yeast to hypha were both inhibited by HDACIs. Such inhibition appeared less evident when an HDA1-deficient strain was tested.29,39 – 45 Smith and Edlind25 revealed that TSA could enhance the susceptibility of C. albicans to azoles and terbinafine in vitro. The addition of 3 mg/L TSA could lower the itraconazole MICs for five C. albicans strains by an average of 2.7-fold at 24 h; however, only a small number of strains were included in this study.25 Synergy or an enhancing effect was also identified for other HDACIs such as apicidin, MGCD290 and vorinostat (SAHA), some of these having an
2000
RPD3
antifungal function because of their chemical structure.26,27 Therefore, the relationship between histone deacetylation and azole resistance in C. albicans needs to be further evaluated. In the current study, we investigated whether histone deacetylation was associated with azole resistance in C. albicans. Compared with previous reports, a total of 40 C. albicans isolates with different genetic backgrounds were obtained from a variety of clinical sources, including two series of strains with acquired resistance – one in vitro and one in vivo. Three antifungal agents fundamental to modern therapy for candidiasis were evaluated in combination with TSA. In particular, the concentration of TSA in this study was much lower (0.25 mg/L) than is seen in other studies in order to rule out cytotoxicity caused by TSA. Overall enhancing effects for the clinical strains (mutant and induction strains were excluded) were noted in 84.6% (22/26) of the strains as trailing growth and cell growth decreased dramatically with TSA treatment (Figure 2). Such enhancing effects could be sustained over 72 h. TSA had less effect on the resistant strains (PYS2958, ATCC 64550 and Ca12-99) than the susceptible ones, suggesting a limitation of HDACIs in reversing azole resistance in C. albicans. Such a lack of effect of TSA for Ca12-99 may be associated with a resistance mutation in ERG11(16) and loss of heterozygosity. However, such an ERG11(16) mutation was not found in PYS2958 and ATCC 64550. Since the suppressant effect of TSA on histone deacetylation is non-selective,15,16 different mutant strains were used to determine which specific HDAC gene(s) were involved in the azole resistance. Our results showed that a deletion of HDA1 or RPD3, which encode an HDAC that is susceptible to TSA, increased azole susceptibility in both microdilution and drop-plate assays, and failed to show adaptation to azoles in vitro (Figures 3 and 4). Furthermore, both HDA1 and RPD3 showed elevated transcription levels during the acquisition of azole resistance in vitro and in vivo
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
0.5
Relative expression
Relative expression
RPho3
JAC
Rpd3/Hda1 family regulates azole resistance
including vorinostat, romidepsin and chidamide, have been used in clinical treatments or trials, with better responses being seen for haematological malignancies, cutaneous lymphomas and solid tumours.18 – 20 A prospective multicentre observational study in China showed that invasive Candida infection occurred in 0.32% of ICU patients, with a 36.6% mortality rate; the mortality rate was much higher in immunocompromised populations such as patients with malignant tumours.3 The data obtained from this study suggest possibilities for the development of a new therapeutic method or strategy. The concept of assuring antifungal effects by a combination of current antifungal agents and HDACIs will also prove beneficial in terms of improving fungal elimination and reducing drug resistance and treatment failure. It may be more rational to apply HDACIs at an earlier stage of infection because of their characteristics of early regulation in azole resistance, mentioned above. Both the development of HDACIs and their roles in fungal disease need to be further elucidated both in vitro and in vivo. As a result, HDACIs might in future provide a more selective and less toxic choice for patients with multiple diseases. In conclusion, our research broadens knowledge on the functions of the Rpd3/Hda1 family in azole resistance in C. albicans. The relationship between histone deacetylation and the evolution of drug resistance in C. albicans appears to be more complicated than we had first thought. How histone deacetylation is associated with the development of resistance in C. albicans, how it controls signal transduction and how it interacts with other factors are questions awaiting further investigation.
Acknowledgements We would like to thank Professor D. R. Soll (University of Iowa, Iowa City, IA, USA) and Professor T. White (University of Missouri-Kansas City, Kansas City, MO, USA) for gifts of mutant and azole-resistant C. albicans strains.
Funding This work was supported by National Natural Science Foundation of China (Grant number 81101203), National Key Basic Research Program of China (973 Program) (Grant number 2013CB531605), major national science and technology projects (Grant number 2012ZX09301002005001005), funded by Jiangsu Provincial Special Program of Medical Science (Grant number BL2012003), and Applied Basic Research Programs of Science and Technology Commission Foundation of Jiangsu Province (Grant number SBK201122039).
Transparency declarations None to declare.
References 1 Alcazar-Fuoli L, Mellado E. Current status of antifungal resistance and its impact on clinical practice. Br J Haematol 2014; 166: 471–84. 2 Tang HJ, Liu WL, Lin HL et al. Epidemiology and prognostic factors of candidemia in cancer patients. PLoS One 2014; 9: e99103. 3 Guo F, Yang Y, Kang Y et al. Invasive candidiasis in intensive care units in China: a multicentre prospective observational study. J Antimicrob Chemother 2013; 68: 1660– 8.
2001
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
(Figures 6 and 7). These results indicate that both HDA1 and RPD3 are implicated in the evolutionary events leading to azole tolerance in C. albicans. As mentioned above, the enhancing effects of TSA at a low concentration were noted in most of the susceptible strains tested in our study, particularly in those that exhibited trailing growth at drug concentrations above the highest level used (Figure 2, Group A). Interestingly, resistant strains, unlike susceptible ones, showed no changes in trailing growth after 48 h in the presence of TSA. Trailing growth with surviving yeast cells provides a possible mechanism for acquired drug resistance. From this point of view, trailing growth could be considered to be a form of early adaptation to azoles. In addition, our results showed that the increased expression of HDA1 and RPD3 occurred in the early stages of the acquisition of fluconazole resistance, but decreased when the resistance had become stable, both in vitro and in vivo. In addition, resistant strains were less affected by a TSA-dependent inhibition of trailing growth. We conclude that the Rpd3/Hda1 family may play an important role in the early evolution of azole resistance, although the significance of the earlier peak for HDA1 compared with RPD3 needs to be studied further. The exact mechanism of how histone deacetylation regulates azole resistance is unclear. It is plausible that it might not be attributable to just one mechanism, but could involve several mechanisms reflecting the complexity of drug resistance. The link between HDAC and azole resistance genes was suggested in a previous study in which the addition of TSA (3 mg/L) was able to reduce the up-regulation of the ERG11(16) and CDR genes in C. albicans after a short (1 –8 h) period of exposure to fluconazole and terbinafine.25 It has been confirmed that increased levels of ERG11(16), CDR and MDR1 were correlated to increased azole resistance in a series of Ca2-76 to Ca12-99 and other Candida strains.30,35 In our study, CDR2 was up-regulated to a peak level in induction strain 535-6. Meanwhile, HDA1 and RPD3 expression decreased to the basal level when stable fluconazole resistance had formed during both in vitro and in vivo induction. Moreover, the deletion of HDA1 and RPD3 led to a significant reduction in efflux genes including CDR1, CDR2, MDR1 and FLU1. Since HDACs can modify the key lysine residues in histones to regulate the chromatin architecture,13 which often results in transcriptional repression and gene silence, we hypothesize that HDA1 and RPD3 have indirect (rather than direct) effects on the expressions of the efflux genes. Efflux pumps related to azole resistance are grouped into ATP binding cassette transporters (Cdr1p, Cdr2p) and the major facilitator superfamily (Mdr1p, Flu1p). A number of transcription factors, such as Tac1p, Cap1p, Mrr1p, Upc2p and Fcr1p, are thought to be involved in the overexpression of these efflux pumps.46,47 Therefore, histone deacetylation is likely to be an essential process in ensuring the decreased expression of one or more of these transcription factors that is required for azole resistance. Other possibilities also exist, such as Hsp90 being a regulator of azole resistance. In fungi, Hsp90 governs the evolution of drug resistance by stabilizing signal transducers in Saccharomyces cerevisiae and C. albicans. It has been claimed that Hda1 and Rpd3 are both regulators of Hsp90 deacetylation, which is responsible for Hsp90-dependent azole resistance in S. cerevisiae.48,49 These hypotheses or the involvement of another signalling pathway will be confirmed by further studies. Studies of histone deacetylation shed important light on the therapeutic potential of HDACIs in fungal disease. Some HDACIs,
Li et al.
4 Sanglard D, Coste A, Ferrari S. Antifungal drug resistance mechanisms in fungal pathogens from the perspective of transcriptional gene regulation. FEMS Yeast Res 2009; 9: 1029 –50. 5 Espinel-Ingroff A. Mechanisms of resistance to antifungal agents: yeasts and filamentous fungi. Rev Iberoam Micol 2008; 25: 101– 6. 6 Morio F, Pagniez F, Lacroix C et al. Amino acid substitutions in the Candida albicans sterol D5,6-desaturase (Erg3p) confer azole resistance: characterization of two novel mutants with impaired virulence. J Antimicrob Chemother 2012; 67: 2131– 8.
8 Lee MK, Kim HR, Kang JO et al. Susceptibility and trailing growth of Candida albicans to fluconazole: results of a Korean multicentre study. Mycoses 2007; 50: 148–9.
26 Pfaller MA, Messer SA, Georgopapadakou N et al. Activity of MGCD290, a Hos2 histone deacetylase inhibitor, in combination with azole antifungals against opportunistic fungal pathogens. J Clin Microbiol 2009; 47: 3797–804. 27 Mai A, Rotili D, Massa S et al. Discovery of uracil-based histone deacetylase inhibitors able to reduce acquired antifungal resistance and trailing growth in Candida albicans. Bioorg Med Chem Lett 2007; 17: 1221 –5. 28 Morschha¨user J. Regulation of multidrug resistance in pathogenic fungi. Fungal Genet Biol 2010; 47: 94 –106. 29 Srikantha T, Tsai L, Daniels K et al. The histone deacetylase genes HDA1 and RPD3 play distinct roles in regulation of high-frequency phenotypic switching in Candida albicans. J Bacteriol 2001; 183: 4614 –25. 30 White TC, Pfaller MA, Rinaldi MG et al. Stable azole drug resistance associated with a substrain of Candida albicans from an HIV-infected patient. Oral Dis 1997; 3 Suppl 1: S102–9.
9 Lee MK, Williams LE, Warnock DW et al. Drug resistance genes and trailing growth in Candida albicans isolates. J Antimicrob Chemother 2004; 53: 217–24.
31 White TC. The presence of an R467 K amino acid substitution and loss of allelic variation correlate with an azole-resistant lanosterol 14alpha demethylase in Candida albicans. Antimicrob Agents Chemother 1997; 41: 1488– 94.
10 Wang AH, Bertos NR, Vezmar M et al. HDAC4, a human histone deacetylase related to yeast HDA1, is a transcriptional corepressor. Mol Cell Biol 1999; 19: 7816– 27.
32 Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts: Approved Standard M27-A3. CLSI, Wayne, PA, USA, 2008.
11 Emiliani S, Fischle W, Van Lint C et al. Characterization of a human RPD3 ortholog, HDAC3. Proc Natl Acad Sci USA 1998; 95: 2795– 800.
33 Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts: Fourth Informational Supplement M27-S4. CLSI, Wayne, PA, USA, 2012.
12 Grozinger CM, Hassig CA, Schreiber SL. Three proteins define a class of human histone deacetylases related to yeast Hda1p. Proc Natl Acad Sci USA 1999; 96: 4868 –73. 13 Yang XJ, Seto E. The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Nat Rev Mol Cell Biol 2008; 9: 206–18. 14 Khan SN, Khan AU. Role of histone acetylation in cell physiology and diseases: an update. Clin Chim Acta 2010; 411: 1401– 11. 15 Bernstein BE, Tong JK, Schreiber SL. Genomewide studies of histone deacetylase function in yeast. Proc Natl Acad Sci USA 2000; 97: 13708–13. 16 Pontiki E, Hadjipavlou-Litina D. Histone deacetylase inhibitors (HDACIs). Structure-activity relationships: history and new QSAR perspectives. Med Res Rev 2012; 32: 1 –165. 17 Carmen AA, Rundlett SE, Grunstein M. HDA1 and HDA3 are components of a yeast histone deacetylase (HDA) complex. J Biol Chem 1996; 271: 15837– 44. 18 Liu L, Chen B, Qin S et al. A novel histone deacetylase inhibitor chidamide induces apoptosis of human colon cancer cells. Biochem Biophys Res Commun 2010; 392: 190– 5. 19 Wagner JM, Hackanson B, Lu¨bbert M et al. Histone deacetylase (HDAC) inhibitors in recent clinical trials for cancer therapy. Clin Epigenetics 2010; 1: 117–36. 20 Beumer JH, Tawbi H. Role of histone deacetylases and their inhibitors in cancer biology and treatment. Curr Clin Pharmacol 2010; 5: 196– 208. 21 Bolden JE, Peart MJ, Johnstone RW et al. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Disc 2006; 5: 769–84. 22 Sharma SV, Lee DY, Li B et al. A chromatin-mediated reversible drugtolerant state in cancer cell subpopulations. Cell 2010; 141: 69 –80. 23 Rebecca VW, Smalley KS. Tumor heterogeneity and strategies to overcome kinase inhibitor resistance in cancer: lessons from melanoma. Expert Opin Investig Drugs 2011; 20: 137– 40.
34 Yan L, Zhang JD, Cao YB, Gao PH, Jiang YY. Proteomic analysis reveals a metabolism shift in a laboratory fluconazole-resistant Candida albicans strain. J Proteome Res 2007; 6: 2248 –56. 35 White TC. Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole resistance in Candida albicans isolates from a patient infected with human immunodeficiency virus. Antimicrob Agents Chemother 1997; 41: 1482– 7. 36 Riddihough G, Zahn LM. Epigenetics. What is epigenetics? Introduction. Science 2010; 330: 611. 37 Bonasio R, Tu S, Reinberg D. Molecular signals of epigenetic states. Science 2010; 330: 612–6. 38 Kaminsky ZA, Tang T, Wang SC et al. DNA methylation profiles in monozygotic and dizygotic twins. Nat Genet 2009; 41: 240– 5. 39 Hnisz D, Majer O, Frohner IE et al. The Set3/Hos2 histone deacetylase complex attenuates cAMP/PKA signaling to regulate morphogenesis and virulence of Candida albicans. PLoS Pathog 2010; 6: e1000889. 40 Klar AJ, Srikantha T, Soll DR. A histone deacetylation inhibitor and mutant promote colony-type switching of the human pathogen Candida albicans. Genetics 2001; 158: 919– 24. 41 Simonetti G, Passariello C, Rotili D et al. Histone deacetylase inhibitors may reduce pathogenicity and virulence in Candida albicans. FEMS Yeast Res 2007; 7: 1371 –80. 42 Hnisz D, Schwarzmu¨ller T, Kuchler K. Transcriptional loops meet chromatin: a dual-layer network controls white-opaque switching in Candida albicans. Mol Microbiol 2009; 74: 1– 15. 43 Hnisz D, Bardet AF, Nobile CJ et al. A histone deacetylase adjusts transcription kinetics at coding sequences during Candida albicans morphogenesis. PLoS Genet 2012; 8: e1003118.
24 Wurtele H, Tsao S, Le´pine G et al. Modulation of histone H3 lysine 56 acetylation as an antifungal therapeutic strategy. Nat Med 2010; 16: 774–80.
44 Zacchi LF, Schulz WL, Davis DA. HOS2 and HDA1 encode histone deacetylases with opposing roles in Candida albicans morphogenesis. PLoS One 2010; 5: e12171.
25 Smith WL, Edlind TD. Histone deacetylase inhibitors enhance Candida albicans susceptibility to azoles and related antifungals: correlation with
45 Tebarth B, Doedt T, Krishnamurthy S et al. Adaptation of the Efg1p morphogenetic pathway in Candida albicans by negative autoregulation
2002
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
7 Arthington-Skaggs BA, Lee-Yang W, Ciblak MA et al. Comparison of visual and spectrophotometric methods of broth microdilution MIC endpoint determination and evaluation of a sterol quantitation method for in vitro susceptibility testing of fluconazole and itraconazole against trailing and nontrailing Candida isolates. Antimicrob Agents Chemother 2002; 46: 2477–81.
reduction in CDR and ERG upregulation. Antimicrob Agents Chemother 2002; 46: 3532– 9.
Rpd3/Hda1 family regulates azole resistance
and PKA-dependent repression of the EFG1 gene. J Mol Biol 2003; 329: 949–62. 46 Shen H, An MM, Wang DJ et al. Fcr1p inhibits development of fluconazole resistance in Candida albicans by abolishing CDR1 induction. Biol Pharm Bull 2007; 30: 68– 73. 47 Morio F, Pagniez F, Besse M et al. Deciphering azole resistance mechanisms with a focus on transcription factor-encoding genes TAC1, MRR1 and UPC2 in a set of fluconazole-resistant clinical isolates of Candida albicans. Int J Antimicrob Agents 2013; 42: 410–5.
JAC 48 Robbins N, Leach MD, Cowen LE. Lysine deacetylases Hda1 and Rpd3 regulate Hsp90 function thereby governing fungal drug resistance. Cell Rep 2012; 2: 878–88. 49 Cowen LE. The fungal Achilles’ heel: targeting Hsp90 to cripple fungal pathogens. Curr Opin Microbiol 2013; 16: 377–84. 50 Yu LH, Wei X, Ma M et al. Possible inhibitory molecular mechanism of farnesol on the development of fluconazole resistance in Candida albicans biofilm. Antimicrob Agents Chemother 2012; 56: 770–5.
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
2003
The Rpd3/Hda1 family of histone deacetylases regulates azole resistance in Candida albicans Xiaofang Li1,2†, Qing Cai1–3†, Huan Mei1,2, Xiaowei Zhou1,2, Yongnian Shen1,2, Dongmei Li1,2,4 and Weida Liu1,2* 1
*Corresponding author. Tel: +86-025-85478982; Fax: +86-025-85414477; E-mail: [email protected] †These authors contributed equally to the article.
Received 25 October 2014; returned 6 January 2015; revised 9 February 2015; accepted 23 February 2015 Objectives: The histone deacetylase (HDAC) has recently been linked to the morphogenesis and virulence of yeast. However, the effects of HDAC on antifungal susceptibility are not well understood. We sought to characterize the action of histone deacetylation on azole resistance in Candida albicans and its possible mechanism of action. Methods: A total of 40 C. albicans strains were studied. Azole susceptibility with or without trichostatin A (TSA) was determined according to the CLSI microdilution method. The null mutants of HDA1 and RPD3 (genes targeted by TSA) were also investigated using drop-plate assays and a rapid acquisition of adaptation to the azole test. Transcriptional levels of HDAC genes and efflux genes were quantified using RT – PCR for both the basal and fluconazole-induced conditions. Results: The inhibition of HDACs by TSA (0.25 mg/L) markedly reduced the trailing growth and the growth of most C. albicans strains. Trailing growth for C. albicans strains was decreased from 2-fold to 256-fold at 48 h. The deletion of HDA1 or RPD3 increased the susceptibility to azoles compared with the WT strain. The expression of HDA1 and RPD3 was up-regulated to different levels, and returned to the level of the susceptible parental strain when stable resistance had formed during the course of acquired fluconazole resistance both in vitro and in vivo. Efflux genes were poorly expressed in mutant strains compared with those of the WT strain. Conclusions: Our results indicate the important role of the Rpd3/Hda1 family in the development of azole resistance in C. albicans. Histone deacetylation may govern the expression of genes related to the early stages of adaptation to azole stress, such as efflux pump genes. Keywords: C. albicans, histone deacetylation, histone deacetylase inhibitors, trichostatin A
Introduction Candida albicans is the most important pathogenic fungus seen in superficial and invasive infections. The mortality linked to invasive candidiasis remains very high, especially in immunocompromised patients such as ICU patients, AIDS patients or patients undergoing cancer therapy.1,2 Therapies for fungal diseases include, among others, azoles, echinocandins, allylamines and polyenes. Among these antifungals, azoles are the most commonly used in the management of candidiasis. As a result of the wide application of azoles as the sole agents of treatment, resistance is easily developed in clinical Candida isolates. It has been confirmed that resistance to first-line therapy is associated with higher mortality than susceptibility to first-line treatments.3 A number of physiological
attributes of yeast have been associated with azole resistance mechanisms, such as transport alterations (CDR, MDR and FLU), target alterations by mutations and gene up-regulation (ERG), the utilization of compensatory pathways and the presence of complex multicellular structures (biofilms). All of these are related to the abnormal expression of certain genes.4 – 6 One of the difficulties when working with fungistatic drugs, such as azoles, in vitro is the phenomenon of trailing growth. Trailing growth is defined as a reduced, but persistent, growth of some Candida isolates at higher drug concentrations, particularly with fluconazole and itraconazole. Drug concentrations for trailing growth can be exhibited over an extended concentration range.7 According to Lee et al.,8 only 0.35% (4/1137) of isolates presented with susceptible MICs after 24 h of incubation, but resistant MICs
# The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: [email protected]
1993
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
Department of Medical Mycology, Institute of Dermatology, Chinese Academy of Medical Science and Peking Union Medical College, Nanjing, Jiangsu, People’s Republic of China; 2Jiangsu Key Laboratory of Molecular Biology for Skin Diseases and STIs, Nanjing, Jiangsu, People’s Republic of China; 3Fungal Reference Laboratory, Shanghai Dermatology Hospital, Shanghai, People’s Republic of China; 4 Department of Microbiology & Immunology, Georgetown University Medical Center, Washington, DC, USA
Li et al.
Table 1. Genotypes of mutant strains used in this study Strain WO-1 HDho15 RPho3
Relevant genotype
Reference
WT ade2/ade2,Dura3::ADE2/Dura3::ADE2, Dhda1::CAT/Dhda1::hisG-URA3-hisG ade2/ade2,Dura3::ADE2/Dura3::ADE2, Drpd3::hisG/Drpd3::hisG-URA3-hisG
29 29 29
phenotype.23 Compared with the rapidly accumulating knowledge on the mechanisms of HDACs in cancer and cancer treatment, much less is known about their specific roles in fungal disease. Hst3p is a member of the sirtuin family whose inhibition by nicotinamide leads to cytotoxic effects in C. albicans. Wurtele et al. 24 have demonstrated in both molecular and in vivo experiments that an inhibition of Hst3p can sensitize C. albicans to antifungal agents by the deacetylation of H3K56ac. A few studies have shown that non-specific HDACIs against Class I and Class II HDACs can increase the activities of sterol biosynthesis inhibitors, such as TSA, apicidin and MGCD290, against C. albicans in vitro.25 – 27 However, the specific HDACs involved in azole resistance and the characteristics of their actions still need to be demonstrated. A similar picture exists for both fungi and cancer cells with regard to multidrug resistance mechanisms, for example the overexpression of efflux pumps.28 Given the results summarized from these previous studies, we hypothesized that HDACs were likely to govern drug resistance in C. albicans by regulating efflux pump functions or other as yet undefined mechanism(s). Here we attempt to discover the roles of histone deacetylation in the development of drug tolerance in C. albicans.
Materials and methods Strains and media Twenty-two clinical isolates of C. albicans were obtained from Institute of Dermatology, Chinese Academy of Medical Sciences, Jiangsu Province Hospital and Shandong Qilu Hospital. Among these strains, SRY535-60 was used to induce resistance in vitro. C. albicans ATCC 44505, ATCC 62342, ATCC 64550, ATCC 90028, Candida parapsilosis ATCC 22019 and Candida krusei ATCC 6258 were all obtained from the ATCC. WT strain WO-1 and HDAC mutant strains (HDho15 and RPho3) were gifts from D. R. Soll (Department of Biology, University of Iowa). HDho15 (hda1D_/D) and RPho3 (rpd3D_/D) were maintained on agar containing modified Lee’s medium. The phenotypic studies conducted by Dr Soll’s group indicated that HDho15 accelerated white-to-opaque switching, while RPho3 also increased opaque-to-white switching.29 The genotypes of these three strains are listed in Table 1. Strains Ca2-76, Ca2-79, Ca2-85, Ca8-44, Ca8-46 and Ca12-99 were obtained from T. White (School of Biological Sciences, Marion Merrell Dow, University of Missouri-Kansas City). These strains were isolated from an HIV patient with a 2 year history of fluconazole treatment. During the course of therapy, the patient experienced discontinuous oral candidiasis and was treated with increasing doses of fluconazole. Thus, these strains were considered as having acquired azole resistance in vivo.30,31 The azole susceptibilities and established resistance mechanisms of each strain are described in Table 2. The clinical isolates were all
Table 2. MICs for and resistance mechanism of White’s strains CLSI MICs (mg/L) Strain Ca2-76 Ca2-79 Ca2-85 Ca8-44 Ca8-46 Ca12-99
1994
fluconazole itraconazole voriconazole 0.25 1 8 16 16 .64
0.03 0.03 0.03 0.18 0.5 1
0.03 0.03 0.03 0.03 0.125 1
Resistance mechanism31,35 unknown unknown unknown R467K mutation; loss of allelic variation of ERG11(16); and ERG11(16) and MDR1 increased R467K mutation; loss of allelic variation of ERG11(16); and ERG11(16) and MDR1 increased R467K mutation; loss of allelic variation of ERG11(16); and ERG11(16), CDR1 and MDR1 increased
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
after 48 h of incubation. The mechanism of trailing growth in C. albicans is still unknown, but the up-regulation of resistance genes on drug exposure has been suggested as a mechanism.9 Histone deacetylases (HDACs) are a family of significant enzymes that act to deacetylate lysines in histones, transcription factors, signal transduction proteins and other cellular proteins. This gene family is conserved between humans and yeast.10 – 12 HDACs can be grouped into the Rpd3/Hda1 family and the sirtuin family in yeast according to sequence homology and phylogenetic analysis. The Rpd3/Hda1 family belongs to the ‘classical’ zincdependent HDACs. Rpd3 and Hda1 are founding members of the Class I and Class II HDACs, respectively. Class I HDACs are mainly located within the nucleus and play an important role in cell survival and proliferation. Class II HDACs shuttle between the nucleus and the cytoplasm in response to certain cellular signals and possibly have tissue-specific roles. The sirtuin family, described in 2000, belongs to Class III HDACs and is NAD+ dependent. Inhibitors of ‘classical’ HDACs are commonly referred to as HDAC inhibitors (HDACIs). HDACIs can block angiogenesis, arrest cell growth and lead to differentiation and apoptosis in tumour cells.13,14 Class I and Class II HDACs (the Rpd3/Hda1 family) can be inhibited by the classical, non-selective inhibitor trichostatin A (TSA). This is the first natural product of hydroxamate and has the ability to directly inhibit HDACs in both mammalian and yeast cells in vitro.15 – 17 It has been recognized that HDACIs have great potential for treating cancers, immunological diseases and other conditions. A number of compounds that target the Rpd3/Hda1 family are currently under clinical evaluation or have been used in cancer therapy.18 – 21 A recent survey of drug resistance in cancer cells showed that an inhibition of HDAC activity could prevent the development of drug resistance.22 One study has also identified IGFR1 (insulin-like growth factor receptor 1) signalling and histone modification as being critical to the adoption of a drug-tolerant
JAC
Rpd3/Hda1 family regulates azole resistance
identified by standard mycological and molecular tests. All strains were typically preserved in and subsequently subcultured on yeast extract/peptone/ dextrose (YPD; 1% yeast extract/2% peptone/2% dextrose) broth.
HDACIs and antifungals TSA, fluconazole, itraconazole and voriconazole were all purchased from Sigma-Aldrich Co. LLC. These drugs were prepared following the manufacturer’s directions. TSA was diluted in ethanol to 1 mg/L. Fluconazole was diluted in sterile water to 1.28 mg/L. Itraconazole and voriconazole were diluted in DMSO and sterile water to 1.28 mg/L.
Azole susceptibilities without TSA for C. albicans clinical strains were determined following the CLSI M27-A3 method.32 Fresh overnight cultures were prepared in YPD medium and then diluted in RPMI-1640 and counted using a haemocytometer to 104 cells/mL. Final concentrations for each antifungal agent were as follows: for fluconazole, a range of 64 mg/L to 0.125 mg/L, and for itraconazole and voriconazole, a range of 16 mg/L to 0.03 mg/L. The plates were incubated at 358C in boxes to minimize evaporation. The MIC values for and growth of C. albicans were evaluated visually and by reading the absorbance at 630 nm in a microplate reader after both 24 and 48 h of incubation. The MIC was defined as the lowest concentration of drug that caused a prominent decrease (≥50% inhibition) in visible growth relative to that of the growth control. Trailing growth was defined as a reduced, but persistent, growth of Candida isolates at drug concentrations above the MIC after 48 h of incubation. Results for trailing growth were evaluated as the ratio of the highest concentration without fungal growth at 48 h to the MIC at 24 h. Interpretive breakpoints were determined in line with CLSI M27-S4.33 C. krusei ATCC 6258 and C. parapsilosis ATCC 22019 were used as quality controls. All tests were performed in triplicate and repeated on another day.
Drop-plate assays with azoles The susceptibilities of WT strain WO-1 and the mutant strains (HDho15 and RPho3) to azoles were also tested by drop-plate assays. C. albicans cells were obtained from fresh cultures in YPD medium and counted using a haemocytometer. We then plated 5 mL of serial dilutions of 1×105 to 1×100 cells onto YPD agar plates with or without an azole. The concentrations of fluconazole, itraconazole and voriconazole were 64 mg/L, 16 mg/L and 2 mg/L, respectively. The cultures were incubated at 308C for 48 h. The rapid acquisition of adaptation to azoles was also tested for the three strains mentioned above. Yeast cells were grown overnight in Sabouraud dextrose agar (SDA) medium and a colony was transferred into fresh YPD broth for an additional 4– 5 h of growth. Each 100 mL aliquot of fresh culture containing 104 cells was then plated onto YPD agar with or without azole. The final drug concentrations in the agar plates were 128 mg/L for fluconazole, 32 mg/L for itraconazole and 32 mg/L for voriconazole. The plates were incubated at 308C for 8 days and the colony counts for each strain were determined after 5 and 8 days.
Induction of resistant strains Induction of resistance was accomplished with an azole-susceptible C. albicans strain SRY535-60 by incrementally increasing the concentrations of fluconazole as previously described.34 The initial medium for induction contained twice the MIC of fluconazole for SRY535-60. The single colony of SRY535-60 was first incubated in SDA medium at 308C and yeast cells were transferred onto fresh medium when the cell density reached 108 cells/mL. Isolates from each passage were tested using CLSI
Primer
Sequence (5′ 3′ )
Origin
Product size (bp)
ACT1-F ACT1-R HDA1-F HDA1-R RPD3-F RPD3-R CDR1-F CDR1-R CDR2-F CDR2-R MDR1-F MDR1-R FLU1-F FLU1-R
ACTACCATGTTCCCAGGTATTG CCACCAATCCAGACAGAGTATT GCACGACGGTGATTATGTTTATG GCAGCATCAAATCCAGAACTAAC GAGTGCCCGTGATGGTATTAG CCATTGCAAACTCCGGTTTC ACTCCTGCTACCGTGTTGTTATTG ACCTGGACCACTTGGAACATATTG CTGTTACAACCACTATTGCTACTG TACCTTGGACAACTGTGCTTC GGTGCTGCTACTACTGCTTCTG TGATGAAACCCAACACGGAACTAC CGTCATTGGTGCTGCATTTG AGGCAGTGGCTGCATATAAC
XM_717118.1
122
XM_713178.1
102
XM_710672.1
88
Yu et al.50
192
Yu et al.50
297
Yu et al.50
226
XM_715807.1
101
methodology until resistance to fluconazole occurred. We then collected the series of isolates for further experiments.
Quantification of gene expression by RT– PCR One-step RT – PCR was performed on an Agilent MX3000P real-time PCR machine (Agilent, America) according to the manufacturer’s instructions. Primers were synthesized by Shanghai Samgon Biotech Co. Ltd and are listed in Table 3. The primers were tested to minimize primer-dimer and other PCR artefacts. Yeast cells were harvested from 24 h YPD cultures and total RNA was extracted using Trizol and acid-washed glass beads. The qRT – PCR was performed in 25 mL reaction volumes containing 500 ng of C. albicans RNA, 5 pmol of each forward and reverse primer, 0.375 mL of the reference dye, 1 mL of block enzyme mix and 12.5 mL of Brilliant SYBR Green qRT– PCR Mix (Agilent). Amplification was carried out under the following conditions: 508C for 30 min, 958C for 10 min, 40 cycles of 958C for 30 s, followed by 608C for 1 min. The dissociation curves were produced as follows: the temperature was elevated to 958C for 1 min, ramped down to 558C, and then ramped up again to 958C, and fluorescence data were continuously collected during the ramp from 558C to 958C. The dissociation curves were analysed to ensure that there was no non-target amplification. Gene expression was analysed using the 2-△△Ct method, with ACT1 as the reference gene.
Statistical analysis In vitro susceptibility tests involving azoles alone were compared with tests involving azoles plus TSA using the Student’s t-test. All tests were two-tailed and P≤ 0.05 was considered statistically significant. The SPSS statistical software program (version 13.0 for Windows; SPSS Inc., Chicago, IL, USA) was used to perform all the analyses.
Results Susceptibility of C. albicans to azole antifungals and effects of TSA on azole activities against C. albicans First, we determined the susceptibility baselines of all C. albicans strains to three azoles in vitro. According to the CLSI M27-S4 breakpoints for the yeast microdilution method, of the 26 C. albicans strains (the clinical and ATCC strains mentioned
1995
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
Antifungal susceptibility testing
Table 3. Primers for qRT–PCR analysis
Li et al.
Fluconazole
Table 4. Susceptibility of C. albicans to azoles (mg/L) Itraconazole
Voriconazole
0.5 4 32 0.125 0.125 4 32 1 0.125 2 1 0.5 0.5 0.125 1 0.5 1 0.5 1 0.5 0.5 1 0.125 0.125 0.125 0.25
0.03 0.25 1 0.03 0.03 0.25 1.41 0.125 0.06 0.125 0.03 0.25 0.25 0.03 0.25 0.25 0.25 0.125 0.125 0.25 0.03 0.125 0.03 0.03 0.03 0.03
0.03 0.25 0.25 0.03 0.03 0.25 1.41 0.125 0.03 0.25 0.25 0.06 0.06 0.03 0.125 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03
0.8
0.6
0.4
0.2
0.0 0 0.125 0.25 0.5
1
2
4
8
16
32
64
Fluconazole concentration (mg/L) Itraconazole (b) 1.0
0.8
0.6
0.4
0.2
a
Twenty-two clinical strains (including the original isolate of SRY535-60) and four ATCC strains.
0.0 0
1996
1
2
4
8
16
8
16
Itraconazole concentration (mg/L) Voriconazole (c) 1.0
0.8 Absorbance (630 nm)
above), 15 strains were susceptible to all three azoles, 6 strains were dose-dependently susceptible to itraconazole, 1 strain was dose-dependently susceptible to voriconazole and 3 strains were dose-dependently susceptible to all three azoles. As shown in Table 4, the resistant controls ATCC 64550 and PYS2958 were resistant to fluconazole (MICs of 32 mg/L and 32 mg/L, respectively), resistant to itraconazole (MICs of 1.0 mg/L and 1.41 mg/L, respectively) and dose-dependently resistant to voriconazole, respectively (MICs of 0.25 mg/L and 1.41 mg/L, respectively). All the C. albicans strains tested in this study exhibited variable degrees of trailing growth in azole concentrations above the MICs, as previously reported. Representative of this, the trailing growth of PYS2958 is shown in Figure 1, in which the absorbance values of this strain were seen to increase at 48 h compared with the results at 24 h, even above the MIC values. We next tested whether the inhibition of HDAC functions by TSA would reduce azole resistance in C. albicans. For TSA-treated cultures, the final concentration of TSA (0.25 mg/L) was determined by the microdilution method in our preliminary experiment. At this concentration, each C. albicans strain that was tested retained over 90% of its yeast cell growth. There was no significant difference between two groups in terms of CLSI MIC results (P .0.05). However, the inhibition of HDACs with TSA markedly reduced the trailing growth (P, 0.05) and inhibited cell growth for most strains at 48 h. The effects of the inhibition of trailing growth by TSA for all
0.03 0.06 0.125 0.25 0.5
0.6
0.4
0.2
0.0 0
0.03 0.06 0.125 0.25 0.5
1
2
4
Voriconazole concentration (mg/L) Figure 1. Effects of TSA on azole activities and growth of the resistant strain PYS2958 determined by the broth microdilution method. (a) Fluconazole, (b) itraconazole or (c) voriconazole with (triangles) or without (squares) 0.25 mg/L TSA. Candida cells were incubated for 24 h (open symbols) or 48 h (filled symbols).
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
ATCC 44505 ATCC 62342 ATCC 64550 ATCC 90028 PYS2270 PYS2825 PYS2958 PYS3061 PYS3066 PYS3089 PYS3161 PYS3216 PYS3248 PYS3313 PYS3315 PYS3343 PYS7807 SD4263 SD4266 SD592 SDGZ03 SDGZ15 SRY547-57 SRY551-57 SRY554-72 SRY535-60 (535-1)
Fluconazole
Absorbance (630 nm)
Isolatea
Absorbance (630 nm)
(a) 1.0
JAC
Rpd3/Hda1 family regulates azole resistance
Effects of HDA1 and RPD3 deletion on activities of azoles against C. albicans In order to further clarify the roles of HDAC genes in azole susceptibility, the WT strain and mutant strains were analysed by dropplate assays and rapid adaptation tests. In comparison with the WT strain WO-1, HDho15 and RPho3 were hypersensitive on drop-assay plates supplemented with 64 mg/L fluconazole, 16 mg/L itraconazole and 2 mg/L voriconazole, respectively (Figure 3). The C. albicans WT strain and HDA1 and RPD3 deletion mutant strains were also tested in vitro for their susceptibilities to fluconazole, itraconazole and voriconazole using the M27-A3 method. The mutant strains with a deletion of HDA1 or RPD3 showed reduced cell growth at 24 and 48 h. Compared with the WT strain, the deletion of HDA1 resulted in a 16-fold reduction of trailing growth with fluconazole, a 267-fold reduction with itraconazole and a 128-fold reduction with voriconazole. The deletion of RPD3 resulted in a 267-fold reduction in trailing growth with itraconazole and a 128-fold reduction with voriconazole (data not shown). A rapid acquisition of adaptation has been detected in WT C. albicans when a great number of yeast cells were cultured in high concentrations of azoles. In contrast, this adaptability to azoles was markedly reduced in HDAC gene mutant strains. At a high concentration of fluconazole (128 mg/L), itraconazole (32 mg/L) or voriconazole (32 mg/L), adaptation occurred by 5 – 8 days in WO-1. However, HDho15 and RPho3 mutants failed to grow in the presence of high azole concentrations in the same cycle (Figure 4). These results imply that the HDAC genes HDA1 and RPD3 may regulate azole resistance in C. albicans.
Gene expression of clinical C. albicans and mutant strains The expression levels of the HDAC genes (HDA1 and RPD3) and efflux genes (CDR1, CDR2, MDR1 and FLU1) were determined by RT–PCR. There was no correlation between the basal expression
of the HDAC genes and the susceptibilities of C. albicans in terms of either the type of azole or the enhancing effects of TSA on inhibition (data not shown). However, the efflux genes CDR1, CDR2, MDR1 and FLU1 were poorly expressed in the HDho15 and RPho3 strains, with expression levels that were typically ,50% that of the WT strain (Figure 5).
Analysis of HDAC genes and efflux genes in induced C. albicans strains Given the enhanced inhibitory effects of TSA on C. albicans strains, we next tested changes in the expression of HDA1 and RPD3 during the development of acquired azole resistance. A series of fluconazole-resistant strains, which were obtained from a fluconazole-susceptible strain SRY535-60 through serial cultures with inhibitory concentrations of fluconazole, was evaluated for the expression of both HDAC and efflux genes. As shown in Figure 6, the expressions of HDA1 and RPD3 were up-regulated to various levels with increased MICs, but returned to the level seen in the susceptible parental strain as stable resistance formed during the course of acquired fluconazole resistance. The highest expression levels were observed in the early or middle stage of induction of resistance; e.g. HDA1 was induced 5-fold in the presence of fluconazole when the MIC increased to 8-fold that for the original parental strain, and RPD3 was induced 10-fold when the MIC increased 16-fold (Figure 6). Of the efflux genes, CDR2 and MDR1 were up-regulated to different levels by fluconazole exposure when compared with the susceptible parental strain, but the transcription levels of CDR1 and FLU1 showed no obvious changes (Figure 6). The gene expressions of HDA1 and RPD3 were also assessed in a series of in vivo isolates with acquired resistance that were collected from clinical specimens of a single HIV patient who was treated with fluconazole for 2 years. Genetic studies had confirmed that the MICs for these strains increased in correlation to the overexpression of ERG11(16), CDR and MDR1.35 The mutation in ERG11(16) and loss of heterozygosity were also linked to their modes of resistance within this group of resistant strains.31 We found similar changes in the levels of expression of the HDAC genes HDA1 and RPD3 in these strains when compared with induced SRY535-60 strains (Figure 6). The levels of expression of HDA1 increased 7-fold as the MIC increased to 32-fold that for the original parental strain. Similarly, RPD3 was induced 4-fold when the MIC increased 64-fold (Figure 7). Interestingly, an earlier peak of HDA1 was observed in both series of C. albicans strains compared with RPD3.
Discussion Epigenetics is defined as heritable changes in gene expression that are not based on alterations in the DNA sequence. The major mechanisms involved in epigenetics are histone acetylation and deacetylation, which are reversible processes controlled by histone acetyltransferase and HDAC. Epigenetics plays an important role in eukaryotic gene regulation. High HDAC activity could result in transcriptional repression and gene silence.36 – 38 A number of studies have indicated that epigenetics has an indispensable role in the virulence and morphogenesis of yeast. Rpd3, Hda1 and Set3/Hos2 have been linked to the modulation of
1997
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
the tested strains (WT and mutant strains were excluded) are presented in Figure 2. Eighteen strains showed enhancing effects of TSA when tested with fluconazole, 15 with itraconazole and 14 with voriconazole (mutant and induction strains were not included). Based upon the degree of trailing growth, we divided the 26 strains into two groups. Strains in Group A (16 strains) exhibited trailing growth over the highest drug concentration, whereas Group B (10 strains) exhibited trailing growth in the concentration range that was tested. Enhancing effects of inhibition were shown in both groups, particularly in Group A. In Group A, the addition of TSA lessened the trailing growth of C. albicans strains even at 256-fold the MIC at 48 h (Figure 2). The series of C. albicans isolates collected from a single patient with HIV were also tested for the effectiveness of TSA. Using the CLSI M27-S4 method, Ca2-76 and Ca2-79 were fluconazolesusceptible strains and Ca2-85, Ca8-44, Ca8-46 and Ca12-99 were fluconazole-resistant strains with gradually increasing MICs. Increasing effects in terms of inhibition were observed only in azolesusceptible strains, but not in persistently resistant strains even if the concentration of TSA rose to 1 mg/L (Figure 2). The azole-resistant strains PYS2958 and ATCC 64550 showed no inhibition of trailing growth, but a clear reduction in cell growth occurred after the addition of TSA (Figure 1).
Li et al.
FLC
FLC + TSA
ITC
ITC + TSA
VRC
VRC + TSA
ATCC 64550
Clinical azole-resistant strains of group Aa
PYS2958 PYS3161 PYS3248
Clinical azole-dose-dependent strains of group A
PYS3343 PYS7807 SD592
ATCC 90028 PYS2270 SD4263
Clinical azole-susceptible strains of group A
SD4266 SDGZ03 SDGZ15 SRY547-57 SRY551-57 ATCC 62342 PYS2825
Clinical azole-dose-dependent strains of group Bb
PYS3216 PYS3315 PYS3061 PYS3066 PYS3089
Clinical azole-susceptible strains of group B
PYS3313 SRY554-72 535-1(SRY535-60) 535-2 535-3
The series of strains induced in vitro
535-4 535-5 535-6 Ca2-76 Ca2-79 Ca2-85
The series of strains from an HIV-infected patient
Ca8-44 Ca8-46 Ca12-99 1
512
Trailingc Figure 2. Effects of TSA (0.25 mg/L) on trailing growth with azoles. The addition of TSA reduced the trailing growth of C. albicans strains from 2-fold to 256-fold at 48 h in different groups. aStrains in group A exhibited trailing growth above the highest drug concentration used in the study. bStrains in group B exhibited trailing growth in the drug ranges tested. cThe inhibition of trailing growth was evaluated by the ratio of the highest concentration with no sign of growth at 48 h to the MIC value at 24 h. FLC, fluconazole; ITC, itraconazole; VRC, voriconazole.
1998
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
ATCC 44505
JAC
Rpd3/Hda1 family regulates azole resistance
105
104
103
102
105
10
104
103
102
10
WO-1
HDho15
YPD medium
Fluconazole (64 mg/L)
Itraconazole (16 mg/L)
Voriconazole (2 mg/L)
WO-1
HDho15
RPho3
Figure 3. Azole susceptibility profiles of C. albicans WT WO-1 and mutant strains HDho15 (hda1D_/D) and RPho3 (rpd3D_/D) in drop-plate assays. Compared with WO-1, both mutants were more susceptible to fluconazole, itraconazole and voriconazole. The drug concentrations used are indicated in each panel.
200
Day 5 Day 8 Colony number (>1 mm)
150
100
50
0 WO-1
HDho15 FLC
RPho3
WO-1
HDho15 ITC
RPho3
WO-1
HDho15
RPho3
VRC
Figure 4. Rapid acquisition of adaptation to azoles in C. albicans strains. The mutant strain HDho15 was unable to grow in the presence of fluconazole and voriconazole, but was able to grow a few colonies in the presence of itraconazole by 8 days. The mutant RPho3 was unable to grow in the presence of itraconazole and voriconazole, but grew a small number of colonies in the presence of fluconazole by 8 days. The WT strain WO-1 acquired adaptation by 5 and 8 days following incubation for all three azoles. FLC, fluconazole; ITC, itraconazole; VRC, voriconazole.
1999
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
RPho3
Li et al.
Ca2-76 (0.25 mg/L)
WO-1
2.0
HDho15
Ca2-79 (1 mg/L) Ca2-85 (8 mg/L)
1.5
Ca8-44 (16 mg/L)
10
Ca8-46 (16 mg/L)
1.0
Ca12-99 (>64 mg/L)
8
0.0
CDR1
CDR2
MDR1
FLU1
Figure 5. Real-time PCR of efflux genes (CDR1, CDR2, MDR1 and FLU1) is shown for the WT and mutant strains. The expression levels of these genes were significantly reduced in both mutant strains HDho15 and RPho3, but not in the WT strain WO-1.
6
4
2
0
Relative expression
3
2
HDA1
535-1 (0.25 mg/L) 535-2 (2 mg/L) 535-3 (4 mg/L) 535-4 (16 mg/L) 535-5 (64 mg/L) 535-6 (64 mg/L)
Figure 7. Expression of the HDAC genes HDA1 and RPD3 during the course of acquired fluconazole resistance in vivo, with the MIC for each strain given in brackets. The series of C. albicans isolates came from an HIV-infected patient.
1
0
HDA1
RPD3
CDR1
CDR2
MDR1
FLU1
Figure 6. Expression of HDAC genes (HDA1 and RPD3) and efflux genes (CDR1, CDR2, MDR1 and FLU1) during the course of acquired fluconazole resistance in vitro, with the MIC for each strain given in brackets. The series of SRY535-60 isolates was induced using fluconazole in vitro.
spontaneous white and opaque switching frequencies in C. albicans. The evidence for this shows a dramatic increase in the frequency of switching from white to opaque in the absence of the HDA1/RPD3 gene or after the treatment of yeast cells with TSA. The involvement of HDACs in the pathogenicity of C. albicans has been hypothesized since reports that the adhesion of the fungus to epithelial cells and the transition from yeast to hypha were both inhibited by HDACIs. Such inhibition appeared less evident when an HDA1-deficient strain was tested.29,39 – 45 Smith and Edlind25 revealed that TSA could enhance the susceptibility of C. albicans to azoles and terbinafine in vitro. The addition of 3 mg/L TSA could lower the itraconazole MICs for five C. albicans strains by an average of 2.7-fold at 24 h; however, only a small number of strains were included in this study.25 Synergy or an enhancing effect was also identified for other HDACIs such as apicidin, MGCD290 and vorinostat (SAHA), some of these having an
2000
RPD3
antifungal function because of their chemical structure.26,27 Therefore, the relationship between histone deacetylation and azole resistance in C. albicans needs to be further evaluated. In the current study, we investigated whether histone deacetylation was associated with azole resistance in C. albicans. Compared with previous reports, a total of 40 C. albicans isolates with different genetic backgrounds were obtained from a variety of clinical sources, including two series of strains with acquired resistance – one in vitro and one in vivo. Three antifungal agents fundamental to modern therapy for candidiasis were evaluated in combination with TSA. In particular, the concentration of TSA in this study was much lower (0.25 mg/L) than is seen in other studies in order to rule out cytotoxicity caused by TSA. Overall enhancing effects for the clinical strains (mutant and induction strains were excluded) were noted in 84.6% (22/26) of the strains as trailing growth and cell growth decreased dramatically with TSA treatment (Figure 2). Such enhancing effects could be sustained over 72 h. TSA had less effect on the resistant strains (PYS2958, ATCC 64550 and Ca12-99) than the susceptible ones, suggesting a limitation of HDACIs in reversing azole resistance in C. albicans. Such a lack of effect of TSA for Ca12-99 may be associated with a resistance mutation in ERG11(16) and loss of heterozygosity. However, such an ERG11(16) mutation was not found in PYS2958 and ATCC 64550. Since the suppressant effect of TSA on histone deacetylation is non-selective,15,16 different mutant strains were used to determine which specific HDAC gene(s) were involved in the azole resistance. Our results showed that a deletion of HDA1 or RPD3, which encode an HDAC that is susceptible to TSA, increased azole susceptibility in both microdilution and drop-plate assays, and failed to show adaptation to azoles in vitro (Figures 3 and 4). Furthermore, both HDA1 and RPD3 showed elevated transcription levels during the acquisition of azole resistance in vitro and in vivo
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
0.5
Relative expression
Relative expression
RPho3
JAC
Rpd3/Hda1 family regulates azole resistance
including vorinostat, romidepsin and chidamide, have been used in clinical treatments or trials, with better responses being seen for haematological malignancies, cutaneous lymphomas and solid tumours.18 – 20 A prospective multicentre observational study in China showed that invasive Candida infection occurred in 0.32% of ICU patients, with a 36.6% mortality rate; the mortality rate was much higher in immunocompromised populations such as patients with malignant tumours.3 The data obtained from this study suggest possibilities for the development of a new therapeutic method or strategy. The concept of assuring antifungal effects by a combination of current antifungal agents and HDACIs will also prove beneficial in terms of improving fungal elimination and reducing drug resistance and treatment failure. It may be more rational to apply HDACIs at an earlier stage of infection because of their characteristics of early regulation in azole resistance, mentioned above. Both the development of HDACIs and their roles in fungal disease need to be further elucidated both in vitro and in vivo. As a result, HDACIs might in future provide a more selective and less toxic choice for patients with multiple diseases. In conclusion, our research broadens knowledge on the functions of the Rpd3/Hda1 family in azole resistance in C. albicans. The relationship between histone deacetylation and the evolution of drug resistance in C. albicans appears to be more complicated than we had first thought. How histone deacetylation is associated with the development of resistance in C. albicans, how it controls signal transduction and how it interacts with other factors are questions awaiting further investigation.
Acknowledgements We would like to thank Professor D. R. Soll (University of Iowa, Iowa City, IA, USA) and Professor T. White (University of Missouri-Kansas City, Kansas City, MO, USA) for gifts of mutant and azole-resistant C. albicans strains.
Funding This work was supported by National Natural Science Foundation of China (Grant number 81101203), National Key Basic Research Program of China (973 Program) (Grant number 2013CB531605), major national science and technology projects (Grant number 2012ZX09301002005001005), funded by Jiangsu Provincial Special Program of Medical Science (Grant number BL2012003), and Applied Basic Research Programs of Science and Technology Commission Foundation of Jiangsu Province (Grant number SBK201122039).
Transparency declarations None to declare.
References 1 Alcazar-Fuoli L, Mellado E. Current status of antifungal resistance and its impact on clinical practice. Br J Haematol 2014; 166: 471–84. 2 Tang HJ, Liu WL, Lin HL et al. Epidemiology and prognostic factors of candidemia in cancer patients. PLoS One 2014; 9: e99103. 3 Guo F, Yang Y, Kang Y et al. Invasive candidiasis in intensive care units in China: a multicentre prospective observational study. J Antimicrob Chemother 2013; 68: 1660– 8.
2001
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
(Figures 6 and 7). These results indicate that both HDA1 and RPD3 are implicated in the evolutionary events leading to azole tolerance in C. albicans. As mentioned above, the enhancing effects of TSA at a low concentration were noted in most of the susceptible strains tested in our study, particularly in those that exhibited trailing growth at drug concentrations above the highest level used (Figure 2, Group A). Interestingly, resistant strains, unlike susceptible ones, showed no changes in trailing growth after 48 h in the presence of TSA. Trailing growth with surviving yeast cells provides a possible mechanism for acquired drug resistance. From this point of view, trailing growth could be considered to be a form of early adaptation to azoles. In addition, our results showed that the increased expression of HDA1 and RPD3 occurred in the early stages of the acquisition of fluconazole resistance, but decreased when the resistance had become stable, both in vitro and in vivo. In addition, resistant strains were less affected by a TSA-dependent inhibition of trailing growth. We conclude that the Rpd3/Hda1 family may play an important role in the early evolution of azole resistance, although the significance of the earlier peak for HDA1 compared with RPD3 needs to be studied further. The exact mechanism of how histone deacetylation regulates azole resistance is unclear. It is plausible that it might not be attributable to just one mechanism, but could involve several mechanisms reflecting the complexity of drug resistance. The link between HDAC and azole resistance genes was suggested in a previous study in which the addition of TSA (3 mg/L) was able to reduce the up-regulation of the ERG11(16) and CDR genes in C. albicans after a short (1 –8 h) period of exposure to fluconazole and terbinafine.25 It has been confirmed that increased levels of ERG11(16), CDR and MDR1 were correlated to increased azole resistance in a series of Ca2-76 to Ca12-99 and other Candida strains.30,35 In our study, CDR2 was up-regulated to a peak level in induction strain 535-6. Meanwhile, HDA1 and RPD3 expression decreased to the basal level when stable fluconazole resistance had formed during both in vitro and in vivo induction. Moreover, the deletion of HDA1 and RPD3 led to a significant reduction in efflux genes including CDR1, CDR2, MDR1 and FLU1. Since HDACs can modify the key lysine residues in histones to regulate the chromatin architecture,13 which often results in transcriptional repression and gene silence, we hypothesize that HDA1 and RPD3 have indirect (rather than direct) effects on the expressions of the efflux genes. Efflux pumps related to azole resistance are grouped into ATP binding cassette transporters (Cdr1p, Cdr2p) and the major facilitator superfamily (Mdr1p, Flu1p). A number of transcription factors, such as Tac1p, Cap1p, Mrr1p, Upc2p and Fcr1p, are thought to be involved in the overexpression of these efflux pumps.46,47 Therefore, histone deacetylation is likely to be an essential process in ensuring the decreased expression of one or more of these transcription factors that is required for azole resistance. Other possibilities also exist, such as Hsp90 being a regulator of azole resistance. In fungi, Hsp90 governs the evolution of drug resistance by stabilizing signal transducers in Saccharomyces cerevisiae and C. albicans. It has been claimed that Hda1 and Rpd3 are both regulators of Hsp90 deacetylation, which is responsible for Hsp90-dependent azole resistance in S. cerevisiae.48,49 These hypotheses or the involvement of another signalling pathway will be confirmed by further studies. Studies of histone deacetylation shed important light on the therapeutic potential of HDACIs in fungal disease. Some HDACIs,
Li et al.
4 Sanglard D, Coste A, Ferrari S. Antifungal drug resistance mechanisms in fungal pathogens from the perspective of transcriptional gene regulation. FEMS Yeast Res 2009; 9: 1029 –50. 5 Espinel-Ingroff A. Mechanisms of resistance to antifungal agents: yeasts and filamentous fungi. Rev Iberoam Micol 2008; 25: 101– 6. 6 Morio F, Pagniez F, Lacroix C et al. Amino acid substitutions in the Candida albicans sterol D5,6-desaturase (Erg3p) confer azole resistance: characterization of two novel mutants with impaired virulence. J Antimicrob Chemother 2012; 67: 2131– 8.
8 Lee MK, Kim HR, Kang JO et al. Susceptibility and trailing growth of Candida albicans to fluconazole: results of a Korean multicentre study. Mycoses 2007; 50: 148–9.
26 Pfaller MA, Messer SA, Georgopapadakou N et al. Activity of MGCD290, a Hos2 histone deacetylase inhibitor, in combination with azole antifungals against opportunistic fungal pathogens. J Clin Microbiol 2009; 47: 3797–804. 27 Mai A, Rotili D, Massa S et al. Discovery of uracil-based histone deacetylase inhibitors able to reduce acquired antifungal resistance and trailing growth in Candida albicans. Bioorg Med Chem Lett 2007; 17: 1221 –5. 28 Morschha¨user J. Regulation of multidrug resistance in pathogenic fungi. Fungal Genet Biol 2010; 47: 94 –106. 29 Srikantha T, Tsai L, Daniels K et al. The histone deacetylase genes HDA1 and RPD3 play distinct roles in regulation of high-frequency phenotypic switching in Candida albicans. J Bacteriol 2001; 183: 4614 –25. 30 White TC, Pfaller MA, Rinaldi MG et al. Stable azole drug resistance associated with a substrain of Candida albicans from an HIV-infected patient. Oral Dis 1997; 3 Suppl 1: S102–9.
9 Lee MK, Williams LE, Warnock DW et al. Drug resistance genes and trailing growth in Candida albicans isolates. J Antimicrob Chemother 2004; 53: 217–24.
31 White TC. The presence of an R467 K amino acid substitution and loss of allelic variation correlate with an azole-resistant lanosterol 14alpha demethylase in Candida albicans. Antimicrob Agents Chemother 1997; 41: 1488– 94.
10 Wang AH, Bertos NR, Vezmar M et al. HDAC4, a human histone deacetylase related to yeast HDA1, is a transcriptional corepressor. Mol Cell Biol 1999; 19: 7816– 27.
32 Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts: Approved Standard M27-A3. CLSI, Wayne, PA, USA, 2008.
11 Emiliani S, Fischle W, Van Lint C et al. Characterization of a human RPD3 ortholog, HDAC3. Proc Natl Acad Sci USA 1998; 95: 2795– 800.
33 Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts: Fourth Informational Supplement M27-S4. CLSI, Wayne, PA, USA, 2012.
12 Grozinger CM, Hassig CA, Schreiber SL. Three proteins define a class of human histone deacetylases related to yeast Hda1p. Proc Natl Acad Sci USA 1999; 96: 4868 –73. 13 Yang XJ, Seto E. The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Nat Rev Mol Cell Biol 2008; 9: 206–18. 14 Khan SN, Khan AU. Role of histone acetylation in cell physiology and diseases: an update. Clin Chim Acta 2010; 411: 1401– 11. 15 Bernstein BE, Tong JK, Schreiber SL. Genomewide studies of histone deacetylase function in yeast. Proc Natl Acad Sci USA 2000; 97: 13708–13. 16 Pontiki E, Hadjipavlou-Litina D. Histone deacetylase inhibitors (HDACIs). Structure-activity relationships: history and new QSAR perspectives. Med Res Rev 2012; 32: 1 –165. 17 Carmen AA, Rundlett SE, Grunstein M. HDA1 and HDA3 are components of a yeast histone deacetylase (HDA) complex. J Biol Chem 1996; 271: 15837– 44. 18 Liu L, Chen B, Qin S et al. A novel histone deacetylase inhibitor chidamide induces apoptosis of human colon cancer cells. Biochem Biophys Res Commun 2010; 392: 190– 5. 19 Wagner JM, Hackanson B, Lu¨bbert M et al. Histone deacetylase (HDAC) inhibitors in recent clinical trials for cancer therapy. Clin Epigenetics 2010; 1: 117–36. 20 Beumer JH, Tawbi H. Role of histone deacetylases and their inhibitors in cancer biology and treatment. Curr Clin Pharmacol 2010; 5: 196– 208. 21 Bolden JE, Peart MJ, Johnstone RW et al. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Disc 2006; 5: 769–84. 22 Sharma SV, Lee DY, Li B et al. A chromatin-mediated reversible drugtolerant state in cancer cell subpopulations. Cell 2010; 141: 69 –80. 23 Rebecca VW, Smalley KS. Tumor heterogeneity and strategies to overcome kinase inhibitor resistance in cancer: lessons from melanoma. Expert Opin Investig Drugs 2011; 20: 137– 40.
34 Yan L, Zhang JD, Cao YB, Gao PH, Jiang YY. Proteomic analysis reveals a metabolism shift in a laboratory fluconazole-resistant Candida albicans strain. J Proteome Res 2007; 6: 2248 –56. 35 White TC. Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole resistance in Candida albicans isolates from a patient infected with human immunodeficiency virus. Antimicrob Agents Chemother 1997; 41: 1482– 7. 36 Riddihough G, Zahn LM. Epigenetics. What is epigenetics? Introduction. Science 2010; 330: 611. 37 Bonasio R, Tu S, Reinberg D. Molecular signals of epigenetic states. Science 2010; 330: 612–6. 38 Kaminsky ZA, Tang T, Wang SC et al. DNA methylation profiles in monozygotic and dizygotic twins. Nat Genet 2009; 41: 240– 5. 39 Hnisz D, Majer O, Frohner IE et al. The Set3/Hos2 histone deacetylase complex attenuates cAMP/PKA signaling to regulate morphogenesis and virulence of Candida albicans. PLoS Pathog 2010; 6: e1000889. 40 Klar AJ, Srikantha T, Soll DR. A histone deacetylation inhibitor and mutant promote colony-type switching of the human pathogen Candida albicans. Genetics 2001; 158: 919– 24. 41 Simonetti G, Passariello C, Rotili D et al. Histone deacetylase inhibitors may reduce pathogenicity and virulence in Candida albicans. FEMS Yeast Res 2007; 7: 1371 –80. 42 Hnisz D, Schwarzmu¨ller T, Kuchler K. Transcriptional loops meet chromatin: a dual-layer network controls white-opaque switching in Candida albicans. Mol Microbiol 2009; 74: 1– 15. 43 Hnisz D, Bardet AF, Nobile CJ et al. A histone deacetylase adjusts transcription kinetics at coding sequences during Candida albicans morphogenesis. PLoS Genet 2012; 8: e1003118.
24 Wurtele H, Tsao S, Le´pine G et al. Modulation of histone H3 lysine 56 acetylation as an antifungal therapeutic strategy. Nat Med 2010; 16: 774–80.
44 Zacchi LF, Schulz WL, Davis DA. HOS2 and HDA1 encode histone deacetylases with opposing roles in Candida albicans morphogenesis. PLoS One 2010; 5: e12171.
25 Smith WL, Edlind TD. Histone deacetylase inhibitors enhance Candida albicans susceptibility to azoles and related antifungals: correlation with
45 Tebarth B, Doedt T, Krishnamurthy S et al. Adaptation of the Efg1p morphogenetic pathway in Candida albicans by negative autoregulation
2002
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
7 Arthington-Skaggs BA, Lee-Yang W, Ciblak MA et al. Comparison of visual and spectrophotometric methods of broth microdilution MIC endpoint determination and evaluation of a sterol quantitation method for in vitro susceptibility testing of fluconazole and itraconazole against trailing and nontrailing Candida isolates. Antimicrob Agents Chemother 2002; 46: 2477–81.
reduction in CDR and ERG upregulation. Antimicrob Agents Chemother 2002; 46: 3532– 9.
Rpd3/Hda1 family regulates azole resistance
and PKA-dependent repression of the EFG1 gene. J Mol Biol 2003; 329: 949–62. 46 Shen H, An MM, Wang DJ et al. Fcr1p inhibits development of fluconazole resistance in Candida albicans by abolishing CDR1 induction. Biol Pharm Bull 2007; 30: 68– 73. 47 Morio F, Pagniez F, Besse M et al. Deciphering azole resistance mechanisms with a focus on transcription factor-encoding genes TAC1, MRR1 and UPC2 in a set of fluconazole-resistant clinical isolates of Candida albicans. Int J Antimicrob Agents 2013; 42: 410–5.
JAC 48 Robbins N, Leach MD, Cowen LE. Lysine deacetylases Hda1 and Rpd3 regulate Hsp90 function thereby governing fungal drug resistance. Cell Rep 2012; 2: 878–88. 49 Cowen LE. The fungal Achilles’ heel: targeting Hsp90 to cripple fungal pathogens. Curr Opin Microbiol 2013; 16: 377–84. 50 Yu LH, Wei X, Ma M et al. Possible inhibitory molecular mechanism of farnesol on the development of fluconazole resistance in Candida albicans biofilm. Antimicrob Agents Chemother 2012; 56: 770–5.
Downloaded from http://jac.oxfordjournals.org/ at University of Georgia Libraries, Serials Department on June 28, 2015
2003
