Annals of Biomedical Engineering, Vol. 43, No. 5, May 2015 ( 2014) pp. 1178–1188 DOI: 10.1007/s10439-014-1178-2
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization SING WAN WONG,1 SHAN SUN,2 MICHAEL CHO,2 KENNETH K. H. LEE,3 and ARTHUR F. T. MAK1 1 Division of Biomedical Engineering, The Chinese University of Hong Kong, Shatin, Hong Kong; 2Department of Bioengineering, University of Illinois at Chicago, Chicago, IL, USA; and 3Key Laboratory for Regenerative Medicine, School of Biomedical Sciences, The Chinese University of Hong Kong, Shatin, Hong Kong
(Received 26 June 2014; accepted 29 October 2014; published online 5 November 2014) Associate Editor Estefanı´ a Pen˜a oversaw the review of this article.
suggested to be related to oxidative stress.17 While prolonged and excessive loading is believed to be one of the major causes contributing to the development of pressure ulcer, reperfusion-induced oxidative stress may further compromise the load-carrying capacity of skeletal muscle cells and make them more vulnerable to biomechanical damage in subsequent reloading.19 Actin filaments are the most abundant components of the cytoskeleton. Along with supporting the cell shape, actin filaments serve critical roles in skeletal muscle contraction.14 Actin filaments exist in a dynamic state, constantly being assembled and disassembled. Such polymerization and depolymerization processes allow the cells to respond to different biomechanical situations. For instance, it will, together with linker proteins like alpha actinin, form bundlelike structures to resist external tensile stresses,16 or modify themselves to sustain extrinsic compressive loads.4 The process of actin polymerization has been described.3 A regulatory protein profilin1 takes actin monomers (G-actin) in the cytoplasm to form an actin filament (F-actin). At the same time, another regulatory protein cofilin (in muscle cells, cofilin present as isoform-2, i.e., cofilin2) takes an actin monomer out of the filament. The above process involves ATP/ADP conversion. Profilin1 brings an actin monomer with ATP to an actin filament, and the ATP would then be hydrolyzed to become ADP. Cofilin recognizes the ADP-actin and cut them off from the actin filament.22 The ADP-actin would then become ATP-actin for recycles. Thymosin beta 4 competes with cofilin2 to bind with actin and interacts with profilin1 to form a ternary complex.2,21 The effects of oxidative stress on cytoskeleton have been reported for a number of tissues. Examples
Abstract—Skeletal muscles often experience oxidative stress in anaerobic metabolism and ischemia–reperfusion. This paper reports how oxidative stress affects the stiffness of cultured murine myotubes and their actin filaments polymerization dynamics. H2O2 was applied as an extrinsic oxidant to C2C12 myotubes. Atomic force microscopy results showed that short exposures to H2O2 apparently increased the stiffness of myotubes, but that long exposures made the cells softer. The turning point seemed to take place somewhere between 1 and 2 h of H2O2 exposure. We found that the stiffness change was probably due to actin filaments being favored for depolymerization after prolong H2O2 treatments, especially when the exposure duration exceeded 1 h and the exposure concentration reached 1.0 mM. Such depolymerization effect was associated with the down-regulation of thymosin beta 4, as well as the up-regulation of both cofilin2 and profilin1 after prolong H2O2 treatments. Keywords—Oxidative stress, Myotubes, Cell stiffness, Actin filament, Cofilin2, Thymosin beta 4.
INTRODUCTION Oxidative stress is a physiological condition caused by the excessive presence of reactive oxygen species (ROS). ROS can be normal metabolites during anaerobic respiration, and can also be by-products of processes caused by UV,13 heat23 and chemical toxins.15 Reperfusion, namely the re-entering of blood to the previously ischemic tissues, is a situation that can generate a large amount of ROS and present major clinical challenges, such as in strokes and heart attacks.18 Pressure ulcer is another clinical challenge Address correspondence to Arthur F. T. MAK, Division of Biomedical Engineering, The Chinese University of Hong Kong, Shatin, Hong Kong. Electronic mail: [email protected]
1178 0090-6964/15/0500-1178/0
2014 Biomedical Engineering Society
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
include vascular endothelial cells,5 eyes,24 astrocytes25 and Saccharomyces cerevisiae.1 This study seeks to address how exposures to hydrogen peroxide (H2O2) as an extrinsic oxidative agent may affect the stiffness of cultured myotubes and how such effects may be associated with changes in the polymerization dynamics of the myotube cytoskeleton.
MATERIALS AND METHODS Cell Culture and Oxidative Stress Mouse myogenic C2C12 cells line was obtained from ATCC (#CRL-1772). The cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM), 10% Fetal Bovine Serum (FBS) plus 1% Penicillin– Streptomycin (P–S). The cells were cultured in a 5% CO2 and 37 C incubator until it reached 90% confluence and then the culture medium was replaced by DMEM + 2% FBS + 1% P–S for 4 days to induce myotubes differentiation. H2O2 diluted with differentiation medium to 0.5, 1.0, and 2.0 mM was applied into the myotubes cultures for various durations to simulate different oxidative environments. Confocal Imaging for Actin Filaments Myotubes were cultured on 12 mm round glass cover slips inserted into 4-well culture plates. After 24 h treatment with H2O2, the samples were washed twice in PBS and then fixed with 10% formalin made up in PBS for 10 min. The fixative was then removed and the samples were washed with PBS twice. 0.1% tritonX-100 (USB, #22686) in PBS was applied for 10 min to permeablize the cells and the cells were then stained with FITC-labeled phalloidin (1:40 dilution, Sigma-Aldrich P-5282) to reveal the F-actin filaments. After 3 h incubation, the cells were washed with PBS with 0.1% Tween20 (USB, #20605) for three times to remove unbound phalloidin. The stained cultures were counterstained with 4 lg/mL of DAPI and mounted onto a glass slide. The samples were then examined using an Olympus, FluoView 1000 confocal microscope. The fluorescence intensity was quantified using a software MetaMorph. Atomic Force Microscopy The myotube stiffness was measured by atomic force microscopy (AFM) (Novascan Technologies, Ames, IA). The AFM probe was a glass sphere with 10 lm diameter and the spring constant of the cantilever was 0.12 N/m. This probe applied a micro-indentation to the myotubes with a velocity of ~0.1 mm/s to obtain a force–displacement curve. When 200 nm displacement
1179
was reached, the probe was then retracted. Hertz Model was applied to calculate the Young’s modulus of the cells as follows: F¼
pffiffiffiffi 4 E d3=2 R 2 3 ð1 t Þ
where F is the loading force, d the indentation depth, m the Poisson’s ratio, R the radius of the spherical indenter, and E is the Young’s modulus. The Poisson’s ratio was set to be 0.5 as cells were assumed as intrinsically incompressible.12 Three different positions were measured on each individual myotube, and 30 cells of each sample were selected for the measurement. The final Young’s modulus was the average value of all these data. Real-Time PCR (qPCR) The control and the H2O2-treated myotubes were processed for qPCR. The cultures were washed with DEPC-treated PBS. Then 1 mL of RNAiso Plus (TaKaRa #9109) was added to the cultures for total RNA extraction. 200 lL of chloroform was added to each samples and mixed vigorously to allow phase separation. Then, the extracts were centrifuged at 12,500 rpm and 4 C for 20 min. The upper layer, which contained the total RNA, of each sample was then transferred into a new tube. 500 lL of isopropanol was added to each of the tubes and mixed gently. The samples were allowed to stand at room temperature for 10 min for RNA precipitation. Same centrifugation protocol was performed and the supernatants were discarded. 1 mL of 75% DEPC-EtOH was then added, vortexed, and centrifuged at 7500 rpm, 4 C for 5 min to remove the unwanted salts. The samples were then allowed to air dry to let the remaining DEPCEtOH evaporate. 20 lL of DEPC-H2O was used to resuspend the RNA pellet and was then warmed up to 65 C for 10 min. The concentration of total RNA was measured using Nanodrop. 1 lg of total RNA was reverse transcribed by using RevertAidTM First Strand cDNA Synthesis Kit (Fermetas, K1622) to convert the mRNA to cDNA. The cDNAs were used for qPCR assay using the primers shown in Table 1. SYBE green reaction kit from TaKaRa (DRR041A) was used for qPCR. The reaction was performed in an Abi viia7 real-time PCR machine with 2(2DDCt) method while GAPDH was used as the housekeeping gene for internal control. Western Blot The control and the H2O2 exposed myotubes were treated with 100 lL of RIAP lysis buffer and agitated with a swapper for protein extraction. The lysate were
1180
WONG et al.
TABLE 1. Primer sequences used for the real time PCR assays. Beta-actin mRNA Profilin1 mRNA Cofilin2 mRNA Thymosin beta 4 mRNA GAPDH mRNA
F: ccaccatgtacccaggcatt R: cgctcaggaggagcaatgat F: ggaacgcctacatcgacagc R: tgcctaccaggacaccaacc F: tcccgttcgtgaatgagtga R: actgcaaggaaggcatggaa F: tgacaaacccgatatggctga R: cgctcgcctcattacgattc F: atcctgcaccaccaactgct R: gggccatccacagtcttctg
F, forward primer; R, reverse primer.
Statistical Analysis Two-tailed t test was used to compare the results of the H2O2 treated groups with that of the control group. Statistical significance was affirmed when p < 0.05.
RESULTS Morphological Changes of C2C12 Myotubes After H2O2 Treatment Figure 1 showed the morphological records of C2C12 cells cultured at different stages—(a): myoblasts at confluence, ready for the subsequent differentiation process; (b): cells 4 days after differentiation initiated, showing tubular sturcture significantly different from the myoblasts, indicating myotubes differentiation was successful; and (c): myotubes after 24 h of H2O2 exposure at 1.0 mM, showing gaps between the myotubes (white arrows).
then transferred into 1.5 mL tube and centrifuged at 12,000 rpm, 4 C for 10 min. The supernatants containing the proteins were collected and mixed with 69 SDS buffer and heated to 95 C for 5 min. 50 lg of proteins from each sample was loaded onto a standard SDS-PAGE for separation. The resolved proteins were transferred by semi-dry method onto a PVDF membrane at 300 mA for 60 min. The membranes were then blocked with 5% non-fat dry milk in TBS for 1 h. GAPDH (Sigma, G8795), beta actin (Santa Cruz, SC-8432), profilin1 (abcam, ab124904), thymosin beta 4 (abcam, ab14335) and cofilin2 (abcam, ab14134) was used as a primary antibodies at 1:2000 dilution to incubate overnight. The membrane was washed with TBST three times and TBS twice in the following day. Donkey anti-Mouse IRDye 680LT antibody (Li-Cor, 926-68022) and donkey anti-rabbit IRDye 800CW antibody (Li-Cor, 926-32213) were used as secondary antibody (1:3000 dilution) and incubated at room temperature for 3 h. The immunostained membranes were washed with the above procedure and scanned by using an Odyssey Infrared Imaging System. The signal intensity was measured using MetaMorph.
The presence of F-actin was detected by phalloidin staining since phalloidin specifically binds to F-actin filaments. The fluorescence images were shown in Fig. 2. For the control group (Fig. 2a), the fluorescence intensity was highest compared to those treatment groups. After 0.5, 1.0, and 2.0 mM H2O2 exposures for 24 h (Figs. 2b, 2c, and 2d), the fluorescence intensities of the myotubes cultures decreased by 23, 48, and 71% respectively and these differences were statistically significant (Fig. 2e). The decrease of the fluorescence intensity implied the diminished presence of actin filaments. Such H2O2 effects were found to be dose-dependent.
Intracellular ROS Level
Cells Stiffness After H2O2 Treatment
Myotubes were cultured in a black 96-well plate as described above for intracellular ROS level assay. OxiSelect Intracellular ROS Assay kit (STA-342, Cell bio labs) was applied to measure the ROS level within the cells after 0.5, 1.0, and 2.0 mM treatment for 1, 2, and 24 h. The assay revealed the intracellular ROS level by a reaction between ROS and DCFH. The higher concentration of ROS present within the cells, the higher is the fluorescent signal. The fluorescent signal was measured by Molecular Devices SpectraMax i3 multimode spectrophotometer (MD). Control group (without H2O2 treatment) at time zero (immediately after H2O2 added to the culture) was used as baseline. The fold change of each treatment group and time point was calculated relative to the baseline.
Table 2 summarized the averages of the myotube stiffness after 1, 2, and 24 h H2O2 exposures at various concentrations. After 24 h of H2O2 exposures, the Young’s moduli of myotubes decreased by about 42 and 39% after 0.5 and 1.0 mM treatments respectively. In the 2.0 mM group, the decrease in stiffness reached 66%. These differences reached statistical significance with p < 0.01. For 2 h exposures to H2O2 at similar concentrations, the dose-dependent decreasing trend was similar to that for the 24 h exposures, except that the effects were smaller and only the 2.0 mM result was statistically different from the control. It is interesting that for 1 h exposures to H2O2 at similar concentrations, the myotubes exhibited a stiffening trend instead of a softening trend. The Young’s
Effect of H2O2 on the Actin Filaments
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
1181
FIGURE 1. Representative bright field microscopic images of C2C12 cells in culture. (a) Appearance of confluent myoblasts. (b) Myotubes after inducing the myoblasts to differentiate for 4 days. (c) Appearance of myotubes treated with 1.0 mM H2O2 for 24 h. (3100).
modulus of myotubes were 13, 7, and 23% higher than the control after 1 h of exposure to 0.5, 1.0, and 2.0 mM H2O2 respectively. The above differences were found to be statistically significant for the 0.5 and 2.0 mM groups. Transcriptional Analysis of the Core Proteins Regulating Actin Filament Polymerization Dynamics Real time PCR results of cofilin2, thymosin beta 4, profilin1 and beta actin in myotubes after 24 h of H2O2 exposures were shown in Fig. 3. Cofilin2 mRNA (Fig. 3a) showed 29 and 53% up-regulation after 0.5 and 1.0 mM of H2O2 treatments, while the up-regulation effect returned to 27% for the 2.0 mM treatment group. In this study, only the changes in 0.5 and 1.0 mM
treatments were found to be statistically significant. Thymosin beta 4 (Fig. 3b) was up-regulated by 22% after 0.5 mM H2O2 treatment for 24 h. The mRNA was down-regulated by 33 and 60% after 1.0 and 2.0 mM of H2O2 was applied. However, the down-regulation at 1.0 mM treatment group was not found to be statistically significant. Profilin1 mRNA (Fig. 3c) expression was up-regulated 15, 40, and 60% after 0.5, 1.0, and 2.0 mM H2O2 treatments for 24 h respectively. The changes in 1.0 and 2.0 mM treatments were found to be statistically significant. The expression of beta actin mRNA (Fig. 3d) decreased 8% in the 0.5 and 1.0 mM treatment groups, but the statistical significances of those changes could not be established in this study. The expression of the corresponding mRNA was nearly unchanged after 24 h of exposure to 2.0 mM H2O2.
1182
WONG et al.
(a)
(b) 0.5mM H2O2
Control
(c)
Relavely fluorescence intensity
(e)
(d)
1.0mM H2O2
2.0mM H2O2
1.2 1
**
0.8
**
0.6
**
0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
FIGURE 2. Confocal images of myotubes stained with phalloidin to reveal the arrangement of the actin filaments. (a) Myotubes without H2O2 treatment. (b, c, and d) myotubes treated with 0.5, 1.0, and 2.0 mM of H2O2 for 24 h respectively. In the presence of H2O2, there was a dose-dependent decrease of actin filaments in the myotubes. (e) Relative changes in fluorescence intensity between the control group and the H2O2 treated groups, with statistical significance based on two-tail t-test (**p < 0.01) (Blue: nuclei stained with DAPI; Green: F-actin filaments stained with Phalloidin) (3400). TABLE 2. Percentage changes of myotubes stiffness after various H2O2 treatments relative to their corresponding control groups. 1 h (%) 0.5 mM 1.0 mM 2.0 mM
+13* +7 +23*
SD (%) ±6.8 ±6.6 ±6.1
2 h (%)
SD (%)
216 211 249**
±7.4 ±5.4 ±5.4
24 h (%) 242** 239** 266**
SD (%) ±7.5 ±7.6 ±6.3
Statistical significance was based on two tails t-test (*p < 0.05; **p < 0.01).
For 2 h of H2O2 exposures at similar concentrations, the changes in cofilin2, thymosin beta 4, and profilin1 mRNA were presented in Figs. 4b, 4c, and 4d respectively. Only the decreased expressions of thymosin beta 4 were statistically significant. It is interesting to note that profilin1 expressions were all lower compared to the control, which are opposite to the results observed after a prolong exposure for 24 h. Figures 5b, 5c, 5d show the changes in cofilin2, thymosin beta 4, and profilin1 after 1 h exposure to H2O2 at similar concentrations. Noted that cofilin2 mRNA decreased after 1 h of H2O2 exposures, and the decreases were statistically significant for 1.0 and 2.0 mM. Such decreases in cofilin2 after 1 h H2O2 exposures are opposite to the increase responds observed after 24 h exposures. Thymosin beta 4 mRNA expressions appeared lower than the control after 1 h H2O2 treatment, but the changes were not
significant. Profilin1 expressions after 1 h exposures were lower than the control, except for 2 mM treatment group. Only the difference between the control group and the 1 mM treatment group was significant. Translational Expression of the Core Proteins Involved in Actin Filament Polymerization Dynamics The translational expression levels of cofilin2, thymosin beta 4 and profilin1 after 24 h H2O2 exposures were shown in Fig. 6. The translational expression of cofilin2 (Fig. 6b) was increased by 35 and 38% after 0.5 and 1.0 mM H2O2 treatments respectively. In the 2.0 mM treatment group, cofilin2 expression was only 2% higher than that in the control group. The difference between control group and 1 mM group found to be significant statistically. The expression of thymosin beta 4 (Fig. 6c) was up-regulated by 17% in the
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
Cofilin2
1.8
**
1.6
Thymosin beta 4 1.6
*
1.4
Relave fold change
(b) relave fold change
(a)
1.2 1 0.8 0.6 0.4 0.2
1183
*
1.4 1.2 1 0.8
**
0.6 0.4 0.2 0 CTL
0 CTL
0.5mM
1.0mM
2.0mM
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
H2O2 treatment concentraon
Profilin1
2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
*
*
(d)
beta acn
1.2
Relave fold change
Relave fold change
(c)
1 0.8 0.6 0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
FIGURE 3. Real-time PCR results of the expression of the core proteins regulating actin filament polymerization dynamics after 24 h of H2O2 exposure. (a) Cofilin2, (b) thymosin beta 4, (c) profilin1 and (d) beta actin. While the transcriptional expression of cofilin2 and profilin1 showed an overall up-regulation after various H2O2 treatment, thymosin beta 4 mRNA was up-regulated at 0.5 mM treatment concentration and then down-regulated when H2O2 concentration at 1.0 and 2.0 mM. Beta actin mRNA did not show significant difference. Data presented here were the mean 6 SD of the relative folds of change between the control groups and the treatment groups, from three individual experiments. The statistical significance of the differences between the control and the treatment groups were based on two tails t-test (*p < 0.05; **p < 0.01).
0.5 mM treatment group, and became down-regulated by 28 and 37% after 1.0 and 2.0 mM H2O2 was applied for 24 h. However, the statistical significances could only be established in 1.0 mM treatment group. The expression of profilin1 (Fig. 6d) was significantly enhanced by 45, 89, and 61% in the 0.5, 1.0, and 2.0 mM treatment group respectively. Beta actin (Fig. 6e) showed 18, 2, and 7% increases after 0.5, 1.0, and 2.0 mM H2O2 treatment for 24 h respectively. Only the change at 0.5 mM treatment was found statistically significant. GAPDH (Fig. 6f) was used as a housekeeping gene for internal control. Intracellular ROS Level After H2O2 Treatment Intracellular ROS level was measured by commercial assay kit. The detailed fold change of each treatment group and time point relative to the control at time zero was shown in Table 3. Intracellular ROS
increased dramatically within 1 h after the H2O2 was added and then increased gradually with time. The initial rush of intracellular ROS depended on the concentration of the extrinsic H2O2 treatment. The subsequent rates of increase after the rush were similar among the three treatment groups.
DISCUSSION Actin filaments contribute to cell mechanics by modifying its network structure dynamically. The dynamics equilibrium of the actin filaments network is normally maintained to keep proper cell shape and flexibility. The possible interactions between H2O2 with the core regulatory proteins have been reported in other cell types6–11; The present work represents how H2O2 regulates the expression cofilin2, thymosin beta 4 and profilin1 in C2C12 myotubes.
1184
WONG et al.
(a)
2hrs H2O2 treatment
120%
Relave sffness
100% 80%
**
60% 40% 20% 0%
(b)
CTL
(c)
Cofilin2
1.0mM
2.0mM
(d)
Thymosin beta 4
1.2 1 0.8 0.6 0.4 0.2 CTL
0.5mM
1mM
*
1
*
Relave fold change
1.2
Relave fold change
Relave fold change
1.4
0
0.5mM
*
0.8 0.6 0.4 0.2
1 0.8 0.6 0.4 0.2 0
0
2mM
Profilin1 1.2
CTL
H2O2 treatment concentraon
0.5mM
1.0mM
CTL
2.0mM
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
H2O2 treatment concentraon
FIGURE 4. (a) The stiffness of myotubes after 2 h H2O2 treatment. (b, c, and d) Transcriptional expression of cofilin2, thymosin beta 4 and profilin1. Significant down-regulation was recorded in thymosin beta 4 mRNA expression, while cofilin2 and profilin1 did not show significant changes. The statistical significance between control group and treatment groups was based on two tails t-test (*p < 0.05).
(a)
1hr H2O2 treatment 140%
Relave Sffness
*
*
120% 100% 80% 60% 40% 20% 0%
(c)
Cofilin2
0.8
*
0.6 0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
Relave fold change
Relave fold change
*
1.0mM
2.0mM
(d)
Thymosin beta 4
1.2
1.2 1
0.5mM
1 0.8 0.6 0.4 0.2 0
Profilin1
1.2
Relave fold change
(b)
CTL
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
*
1 0.8 0.6 0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
FIGURE 5. (a) The stiffness of myotubes after 1 h H2O2 treatment (b, c, and d). The transcriptional expression of cofilin2, thymosin beta 4 and profilin1. Down-regulation of cofilin2 mRNA after 1 mM and 2 mM H2O2 treatments, and the down-regulation of profilin1 after 1 mM treatment were shown to be significant. The statistical significance between control group and treatment groups was based on two tails t-test (*p < 0.05).
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization CTL
(b)
0.5mM 1.0mM 2.0mM
Relave fold change
Cofilin 2 Thymosin beta 4 Profilin 1
(c)
Cofilin2
Thymosin beta 4 1.4
1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
*
CTL
Relave fold change
(a)
1185
1.2 1
*
0.8 0.6 0.4 0.2 0
0.5mM 1.0mM 2.0mM
H2O2 treatment concentraon
CTL
0.5mM 1.0mM 2.0mM
H2O2 treatment concentraon
Beta acn GAPDH
(e)
**
*
*
0.5mM
1.0mM
2.0mM
*
1.2 1 0.8 0.6 0.4 0.2 0
CTL
(f)
Beta acn 1.4
Relave fold change
Profilin1 2.2 2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
Relaive fold change
Relave fold change
(d)
CTL
0.5mM 1.0mM 2.0mM
GAPDH 1.4 1.2 1 0.8 0.6 0.4 0.2 0
H2O2 treatment concentraon
H2O2 treatment concentraon
CTL
0.5mM 1.0mM 2.0mM
H2O2 treatment concentraon
FIGURE 6. Western blot results of the translational expression of the core proteins regulating the actin filament polymerization dynamics after 24 h of H2O2 treatment. (a) The membrane signal on the immunostained PVFD membrane. (b, c, d, e, and f) Quantification of the signals of cofilin2, thymosin beta4, profilin1, beta actin and GAPDH in various treatment groups. The expression of cofilin2, thymosin beta4, profilin1showed a trend similar to the real-time PCR results. Data presented here were the mean 6 SD obtained from three individual experiments. The statistical significance between the control group and treatment groups was based on two tails t-test (*p < 0.05; **p < 0.01). TABLE 3. Relatively fold changes of intracellular H2O2 fluorescent signals after extrinsic H2O2 treatments for different concentrations and durations.
CTL 0.5 mM 1.0 mM 2.0 mM
0h
SD
1h
SD
2h
SD
24 h
SD
1 15.96 21.71 20.63
– ±1.76 ±2.06 ±3.71
4.38 107.88 175.83 233.74
±0.24 ±10.79 ±29.89 ±58.43
5.66 110.15 178.85 237.40
±0.34 ±11.02 ±30.76 ±59.35
22.97 123.99 195.35 253.92
±0.57 ±12.28 ±33.01 ±62.21
To study the responses of myotubes under oxidative condition, H2O2 was used as extrinsic oxidative agent. Bright field images showed that the morphology of myotubes could be affected by H2O2 after 24 h exposures. Phalloidin staining revealed that F-actin was diminished after H2O2 treatments. Such decreases in F-actin affected the cytoskeleton network. The narrowed cell shape shown in bright field images was associated with the reduction of F-actin after H2O2 treatments. F-actin is the product of polymerization of actin monomers. Decreases in F-actin indicated that the actin filament dynamic equilibrium had been affected.
Real-time PCR and Western blot were used to examine the transcriptional and translational expression of the core proteins regulating actin filament polymerization dynamics. Transcriptional and translational expressions of these three regulatory proteins showed similar trends of responses after various concentrations of H2O2 treatments for 24 h. In 0.5 mM H2O2 treatment group, all the three regulatory proteins were up-regulated. In this treatment group, the effects of the increased cofilin2 expression, which promotes actin filament depolymerization, apparently dominated, resulting in a slight decrease in actin filaments.
1186
WONG et al.
With 24 h H2O2 exposures at 1.0 and 2.0 mM, the expressions of cofilin2 and profilin1 further increased relative to the control; meanwhile thymosin beta 4 decreased. Since thymosin beta 4 competes with cofilin2 to bind with actin molecules, the downregulation of thymosin beta 4 would give bigger opportunity for cofilin2 to bind with actin for depolymerization. Together with the up-regulations of cofilin2, down-regulating thymosin beta 4 would shift the actin filament polymerization dynamics to the depolymerization side. When depolymerization became dominant, the number of actin filaments became fewer. These results are consistent with the observation that the fluorescent intensity of phalloidin became significantly lower after 24 h H2O2 exposures at 1.0 mM and 2.0 mM. The expression of beta actin did not showed significant decrease, indicating that the decrease in F-actin was not due to the down-regulation of beta actin. Profilin1, which promotes actin filament polymerization, was also up-regulated after H2O2 treatments. Under this condition, the presence of F-actin should be increased. However, this was not shown in the optical records. We hypothesize that this profilin1 up-regulation was the cell’s response to itself, trying to promote polymerization to compensate for the lost of F-actin under prolong oxidative condition. How exactly this profilin1 up-regulation contributed to the event has yet to be more clearly worked out. The three regulatory proteins were first up-regulated at low H2O2 concentration and then became downregulated at high concentration (except profilin1). This suggested a critical H2O2 treatment concentration may fall between 0.5 and 1.0 mM. Once this threshold is crossed, the critical response of thymosin beta 4 was apparently triggered. The detail of this critical point needs further investigation. Since actin filaments, the major structural components of cells, were diminished after prolong H2O2 insults, the mechanical properties of the cells were likely to be affected. This hypothesis was supported by our mechanical measurements using AFM. Our results revealed that myotubes became softer after 24 h of H2O2 treatment. The softening effect was most obvious in the 24 h 2.0 mM treatment group, with only 1/3 of the stiffness remaining compared to the control. We have also examined the effects of short exposure of H2O2 on myotubes. After 2 h of H2O2 treatment, only thymosin beta 4 showed significant down-regulation, while cofilin2 and profilin1 did not exhibit significant changes (Figs. 4b, 4c, and 4d). Such decrease in thymosin beta 4 favored the depolymerization of the
actin filaments. The myotube stiffness at 2.0 mM became significantly lower relative to the control (Fig. 4a). Comparatively, the stiffness decrease after 2 h exposure to 2.0 mM H2O2 was not as much as the 24 h exposure group, indicating that the softening effect may accumulate with the duration of oxidative exposures. Interestingly, the AFM results showed that the myotubes became slightly stiffer after 1 h of oxidative exposures (Fig. 5a). After 1 h treatment, cofilin2 mRNA expression was down-regulated, while thymosin beta 4 and profilin1 did not show significant changes (Figs. 5b, 5c, and 5d). The down-regulation of cofilin2 lowered the rate of actin depolymerization, Along with this enhancement of actin polymerization, the myotube stiffness increased. After 24 h of H2O2 treatment, phalloidin staining fluorescent intensity showed a significant decrease from 0.5 to 1.0 mM treatment concentration, but AFM showed that cultured myotubes were slightly stiffer after 1.0 mM than 0.5 mM H2O2 treatments. Though the difference is not statistically significant, this is somewhat unexpected. This suggested that other factors like the mechanical properties of actin filament, or the cross-linking of cytoskeleton also contribute to the overall cell stiffness. Our data provided only one of the reasons affecting the overall stiffness. We have measured the intracellular ROS levels after extrinsic H2O2 treatment (Table 3). Interestingly, the major rush of intracellular ROS occurred within the first hour after H2O2 added to the culture and then gradually climbed up with a similar rate in all treatment groups. AFM data showed the stiffness decreased dramatically from 1 to 2 h after H2O2 was introduced and further decreased with a much slower rate till 24 h. It implied that the relationship between intracellular ROS level and cell stiffness was highly non-linear and some critical time constants might be involved. Our group has conducted a separate study to investigate what would happen to the actin filaments when H2O2 was removed after prolonged exposure. Data indicated that the density of actin filaments was partially reverted 2 h after 0.5 mM H2O2 was removed,20 suggesting that the compromising effect of H2O2 on the cytoskeleton may be a reversible process, particularly when the oxidative exposure is mild. Further investigation is still undergoing. Under prolong exposure of oxidative stress, muscle cells lose their cytoskeletal stability and stiffness, thus compromising their resistance to deformation. The same mechanical loading would cause a larger cell deformation, potentially making the affected cells more vulnerable to mechanical damage. Such a scenario could be significant in clinical situations, such as
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
chronic inflammation in the context of rehabilitation medicine and sports medicine.
CONCLUSION Short exposure to H2O2 apparently increased the stiffness of myotubes, but then with longer exposure, the cells became softer. The turning point seems to take place somewhere between the first and second hour of H2O2 exposure. The decrease in the overall myotube stiffness after prolong exposure to H2O2 was associated with changes in the myotube cytoskeleton. The presence of actin filament in myotubes notably decreased after 24 h of H2O2 treatment. This was probably due to the down-regulation of thymosin beta 4 and the up-regulation of cofilin2, eventually shifting the actin filament polymerization dynamics to the depolymerization side. ACKNOWLEDGMENTS This study was supported by General Research Fund from the Hong Kong Research Grants Council (RGC Ref. No.: CUHK415413).
DISCLOSURE No potential conflicts of interests exist.
REFERENCES 1
Bradamante, S., A. Villa, S. Versari, L. Barenghi, I. Orlandi, and M. Vai. Oxidative stress and alternations in actin cytoskeleton trigger glutathione efflux in Sccharomyces cerevisiae. Biochim. Biophys. Acta 1803(12):1376– 1385, 2010. 2 Dedova, I. V., O. P. Nikolaeva, D. Safer, E. M. DeLa Cruz, and C. G. Remedios. Thymosin beta 4 induces a conformational change in actin monomers. Biophys. J . 90(3):985–992, 2006. 3 Goldschmidt-Clermont, P. J., M. I. Furman, D. Wachsstock, D. Safer, V. T. Nachmias, and T. D. Pollard. The control of actin nucleotide exchange by thymosin beta 4 and profilin. A potential regulatory mechanism for actin polymerization in cells. Mol. Biol. Cell 3(9):1015–1024, 1992. 4 Henson, J. H. Relationship between the actin cytoskeleton and cell volume regulation. Microsc. Res. Tech. 47(2):155– 162, 1999. 5 Huot, J., F. Houle, F. Marceau, and J. Landry. Oxidative stress-induced actin reorganization mediated by the p38 mitogen-activated protein kinase/heat shock protein 27 pathway in vascular endothelial cells. Circ. Res. 80(3):383– 392, 1997. 6 Kim, J. S., T. Y. Huang, and G. M. Bokoch. Reactive oxygen species regulate a slingshot-cofilin activation pathway. Mol. Biol. Cell 20(11):2650–2660, 2009.
7
1187
Klemke, M., and Y. Samstag. Molecular mechanisms mediating oxidative stress-induced T-cell suppression in cancer. Adv. Enz. Reg. 49:107–112, 2009. 8 Kumar, S., and S. Gupta. Thymosin beta 4 prevents oxidative stress by targeting antioxidant and anti-apoptoic genes in cardic fibrolabsts. PLoS ONE 6(11):e26912, 2011. 9 Lassing, I., F. Schmitzberger, M. Bjo¨rnstedt, A. Holmgren, P. Nordlund, C. E. Schutt, and U. Lindberg. Molecular and structural basis for redox regulation of b-actin. J. Mol. Biol. 370:331–346, 2007. 10 Lee, C. K., H. J. Park, H. H. So, H. J. Kim, K. S. Lee, W. S. Choi, H. M. Lee, K. J. Won, T. J. Yoon, T. K. Park, and B. Kim. Proteomic profiling and identification of cofilin responding to oxidative stress in vascular smooth muscle. Proteomics 6:6455–6475, 2006. 11 Pujol, N., C. Bonet, F. Viella, M. I. Petkova, A. MozoVillarias, and M. A. D. L. Torre-Ruiz. Two proteins from Saccharomyces cerevisiae: Pfy1 and Pkc1, play a dual role in activating actin polymerization and in increasing cell viability in the adaptive response to oxidative stress. FEMS Yeast Res. 9(8):1196–1207, 2009. 12 Radmacher, M. Measuring the elastic properties of living cells by the atomic force microscope. Methods Cell Biol. 68:67–90, 2002. 13 Scharffetter-Kochanek, K., M. Wlaschek, P. Brenneisen, M. Schauen, R. Blaudschun, and J. Wenk. UV-induced reactive oxygen species in photocarcinogenesis and photoaging. Biol. Chem. 387(11):1247–1257, 1997. 14 Scott, W., J. Stevens, and S. A. Binder-Macleod. Human skeletal muscle fiber type classifications. Phys. Ther. 81(11):1810–1816, 2001. 15 Shi, H., X. Shi, and K. J. Liu. Oxidative mechanism of arsenic toxicity and carcinogenesis. Mol. Cell. Biochem. 255(1–2):67–78, 2004. 16 Svitkina, T. M., A. B. Verkhovsky, and G. G. Borisy. Plectin siderarms mediate interaction of intermediate filaments with microtubules and other components of the cytoskeleton. J. Cell Biol. 135(4):991–1007, 1996. 17 Taylor, R., and T. James. The role of oxidative stress in the development and persistence of pressure ulcers. In: Pressure Ulcer Research: Current and Future Perspectives, edited by D. L. Bader, C. Bouten, D. Colin, and C. W. J. Oomens. Berlin: Springer, 2005, pp. 205–232. 18 Verma, S., P. W. M. Fedak, R. D. Weisel, J. Butany, V. Rao, A. Maitland, R. K. Li, B. Dhillon, and T. M. Yau. Fundamentals of reperfusion injury for the clinical cardiologist. Circulation 105(20):2332–2336, 2002. 19 Xiao, D. Z. T., S. Y. Q. Wu, and A. F. T. Mak. Accumulation of loading damage and unloading reperfusion injury-modeling of the propagation of deep tissue ulcers. J. Biomech. 47(7):1658–1664, 2014. 20 Yao Y., S. W. Wong, L. Bian, A. F. T. Mak. Effect of Oxidative Stress on the Actin Filamentous Structure and the Compressive Damage Threshold of C2C12 Cells. Abstract submitted to The 7th World Congress of Biomechanics. Boston, July 2014. 21 Yarmola, E. G., E. S. Klimenko, G. Fujita, and M. R. Bubb. Thymosin beta4: actin regulation and more. Ann. NY Acad. Sci. 1112:76–85, 2007. 22 Yeoh, S., B. Pope, H. G. Mannherz, and A. Weeds. Determining the differences in actin binding by human ADF and cofilin. J. Mol. Biol. 315(4):911–925, 2002. 23 Zhang, H. J., L. Xu, V. J. Drake, L. Xie, L. W. Oberley, and K. C. Kregel. Heat-induced liver injury in old rats is associated
1188
WONG et al.
with exaggerated oxidative stress and altered transcription factor activation. FASEB J. 17(15):2293–2295, 2003. 24 Zhou, L., Y. Li, and B. Y. Yue. Oxidative stress affects cytoskeletal structure and cells matrix interactions in cells from an ocular tissue: the trabecular meshwork. J. Cell. Physiol. 180(2):182–189, 1999.
25
Zhu, D., K. S. Tan, X. Zhang, A. Y. Sun, G. Y. Sun, and J. C. Lee. Hydrogen peroxide alters membrane and cytoskeleton properties and increase intercellular connections in astrocytes. J. Cell Sci. 118(Pt 16):3695–3703, 2005.
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization SING WAN WONG,1 SHAN SUN,2 MICHAEL CHO,2 KENNETH K. H. LEE,3 and ARTHUR F. T. MAK1 1 Division of Biomedical Engineering, The Chinese University of Hong Kong, Shatin, Hong Kong; 2Department of Bioengineering, University of Illinois at Chicago, Chicago, IL, USA; and 3Key Laboratory for Regenerative Medicine, School of Biomedical Sciences, The Chinese University of Hong Kong, Shatin, Hong Kong
(Received 26 June 2014; accepted 29 October 2014; published online 5 November 2014) Associate Editor Estefanı´ a Pen˜a oversaw the review of this article.
suggested to be related to oxidative stress.17 While prolonged and excessive loading is believed to be one of the major causes contributing to the development of pressure ulcer, reperfusion-induced oxidative stress may further compromise the load-carrying capacity of skeletal muscle cells and make them more vulnerable to biomechanical damage in subsequent reloading.19 Actin filaments are the most abundant components of the cytoskeleton. Along with supporting the cell shape, actin filaments serve critical roles in skeletal muscle contraction.14 Actin filaments exist in a dynamic state, constantly being assembled and disassembled. Such polymerization and depolymerization processes allow the cells to respond to different biomechanical situations. For instance, it will, together with linker proteins like alpha actinin, form bundlelike structures to resist external tensile stresses,16 or modify themselves to sustain extrinsic compressive loads.4 The process of actin polymerization has been described.3 A regulatory protein profilin1 takes actin monomers (G-actin) in the cytoplasm to form an actin filament (F-actin). At the same time, another regulatory protein cofilin (in muscle cells, cofilin present as isoform-2, i.e., cofilin2) takes an actin monomer out of the filament. The above process involves ATP/ADP conversion. Profilin1 brings an actin monomer with ATP to an actin filament, and the ATP would then be hydrolyzed to become ADP. Cofilin recognizes the ADP-actin and cut them off from the actin filament.22 The ADP-actin would then become ATP-actin for recycles. Thymosin beta 4 competes with cofilin2 to bind with actin and interacts with profilin1 to form a ternary complex.2,21 The effects of oxidative stress on cytoskeleton have been reported for a number of tissues. Examples
Abstract—Skeletal muscles often experience oxidative stress in anaerobic metabolism and ischemia–reperfusion. This paper reports how oxidative stress affects the stiffness of cultured murine myotubes and their actin filaments polymerization dynamics. H2O2 was applied as an extrinsic oxidant to C2C12 myotubes. Atomic force microscopy results showed that short exposures to H2O2 apparently increased the stiffness of myotubes, but that long exposures made the cells softer. The turning point seemed to take place somewhere between 1 and 2 h of H2O2 exposure. We found that the stiffness change was probably due to actin filaments being favored for depolymerization after prolong H2O2 treatments, especially when the exposure duration exceeded 1 h and the exposure concentration reached 1.0 mM. Such depolymerization effect was associated with the down-regulation of thymosin beta 4, as well as the up-regulation of both cofilin2 and profilin1 after prolong H2O2 treatments. Keywords—Oxidative stress, Myotubes, Cell stiffness, Actin filament, Cofilin2, Thymosin beta 4.
INTRODUCTION Oxidative stress is a physiological condition caused by the excessive presence of reactive oxygen species (ROS). ROS can be normal metabolites during anaerobic respiration, and can also be by-products of processes caused by UV,13 heat23 and chemical toxins.15 Reperfusion, namely the re-entering of blood to the previously ischemic tissues, is a situation that can generate a large amount of ROS and present major clinical challenges, such as in strokes and heart attacks.18 Pressure ulcer is another clinical challenge Address correspondence to Arthur F. T. MAK, Division of Biomedical Engineering, The Chinese University of Hong Kong, Shatin, Hong Kong. Electronic mail: [email protected]
1178 0090-6964/15/0500-1178/0
2014 Biomedical Engineering Society
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
include vascular endothelial cells,5 eyes,24 astrocytes25 and Saccharomyces cerevisiae.1 This study seeks to address how exposures to hydrogen peroxide (H2O2) as an extrinsic oxidative agent may affect the stiffness of cultured myotubes and how such effects may be associated with changes in the polymerization dynamics of the myotube cytoskeleton.
MATERIALS AND METHODS Cell Culture and Oxidative Stress Mouse myogenic C2C12 cells line was obtained from ATCC (#CRL-1772). The cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM), 10% Fetal Bovine Serum (FBS) plus 1% Penicillin– Streptomycin (P–S). The cells were cultured in a 5% CO2 and 37 C incubator until it reached 90% confluence and then the culture medium was replaced by DMEM + 2% FBS + 1% P–S for 4 days to induce myotubes differentiation. H2O2 diluted with differentiation medium to 0.5, 1.0, and 2.0 mM was applied into the myotubes cultures for various durations to simulate different oxidative environments. Confocal Imaging for Actin Filaments Myotubes were cultured on 12 mm round glass cover slips inserted into 4-well culture plates. After 24 h treatment with H2O2, the samples were washed twice in PBS and then fixed with 10% formalin made up in PBS for 10 min. The fixative was then removed and the samples were washed with PBS twice. 0.1% tritonX-100 (USB, #22686) in PBS was applied for 10 min to permeablize the cells and the cells were then stained with FITC-labeled phalloidin (1:40 dilution, Sigma-Aldrich P-5282) to reveal the F-actin filaments. After 3 h incubation, the cells were washed with PBS with 0.1% Tween20 (USB, #20605) for three times to remove unbound phalloidin. The stained cultures were counterstained with 4 lg/mL of DAPI and mounted onto a glass slide. The samples were then examined using an Olympus, FluoView 1000 confocal microscope. The fluorescence intensity was quantified using a software MetaMorph. Atomic Force Microscopy The myotube stiffness was measured by atomic force microscopy (AFM) (Novascan Technologies, Ames, IA). The AFM probe was a glass sphere with 10 lm diameter and the spring constant of the cantilever was 0.12 N/m. This probe applied a micro-indentation to the myotubes with a velocity of ~0.1 mm/s to obtain a force–displacement curve. When 200 nm displacement
1179
was reached, the probe was then retracted. Hertz Model was applied to calculate the Young’s modulus of the cells as follows: F¼
pffiffiffiffi 4 E d3=2 R 2 3 ð1 t Þ
where F is the loading force, d the indentation depth, m the Poisson’s ratio, R the radius of the spherical indenter, and E is the Young’s modulus. The Poisson’s ratio was set to be 0.5 as cells were assumed as intrinsically incompressible.12 Three different positions were measured on each individual myotube, and 30 cells of each sample were selected for the measurement. The final Young’s modulus was the average value of all these data. Real-Time PCR (qPCR) The control and the H2O2-treated myotubes were processed for qPCR. The cultures were washed with DEPC-treated PBS. Then 1 mL of RNAiso Plus (TaKaRa #9109) was added to the cultures for total RNA extraction. 200 lL of chloroform was added to each samples and mixed vigorously to allow phase separation. Then, the extracts were centrifuged at 12,500 rpm and 4 C for 20 min. The upper layer, which contained the total RNA, of each sample was then transferred into a new tube. 500 lL of isopropanol was added to each of the tubes and mixed gently. The samples were allowed to stand at room temperature for 10 min for RNA precipitation. Same centrifugation protocol was performed and the supernatants were discarded. 1 mL of 75% DEPC-EtOH was then added, vortexed, and centrifuged at 7500 rpm, 4 C for 5 min to remove the unwanted salts. The samples were then allowed to air dry to let the remaining DEPCEtOH evaporate. 20 lL of DEPC-H2O was used to resuspend the RNA pellet and was then warmed up to 65 C for 10 min. The concentration of total RNA was measured using Nanodrop. 1 lg of total RNA was reverse transcribed by using RevertAidTM First Strand cDNA Synthesis Kit (Fermetas, K1622) to convert the mRNA to cDNA. The cDNAs were used for qPCR assay using the primers shown in Table 1. SYBE green reaction kit from TaKaRa (DRR041A) was used for qPCR. The reaction was performed in an Abi viia7 real-time PCR machine with 2(2DDCt) method while GAPDH was used as the housekeeping gene for internal control. Western Blot The control and the H2O2 exposed myotubes were treated with 100 lL of RIAP lysis buffer and agitated with a swapper for protein extraction. The lysate were
1180
WONG et al.
TABLE 1. Primer sequences used for the real time PCR assays. Beta-actin mRNA Profilin1 mRNA Cofilin2 mRNA Thymosin beta 4 mRNA GAPDH mRNA
F: ccaccatgtacccaggcatt R: cgctcaggaggagcaatgat F: ggaacgcctacatcgacagc R: tgcctaccaggacaccaacc F: tcccgttcgtgaatgagtga R: actgcaaggaaggcatggaa F: tgacaaacccgatatggctga R: cgctcgcctcattacgattc F: atcctgcaccaccaactgct R: gggccatccacagtcttctg
F, forward primer; R, reverse primer.
Statistical Analysis Two-tailed t test was used to compare the results of the H2O2 treated groups with that of the control group. Statistical significance was affirmed when p < 0.05.
RESULTS Morphological Changes of C2C12 Myotubes After H2O2 Treatment Figure 1 showed the morphological records of C2C12 cells cultured at different stages—(a): myoblasts at confluence, ready for the subsequent differentiation process; (b): cells 4 days after differentiation initiated, showing tubular sturcture significantly different from the myoblasts, indicating myotubes differentiation was successful; and (c): myotubes after 24 h of H2O2 exposure at 1.0 mM, showing gaps between the myotubes (white arrows).
then transferred into 1.5 mL tube and centrifuged at 12,000 rpm, 4 C for 10 min. The supernatants containing the proteins were collected and mixed with 69 SDS buffer and heated to 95 C for 5 min. 50 lg of proteins from each sample was loaded onto a standard SDS-PAGE for separation. The resolved proteins were transferred by semi-dry method onto a PVDF membrane at 300 mA for 60 min. The membranes were then blocked with 5% non-fat dry milk in TBS for 1 h. GAPDH (Sigma, G8795), beta actin (Santa Cruz, SC-8432), profilin1 (abcam, ab124904), thymosin beta 4 (abcam, ab14335) and cofilin2 (abcam, ab14134) was used as a primary antibodies at 1:2000 dilution to incubate overnight. The membrane was washed with TBST three times and TBS twice in the following day. Donkey anti-Mouse IRDye 680LT antibody (Li-Cor, 926-68022) and donkey anti-rabbit IRDye 800CW antibody (Li-Cor, 926-32213) were used as secondary antibody (1:3000 dilution) and incubated at room temperature for 3 h. The immunostained membranes were washed with the above procedure and scanned by using an Odyssey Infrared Imaging System. The signal intensity was measured using MetaMorph.
The presence of F-actin was detected by phalloidin staining since phalloidin specifically binds to F-actin filaments. The fluorescence images were shown in Fig. 2. For the control group (Fig. 2a), the fluorescence intensity was highest compared to those treatment groups. After 0.5, 1.0, and 2.0 mM H2O2 exposures for 24 h (Figs. 2b, 2c, and 2d), the fluorescence intensities of the myotubes cultures decreased by 23, 48, and 71% respectively and these differences were statistically significant (Fig. 2e). The decrease of the fluorescence intensity implied the diminished presence of actin filaments. Such H2O2 effects were found to be dose-dependent.
Intracellular ROS Level
Cells Stiffness After H2O2 Treatment
Myotubes were cultured in a black 96-well plate as described above for intracellular ROS level assay. OxiSelect Intracellular ROS Assay kit (STA-342, Cell bio labs) was applied to measure the ROS level within the cells after 0.5, 1.0, and 2.0 mM treatment for 1, 2, and 24 h. The assay revealed the intracellular ROS level by a reaction between ROS and DCFH. The higher concentration of ROS present within the cells, the higher is the fluorescent signal. The fluorescent signal was measured by Molecular Devices SpectraMax i3 multimode spectrophotometer (MD). Control group (without H2O2 treatment) at time zero (immediately after H2O2 added to the culture) was used as baseline. The fold change of each treatment group and time point was calculated relative to the baseline.
Table 2 summarized the averages of the myotube stiffness after 1, 2, and 24 h H2O2 exposures at various concentrations. After 24 h of H2O2 exposures, the Young’s moduli of myotubes decreased by about 42 and 39% after 0.5 and 1.0 mM treatments respectively. In the 2.0 mM group, the decrease in stiffness reached 66%. These differences reached statistical significance with p < 0.01. For 2 h exposures to H2O2 at similar concentrations, the dose-dependent decreasing trend was similar to that for the 24 h exposures, except that the effects were smaller and only the 2.0 mM result was statistically different from the control. It is interesting that for 1 h exposures to H2O2 at similar concentrations, the myotubes exhibited a stiffening trend instead of a softening trend. The Young’s
Effect of H2O2 on the Actin Filaments
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
1181
FIGURE 1. Representative bright field microscopic images of C2C12 cells in culture. (a) Appearance of confluent myoblasts. (b) Myotubes after inducing the myoblasts to differentiate for 4 days. (c) Appearance of myotubes treated with 1.0 mM H2O2 for 24 h. (3100).
modulus of myotubes were 13, 7, and 23% higher than the control after 1 h of exposure to 0.5, 1.0, and 2.0 mM H2O2 respectively. The above differences were found to be statistically significant for the 0.5 and 2.0 mM groups. Transcriptional Analysis of the Core Proteins Regulating Actin Filament Polymerization Dynamics Real time PCR results of cofilin2, thymosin beta 4, profilin1 and beta actin in myotubes after 24 h of H2O2 exposures were shown in Fig. 3. Cofilin2 mRNA (Fig. 3a) showed 29 and 53% up-regulation after 0.5 and 1.0 mM of H2O2 treatments, while the up-regulation effect returned to 27% for the 2.0 mM treatment group. In this study, only the changes in 0.5 and 1.0 mM
treatments were found to be statistically significant. Thymosin beta 4 (Fig. 3b) was up-regulated by 22% after 0.5 mM H2O2 treatment for 24 h. The mRNA was down-regulated by 33 and 60% after 1.0 and 2.0 mM of H2O2 was applied. However, the down-regulation at 1.0 mM treatment group was not found to be statistically significant. Profilin1 mRNA (Fig. 3c) expression was up-regulated 15, 40, and 60% after 0.5, 1.0, and 2.0 mM H2O2 treatments for 24 h respectively. The changes in 1.0 and 2.0 mM treatments were found to be statistically significant. The expression of beta actin mRNA (Fig. 3d) decreased 8% in the 0.5 and 1.0 mM treatment groups, but the statistical significances of those changes could not be established in this study. The expression of the corresponding mRNA was nearly unchanged after 24 h of exposure to 2.0 mM H2O2.
1182
WONG et al.
(a)
(b) 0.5mM H2O2
Control
(c)
Relavely fluorescence intensity
(e)
(d)
1.0mM H2O2
2.0mM H2O2
1.2 1
**
0.8
**
0.6
**
0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
FIGURE 2. Confocal images of myotubes stained with phalloidin to reveal the arrangement of the actin filaments. (a) Myotubes without H2O2 treatment. (b, c, and d) myotubes treated with 0.5, 1.0, and 2.0 mM of H2O2 for 24 h respectively. In the presence of H2O2, there was a dose-dependent decrease of actin filaments in the myotubes. (e) Relative changes in fluorescence intensity between the control group and the H2O2 treated groups, with statistical significance based on two-tail t-test (**p < 0.01) (Blue: nuclei stained with DAPI; Green: F-actin filaments stained with Phalloidin) (3400). TABLE 2. Percentage changes of myotubes stiffness after various H2O2 treatments relative to their corresponding control groups. 1 h (%) 0.5 mM 1.0 mM 2.0 mM
+13* +7 +23*
SD (%) ±6.8 ±6.6 ±6.1
2 h (%)
SD (%)
216 211 249**
±7.4 ±5.4 ±5.4
24 h (%) 242** 239** 266**
SD (%) ±7.5 ±7.6 ±6.3
Statistical significance was based on two tails t-test (*p < 0.05; **p < 0.01).
For 2 h of H2O2 exposures at similar concentrations, the changes in cofilin2, thymosin beta 4, and profilin1 mRNA were presented in Figs. 4b, 4c, and 4d respectively. Only the decreased expressions of thymosin beta 4 were statistically significant. It is interesting to note that profilin1 expressions were all lower compared to the control, which are opposite to the results observed after a prolong exposure for 24 h. Figures 5b, 5c, 5d show the changes in cofilin2, thymosin beta 4, and profilin1 after 1 h exposure to H2O2 at similar concentrations. Noted that cofilin2 mRNA decreased after 1 h of H2O2 exposures, and the decreases were statistically significant for 1.0 and 2.0 mM. Such decreases in cofilin2 after 1 h H2O2 exposures are opposite to the increase responds observed after 24 h exposures. Thymosin beta 4 mRNA expressions appeared lower than the control after 1 h H2O2 treatment, but the changes were not
significant. Profilin1 expressions after 1 h exposures were lower than the control, except for 2 mM treatment group. Only the difference between the control group and the 1 mM treatment group was significant. Translational Expression of the Core Proteins Involved in Actin Filament Polymerization Dynamics The translational expression levels of cofilin2, thymosin beta 4 and profilin1 after 24 h H2O2 exposures were shown in Fig. 6. The translational expression of cofilin2 (Fig. 6b) was increased by 35 and 38% after 0.5 and 1.0 mM H2O2 treatments respectively. In the 2.0 mM treatment group, cofilin2 expression was only 2% higher than that in the control group. The difference between control group and 1 mM group found to be significant statistically. The expression of thymosin beta 4 (Fig. 6c) was up-regulated by 17% in the
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
Cofilin2
1.8
**
1.6
Thymosin beta 4 1.6
*
1.4
Relave fold change
(b) relave fold change
(a)
1.2 1 0.8 0.6 0.4 0.2
1183
*
1.4 1.2 1 0.8
**
0.6 0.4 0.2 0 CTL
0 CTL
0.5mM
1.0mM
2.0mM
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
H2O2 treatment concentraon
Profilin1
2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
*
*
(d)
beta acn
1.2
Relave fold change
Relave fold change
(c)
1 0.8 0.6 0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
FIGURE 3. Real-time PCR results of the expression of the core proteins regulating actin filament polymerization dynamics after 24 h of H2O2 exposure. (a) Cofilin2, (b) thymosin beta 4, (c) profilin1 and (d) beta actin. While the transcriptional expression of cofilin2 and profilin1 showed an overall up-regulation after various H2O2 treatment, thymosin beta 4 mRNA was up-regulated at 0.5 mM treatment concentration and then down-regulated when H2O2 concentration at 1.0 and 2.0 mM. Beta actin mRNA did not show significant difference. Data presented here were the mean 6 SD of the relative folds of change between the control groups and the treatment groups, from three individual experiments. The statistical significance of the differences between the control and the treatment groups were based on two tails t-test (*p < 0.05; **p < 0.01).
0.5 mM treatment group, and became down-regulated by 28 and 37% after 1.0 and 2.0 mM H2O2 was applied for 24 h. However, the statistical significances could only be established in 1.0 mM treatment group. The expression of profilin1 (Fig. 6d) was significantly enhanced by 45, 89, and 61% in the 0.5, 1.0, and 2.0 mM treatment group respectively. Beta actin (Fig. 6e) showed 18, 2, and 7% increases after 0.5, 1.0, and 2.0 mM H2O2 treatment for 24 h respectively. Only the change at 0.5 mM treatment was found statistically significant. GAPDH (Fig. 6f) was used as a housekeeping gene for internal control. Intracellular ROS Level After H2O2 Treatment Intracellular ROS level was measured by commercial assay kit. The detailed fold change of each treatment group and time point relative to the control at time zero was shown in Table 3. Intracellular ROS
increased dramatically within 1 h after the H2O2 was added and then increased gradually with time. The initial rush of intracellular ROS depended on the concentration of the extrinsic H2O2 treatment. The subsequent rates of increase after the rush were similar among the three treatment groups.
DISCUSSION Actin filaments contribute to cell mechanics by modifying its network structure dynamically. The dynamics equilibrium of the actin filaments network is normally maintained to keep proper cell shape and flexibility. The possible interactions between H2O2 with the core regulatory proteins have been reported in other cell types6–11; The present work represents how H2O2 regulates the expression cofilin2, thymosin beta 4 and profilin1 in C2C12 myotubes.
1184
WONG et al.
(a)
2hrs H2O2 treatment
120%
Relave sffness
100% 80%
**
60% 40% 20% 0%
(b)
CTL
(c)
Cofilin2
1.0mM
2.0mM
(d)
Thymosin beta 4
1.2 1 0.8 0.6 0.4 0.2 CTL
0.5mM
1mM
*
1
*
Relave fold change
1.2
Relave fold change
Relave fold change
1.4
0
0.5mM
*
0.8 0.6 0.4 0.2
1 0.8 0.6 0.4 0.2 0
0
2mM
Profilin1 1.2
CTL
H2O2 treatment concentraon
0.5mM
1.0mM
CTL
2.0mM
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
H2O2 treatment concentraon
FIGURE 4. (a) The stiffness of myotubes after 2 h H2O2 treatment. (b, c, and d) Transcriptional expression of cofilin2, thymosin beta 4 and profilin1. Significant down-regulation was recorded in thymosin beta 4 mRNA expression, while cofilin2 and profilin1 did not show significant changes. The statistical significance between control group and treatment groups was based on two tails t-test (*p < 0.05).
(a)
1hr H2O2 treatment 140%
Relave Sffness
*
*
120% 100% 80% 60% 40% 20% 0%
(c)
Cofilin2
0.8
*
0.6 0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
Relave fold change
Relave fold change
*
1.0mM
2.0mM
(d)
Thymosin beta 4
1.2
1.2 1
0.5mM
1 0.8 0.6 0.4 0.2 0
Profilin1
1.2
Relave fold change
(b)
CTL
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
*
1 0.8 0.6 0.4 0.2 0
CTL
0.5mM
1.0mM
2.0mM
H2O2 treatment concentraon
FIGURE 5. (a) The stiffness of myotubes after 1 h H2O2 treatment (b, c, and d). The transcriptional expression of cofilin2, thymosin beta 4 and profilin1. Down-regulation of cofilin2 mRNA after 1 mM and 2 mM H2O2 treatments, and the down-regulation of profilin1 after 1 mM treatment were shown to be significant. The statistical significance between control group and treatment groups was based on two tails t-test (*p < 0.05).
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization CTL
(b)
0.5mM 1.0mM 2.0mM
Relave fold change
Cofilin 2 Thymosin beta 4 Profilin 1
(c)
Cofilin2
Thymosin beta 4 1.4
1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
*
CTL
Relave fold change
(a)
1185
1.2 1
*
0.8 0.6 0.4 0.2 0
0.5mM 1.0mM 2.0mM
H2O2 treatment concentraon
CTL
0.5mM 1.0mM 2.0mM
H2O2 treatment concentraon
Beta acn GAPDH
(e)
**
*
*
0.5mM
1.0mM
2.0mM
*
1.2 1 0.8 0.6 0.4 0.2 0
CTL
(f)
Beta acn 1.4
Relave fold change
Profilin1 2.2 2 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0
Relaive fold change
Relave fold change
(d)
CTL
0.5mM 1.0mM 2.0mM
GAPDH 1.4 1.2 1 0.8 0.6 0.4 0.2 0
H2O2 treatment concentraon
H2O2 treatment concentraon
CTL
0.5mM 1.0mM 2.0mM
H2O2 treatment concentraon
FIGURE 6. Western blot results of the translational expression of the core proteins regulating the actin filament polymerization dynamics after 24 h of H2O2 treatment. (a) The membrane signal on the immunostained PVFD membrane. (b, c, d, e, and f) Quantification of the signals of cofilin2, thymosin beta4, profilin1, beta actin and GAPDH in various treatment groups. The expression of cofilin2, thymosin beta4, profilin1showed a trend similar to the real-time PCR results. Data presented here were the mean 6 SD obtained from three individual experiments. The statistical significance between the control group and treatment groups was based on two tails t-test (*p < 0.05; **p < 0.01). TABLE 3. Relatively fold changes of intracellular H2O2 fluorescent signals after extrinsic H2O2 treatments for different concentrations and durations.
CTL 0.5 mM 1.0 mM 2.0 mM
0h
SD
1h
SD
2h
SD
24 h
SD
1 15.96 21.71 20.63
– ±1.76 ±2.06 ±3.71
4.38 107.88 175.83 233.74
±0.24 ±10.79 ±29.89 ±58.43
5.66 110.15 178.85 237.40
±0.34 ±11.02 ±30.76 ±59.35
22.97 123.99 195.35 253.92
±0.57 ±12.28 ±33.01 ±62.21
To study the responses of myotubes under oxidative condition, H2O2 was used as extrinsic oxidative agent. Bright field images showed that the morphology of myotubes could be affected by H2O2 after 24 h exposures. Phalloidin staining revealed that F-actin was diminished after H2O2 treatments. Such decreases in F-actin affected the cytoskeleton network. The narrowed cell shape shown in bright field images was associated with the reduction of F-actin after H2O2 treatments. F-actin is the product of polymerization of actin monomers. Decreases in F-actin indicated that the actin filament dynamic equilibrium had been affected.
Real-time PCR and Western blot were used to examine the transcriptional and translational expression of the core proteins regulating actin filament polymerization dynamics. Transcriptional and translational expressions of these three regulatory proteins showed similar trends of responses after various concentrations of H2O2 treatments for 24 h. In 0.5 mM H2O2 treatment group, all the three regulatory proteins were up-regulated. In this treatment group, the effects of the increased cofilin2 expression, which promotes actin filament depolymerization, apparently dominated, resulting in a slight decrease in actin filaments.
1186
WONG et al.
With 24 h H2O2 exposures at 1.0 and 2.0 mM, the expressions of cofilin2 and profilin1 further increased relative to the control; meanwhile thymosin beta 4 decreased. Since thymosin beta 4 competes with cofilin2 to bind with actin molecules, the downregulation of thymosin beta 4 would give bigger opportunity for cofilin2 to bind with actin for depolymerization. Together with the up-regulations of cofilin2, down-regulating thymosin beta 4 would shift the actin filament polymerization dynamics to the depolymerization side. When depolymerization became dominant, the number of actin filaments became fewer. These results are consistent with the observation that the fluorescent intensity of phalloidin became significantly lower after 24 h H2O2 exposures at 1.0 mM and 2.0 mM. The expression of beta actin did not showed significant decrease, indicating that the decrease in F-actin was not due to the down-regulation of beta actin. Profilin1, which promotes actin filament polymerization, was also up-regulated after H2O2 treatments. Under this condition, the presence of F-actin should be increased. However, this was not shown in the optical records. We hypothesize that this profilin1 up-regulation was the cell’s response to itself, trying to promote polymerization to compensate for the lost of F-actin under prolong oxidative condition. How exactly this profilin1 up-regulation contributed to the event has yet to be more clearly worked out. The three regulatory proteins were first up-regulated at low H2O2 concentration and then became downregulated at high concentration (except profilin1). This suggested a critical H2O2 treatment concentration may fall between 0.5 and 1.0 mM. Once this threshold is crossed, the critical response of thymosin beta 4 was apparently triggered. The detail of this critical point needs further investigation. Since actin filaments, the major structural components of cells, were diminished after prolong H2O2 insults, the mechanical properties of the cells were likely to be affected. This hypothesis was supported by our mechanical measurements using AFM. Our results revealed that myotubes became softer after 24 h of H2O2 treatment. The softening effect was most obvious in the 24 h 2.0 mM treatment group, with only 1/3 of the stiffness remaining compared to the control. We have also examined the effects of short exposure of H2O2 on myotubes. After 2 h of H2O2 treatment, only thymosin beta 4 showed significant down-regulation, while cofilin2 and profilin1 did not exhibit significant changes (Figs. 4b, 4c, and 4d). Such decrease in thymosin beta 4 favored the depolymerization of the
actin filaments. The myotube stiffness at 2.0 mM became significantly lower relative to the control (Fig. 4a). Comparatively, the stiffness decrease after 2 h exposure to 2.0 mM H2O2 was not as much as the 24 h exposure group, indicating that the softening effect may accumulate with the duration of oxidative exposures. Interestingly, the AFM results showed that the myotubes became slightly stiffer after 1 h of oxidative exposures (Fig. 5a). After 1 h treatment, cofilin2 mRNA expression was down-regulated, while thymosin beta 4 and profilin1 did not show significant changes (Figs. 5b, 5c, and 5d). The down-regulation of cofilin2 lowered the rate of actin depolymerization, Along with this enhancement of actin polymerization, the myotube stiffness increased. After 24 h of H2O2 treatment, phalloidin staining fluorescent intensity showed a significant decrease from 0.5 to 1.0 mM treatment concentration, but AFM showed that cultured myotubes were slightly stiffer after 1.0 mM than 0.5 mM H2O2 treatments. Though the difference is not statistically significant, this is somewhat unexpected. This suggested that other factors like the mechanical properties of actin filament, or the cross-linking of cytoskeleton also contribute to the overall cell stiffness. Our data provided only one of the reasons affecting the overall stiffness. We have measured the intracellular ROS levels after extrinsic H2O2 treatment (Table 3). Interestingly, the major rush of intracellular ROS occurred within the first hour after H2O2 added to the culture and then gradually climbed up with a similar rate in all treatment groups. AFM data showed the stiffness decreased dramatically from 1 to 2 h after H2O2 was introduced and further decreased with a much slower rate till 24 h. It implied that the relationship between intracellular ROS level and cell stiffness was highly non-linear and some critical time constants might be involved. Our group has conducted a separate study to investigate what would happen to the actin filaments when H2O2 was removed after prolonged exposure. Data indicated that the density of actin filaments was partially reverted 2 h after 0.5 mM H2O2 was removed,20 suggesting that the compromising effect of H2O2 on the cytoskeleton may be a reversible process, particularly when the oxidative exposure is mild. Further investigation is still undergoing. Under prolong exposure of oxidative stress, muscle cells lose their cytoskeletal stability and stiffness, thus compromising their resistance to deformation. The same mechanical loading would cause a larger cell deformation, potentially making the affected cells more vulnerable to mechanical damage. Such a scenario could be significant in clinical situations, such as
H2O2 Exposure Affects Myotube Stiffness and Actin Filament Polymerization
chronic inflammation in the context of rehabilitation medicine and sports medicine.
CONCLUSION Short exposure to H2O2 apparently increased the stiffness of myotubes, but then with longer exposure, the cells became softer. The turning point seems to take place somewhere between the first and second hour of H2O2 exposure. The decrease in the overall myotube stiffness after prolong exposure to H2O2 was associated with changes in the myotube cytoskeleton. The presence of actin filament in myotubes notably decreased after 24 h of H2O2 treatment. This was probably due to the down-regulation of thymosin beta 4 and the up-regulation of cofilin2, eventually shifting the actin filament polymerization dynamics to the depolymerization side. ACKNOWLEDGMENTS This study was supported by General Research Fund from the Hong Kong Research Grants Council (RGC Ref. No.: CUHK415413).
DISCLOSURE No potential conflicts of interests exist.
REFERENCES 1
Bradamante, S., A. Villa, S. Versari, L. Barenghi, I. Orlandi, and M. Vai. Oxidative stress and alternations in actin cytoskeleton trigger glutathione efflux in Sccharomyces cerevisiae. Biochim. Biophys. Acta 1803(12):1376– 1385, 2010. 2 Dedova, I. V., O. P. Nikolaeva, D. Safer, E. M. DeLa Cruz, and C. G. Remedios. Thymosin beta 4 induces a conformational change in actin monomers. Biophys. J . 90(3):985–992, 2006. 3 Goldschmidt-Clermont, P. J., M. I. Furman, D. Wachsstock, D. Safer, V. T. Nachmias, and T. D. Pollard. The control of actin nucleotide exchange by thymosin beta 4 and profilin. A potential regulatory mechanism for actin polymerization in cells. Mol. Biol. Cell 3(9):1015–1024, 1992. 4 Henson, J. H. Relationship between the actin cytoskeleton and cell volume regulation. Microsc. Res. Tech. 47(2):155– 162, 1999. 5 Huot, J., F. Houle, F. Marceau, and J. Landry. Oxidative stress-induced actin reorganization mediated by the p38 mitogen-activated protein kinase/heat shock protein 27 pathway in vascular endothelial cells. Circ. Res. 80(3):383– 392, 1997. 6 Kim, J. S., T. Y. Huang, and G. M. Bokoch. Reactive oxygen species regulate a slingshot-cofilin activation pathway. Mol. Biol. Cell 20(11):2650–2660, 2009.
7
1187
Klemke, M., and Y. Samstag. Molecular mechanisms mediating oxidative stress-induced T-cell suppression in cancer. Adv. Enz. Reg. 49:107–112, 2009. 8 Kumar, S., and S. Gupta. Thymosin beta 4 prevents oxidative stress by targeting antioxidant and anti-apoptoic genes in cardic fibrolabsts. PLoS ONE 6(11):e26912, 2011. 9 Lassing, I., F. Schmitzberger, M. Bjo¨rnstedt, A. Holmgren, P. Nordlund, C. E. Schutt, and U. Lindberg. Molecular and structural basis for redox regulation of b-actin. J. Mol. Biol. 370:331–346, 2007. 10 Lee, C. K., H. J. Park, H. H. So, H. J. Kim, K. S. Lee, W. S. Choi, H. M. Lee, K. J. Won, T. J. Yoon, T. K. Park, and B. Kim. Proteomic profiling and identification of cofilin responding to oxidative stress in vascular smooth muscle. Proteomics 6:6455–6475, 2006. 11 Pujol, N., C. Bonet, F. Viella, M. I. Petkova, A. MozoVillarias, and M. A. D. L. Torre-Ruiz. Two proteins from Saccharomyces cerevisiae: Pfy1 and Pkc1, play a dual role in activating actin polymerization and in increasing cell viability in the adaptive response to oxidative stress. FEMS Yeast Res. 9(8):1196–1207, 2009. 12 Radmacher, M. Measuring the elastic properties of living cells by the atomic force microscope. Methods Cell Biol. 68:67–90, 2002. 13 Scharffetter-Kochanek, K., M. Wlaschek, P. Brenneisen, M. Schauen, R. Blaudschun, and J. Wenk. UV-induced reactive oxygen species in photocarcinogenesis and photoaging. Biol. Chem. 387(11):1247–1257, 1997. 14 Scott, W., J. Stevens, and S. A. Binder-Macleod. Human skeletal muscle fiber type classifications. Phys. Ther. 81(11):1810–1816, 2001. 15 Shi, H., X. Shi, and K. J. Liu. Oxidative mechanism of arsenic toxicity and carcinogenesis. Mol. Cell. Biochem. 255(1–2):67–78, 2004. 16 Svitkina, T. M., A. B. Verkhovsky, and G. G. Borisy. Plectin siderarms mediate interaction of intermediate filaments with microtubules and other components of the cytoskeleton. J. Cell Biol. 135(4):991–1007, 1996. 17 Taylor, R., and T. James. The role of oxidative stress in the development and persistence of pressure ulcers. In: Pressure Ulcer Research: Current and Future Perspectives, edited by D. L. Bader, C. Bouten, D. Colin, and C. W. J. Oomens. Berlin: Springer, 2005, pp. 205–232. 18 Verma, S., P. W. M. Fedak, R. D. Weisel, J. Butany, V. Rao, A. Maitland, R. K. Li, B. Dhillon, and T. M. Yau. Fundamentals of reperfusion injury for the clinical cardiologist. Circulation 105(20):2332–2336, 2002. 19 Xiao, D. Z. T., S. Y. Q. Wu, and A. F. T. Mak. Accumulation of loading damage and unloading reperfusion injury-modeling of the propagation of deep tissue ulcers. J. Biomech. 47(7):1658–1664, 2014. 20 Yao Y., S. W. Wong, L. Bian, A. F. T. Mak. Effect of Oxidative Stress on the Actin Filamentous Structure and the Compressive Damage Threshold of C2C12 Cells. Abstract submitted to The 7th World Congress of Biomechanics. Boston, July 2014. 21 Yarmola, E. G., E. S. Klimenko, G. Fujita, and M. R. Bubb. Thymosin beta4: actin regulation and more. Ann. NY Acad. Sci. 1112:76–85, 2007. 22 Yeoh, S., B. Pope, H. G. Mannherz, and A. Weeds. Determining the differences in actin binding by human ADF and cofilin. J. Mol. Biol. 315(4):911–925, 2002. 23 Zhang, H. J., L. Xu, V. J. Drake, L. Xie, L. W. Oberley, and K. C. Kregel. Heat-induced liver injury in old rats is associated
1188
WONG et al.
with exaggerated oxidative stress and altered transcription factor activation. FASEB J. 17(15):2293–2295, 2003. 24 Zhou, L., Y. Li, and B. Y. Yue. Oxidative stress affects cytoskeletal structure and cells matrix interactions in cells from an ocular tissue: the trabecular meshwork. J. Cell. Physiol. 180(2):182–189, 1999.
25
Zhu, D., K. S. Tan, X. Zhang, A. Y. Sun, G. Y. Sun, and J. C. Lee. Hydrogen peroxide alters membrane and cytoskeleton properties and increase intercellular connections in astrocytes. J. Cell Sci. 118(Pt 16):3695–3703, 2005.
