c Cambridge University Press 2014 Zygote 23 (June), pp. 416–425. doi:10.1017/S0967199414000021 First Published Online 11 March 2014
H1foo is essential for in vitro meiotic maturation of bovine oocytes Yan Yun2,3,4 , Peng An2,4 , Jing Ning2,4 , Gui-Ming Zhao2 , Wen-Lin Yang2 and An-Min Lei1 College of Veterinary Medicine, Shaanxi Stem Cell Engineering and Technology Center, Northwest A&F University, Yangling, China; and School of Biomedical Sciences, University of Newcastle, Callaghan, New South Wales, Australia Date submitted: 14.08.2013. Date revised: 19.12.2013. Date accepted: 27.12.2013
Summary Oocyte-specific linker histone, H1foo, is localized on the oocyte chromosomes during the process of meiotic maturation, and is essential for mouse oocyte maturation. Bovine H1foo has been identified, and its expression profile throughout oocyte maturation and early embryo development has been established. However, it has not been confirmed if H1foo is indispensable during bovine oocyte maturation. Effective siRNAs against H1foo were screened in HeLa cells, and then siRNA was microinjected into bovine oocytes to down-regulate H1foo expression. H1foo overexpression was achieved via mRNA injection. Reverse transcription polymerase chain reaction (RT-PCR) results indicated that H1foo was up-regulated by 200% and down-regulated by 70%. Based on the first polar body extrusion (PB1E) rate, H1foo overexpression apparently promoted meiotic progression. The knockdown of H1foo significantly impaired bovine oocyte maturation compared with H1foo overexpression and control groups (H1foo overexpression = 88.7%, H1foo siRNA = 41.2%, control = 71.2%; P < 0.05). This decrease can be rescued by co-injection of a modified H1foo mRNA that has escaped from the siRNA target. However, the H1e (somatic linker histone) overexpression had no effect on PB1E rate when compared with the control group. Therefore we concluded that H1foo is essential for bovine oocyte maturation and its overexpression stimulates the process. Keywords: Bovine oocyte, H1foo, Meiotic maturation, Overexpression, RNAi
Introduction The linker histone H1 maintains the higher-order chromatin and plays an essential role in the development and stabilization of the chromatin structure (Izzo et al., 2008; Happel & Doenecke, 2009; Medrzycki et al., 2012). In mammals, at least eight H1 subtypes have been identified: the somatic variants H1a, H1b, H1c, H1d, H1e, and H10; the testis-specific variant H1t; and the oocyte-specific variant H1foo (Tanaka et al., 2001; Happel & Doenecke, 2009). It has been reported that 1 All correspondence to: An-Min Lei. College of Veterinary Medicine, Shaanxi Stem Cell Engineering and Technology Center, Northwest A&F University, Yangling 712100, China. Tel.: +86 29 87080068. Fax: +86 29 87080068. e-mail: [email protected] 2 College of Veterinary Medicine, Shaanxi Stem Cell Engineering and Technology Center, Northwest A&F University, Yangling 712100, China. 3 School of Biomedical Sciences, University of Newcastle, Callaghan, New South Wales 2308, Australia. 4 These authors contributed equally to this work.
the composition of the linker histone is tissue specific, as well as developmentally regulated (Khochbin & Wolffe, 1994; Terme et al., 2011). During oogenesis and embryogenesis, the type and expression level of linker-histone composition undergoes a dramatic change in many organisms (Godde & Ura, 2009; Terme et al., 2011). In Xenopus, oocyte-specific linker histone B4 is the predominant subunit during the first division, however B4 is replaced by the somatic linker histones at midblastula transition (Dworkin-Rastl et al., 1994), demonstrating the tight developmental regulation of linker-histone expression and composition. In contrast, knockout mice studies have shown that any individual somatic linker histone H1, or even two, is dispensable for mouse development – as different subunits can compensate for each other’s absence (Fan et al., 2001). Oocyte-specific linker histone, H1foo in mammals, is the homolog of cs-H1 in sea urchins and B4 in Xenopus laevis (Tanaka et al., 2001, 2003a; McGraw et al., 2006). H1foo is localized to the nucleus of germinal vesicle (GV) stage oocytes and binds to chromosomes
Effects of H1foo on oocyte maturation
417
Table 1 Details of siRNA sequences that target bovine H1foo coding sequence siRNA name siRNA-1(229–249) siRNA-2(468–488) siRNA-3(980–1000) Negative control (NC)
in the subsequent stages (Tanaka et al., 2001). H1foo is synthesized and accumulates during oogenesis, and its presence is maintained until some stage of the early embryo, at which rapid degradation follows (Tanaka et al., 2001, 2005; Fu et al., 2003). Unlike somatic linker histones, H1foo has been proven to be indispensable for meiotic maturation of mouse GV oocytes (Furuya et al., 2007). Here, up-regulation and down-regulation of H1foo expression in bovine oocytes were performed to examine the function of H1foo during oocyte maturation.
siRNA sequences 5 →3 GCCAUCAAGGUCUACAUCCTT GCCGAGUGAGUCAAAGAAGTT CCAAGUCUUCAGUGUCCAATT UUCUCCGAACGUGUCACGUTT
Cotransfection of siRNA and plasmids into Hela cells
Materials and methods
HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; HyClone) and 2 mM Lglutamine (Sigma) until 70% confluency. Three H1foo siRNAs and the negative control were cotransfected with plasmids into HeLa cells, using LipofectamineTM 2000 (Invitrogen) in accordance with the manufacturer’s procedure. The medium was changed with fresh DMEM at 5 h after transfection and cells were harvested at 48 h to determine the interference efficiency on RNA and protein expression, based on semi-quantitative RT-PCR and western blotting.
Construction of the expression vector for H1foo and preparation of siRNA
Effect of the different siRNA on H1foo mRNA and protein expression
Bovine H1foo (NM001035372) cDNA was synthesized by reverse transcription polymerase chain reaction (RT-PCR; Fermentas-China, Shenzhen, China) from GV-stage oocytes, and then inserted into pMD19-T (Takara, Dalian, China) vectors. The desired recombinants were sent to the Shanghai Sangon Biotechnology Co. (Shanghai, China) for DNA sequencing. pH1foo– Venus was constructed by inserting H1foo cDNA into pVenus. The vector pVenus is adapted from eukaryotic expression vector pcDNA3.1, inserted coding sequence (CDS) region of the fluorescent protein Venus between BamHI and EcoRI. Three siRNA sequences that targeted bovine H1foo mRNA were designed and synthesized by GenePharma-a siRNA, and the siRNA stock solutions were diluted to a concentration of 20 M. The siRNA sequences are listed in Table 1.
RNA was isolated from about 1.0 × 106 HeLa cells. Extraction of RNA was performed using Trizol (Invitrogen) in accordance with the manufacturer’s protocol. Total RNA was dissolved in diethylpyrocarbonate (DEPC)-treated water, and quantified by means of ultraviolet (UV) light spectrophotometry. Reverse transcription of purified RNA (1 g) was performed using oligo(dT) priming and Moloney murine leukemia virus (M-MLV) in accordance with the kit procedure (TaKaRa). The PCR reaction was conducted in accordance with the manufacturer’s instructions (Fermentas). The sequences of the bovine H1foo and -actin primers are listed in Table 2; PCR products were separated by electrophoresis on 2.0% agarose gels, which were run in Tris–acetic acid–EDTA (TAE) buffer. Protein was extracted from about 1.0 × 106 HeLa cells in lysis buffer. The samples were boiled and loaded onto a 12% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS–PAGE) gel, and were transferred onto a polyvinylidene difluoride (PVDF) membrane (0.45-m, Millipore) using semidry transfer cells (Bio-Rad). The membranes were stained with Ponceau S and blocked with Trisbuffered saline–Tween 20 (TTBS) that contained 10% skimmed milk, then the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-green fluorescent protein (GFP) antibody (1:10,000
Construction of the expression vector for H1e Bovine H1e (NM_001098989) cDNA was synthesized by RT-PCR (Fermentas-China, Shenzhen, China) from cattle skin fibroblasts, and then inserted into pMD19T vectors (TaKaRa, Dalian, China). The desired recombinants were sent to the Shanghai Sangon Biotechnology Co. (Shanghai, China) for DNA sequencing. As for pH1foo-Venus, pH1e-Venus was constructed by inserting H1e cDNA into pVenus.
418
Yan Yun et al.
Table 2 Details of primers used for RNA expression detection Gene name H1foo Beta-actin
GenBank accession no.
Primer sequences
Annealing temperature (°C)
Product size (bp)
NM_001035372
CCCAAGAAGCCGAGTGAGTC; CTTGGTATCTGCTTGGCGGC TCCTCCCTGGAGAAGAGCTA; GTAGAGGTCCTTGCGGATGT
60
279
60
183
NM_173979
dilution, Abcam). The immunoreactive bands were detected by the ECL Plus Western Blotting Detection System (Amersham Bioscience) in accordance with the manufacturer’s instructions and visualized using Kodak BioMax XAR film. Quantitative analysis was performed by densitometric measurement (Gene). Expression profiles of H1foo mRNA during bovine oocyte maturation Before overexpressing or inhibiting H1foo expression in bovine oocytes, endogenous mRNA expression was identified by semi-quantitative RT-PCR. Specifically, bovine ovaries were obtained from a local slaughterhouse and transported to the laboratory within 6– 10 h after slaughter in a thermo flask that contained 0.9% saline solution supplemented with penicillin and streptomycin. The cumulus oocyte complexes (COCs) were aspirated from follicles (2–8 mm in diameter) with a 12-gauge needle and COCs with multiple layers of cumulus cells were selected for in vitro maturation. The COCs were cultured in maturation medium that consisted of M199 (Earle’s salts, Gibco) supplemented with 10% FBS, human menopausal gonadotrophins (HMG) (follicle stimulating hormone (FSH):leuteinizing hormone (LH) = 1:1) (0.1 IU/ml), estradiol (1.0 g/ml), epidermal growth factor (EGF; 50 ng/ ml), uracil (50 g/ml), and insulin–transferrin– selenium (ITS) in groups of 50–100 in four-well dishes (Nunc) at 38.5°C under a humidified atmosphere of 5% CO2 . The naked oocyte samples (zona pellucida free) in pools of five were collected at 0 h, 4 h, 8 h, 12 h and 24 h, and added in 5 l lysis buffer (5 mM dithiothreitol (DTT), 20 U/ml RNase inhibitor, 1% NP40), and stored at –80°C until RNA extraction. H1foo-Venus, M-H1foo-Venus and H1e-Venus mRNA constructs To construct pH1foo-Venus and pH1e-Venus, fulllength coding sequence for bovine H1foo and H1e was amplified from GV-stage oocytes or cattle skin fibroblasts and cloned into the plasmid pVenus. Using linearised plasmids as templates, capped mRNAs were R synthesized using the T7 mMESSAGE mMACHINE Kit (Ambion) and dissolved in nuclease-free water to a final concentration of 1 g/l.
H1foo and H1e overexpression and H1foo-siRNA knockdown in bovine oocytes Prior to microinjection, the COCs were cultured in maturation media at 38.5°C for 8 h. Then the COCs were completely denuded by gently pipetting in 0.3% hyaluronidase. The naked oocytes were incubated for 15 min in M-199 supplemented with 10% FBS and 7.5 g/ml cytochalasin B before microinjection in order to reduce mechanical damage during injection (Paradis et al., 2005). During microinjection, a group of 20–30 oocytes were placed in a 10 l droplet of M-199 supplemented with 10% FBS and 7.5 g/ml cytochalasin B under mineral oil (Sigma). Oocytes were either injected with mRNAs only or mix of siRNA and mRNA using Eppendorf Femtojet with EggJek injection needles (Eppendorf) and Precision Micro Devices holding pipets (Eppendorf). In total, 40– 50 oocytes were injected per group. Before being transferred to maturation medium for further culture, the injected oocytes were incubated for 1 h to remove the oocytes with damaged plasma membranes following microinjection. Oocytes without microinjection were matured as controls. The rate of meiotic maturation was calculated based on first polar body extrusion at 22–24 h post oocyte maturation. Oocyte imaging Live oocytes were incubated with 10 g/ml Hoechst 33342 stain in M-199 to stain chromatin. Brightfield, Hoechst 33342 and Venus fluorescence images were recorded with a charge coupled device (CCD) camera (Axiocam MRm; Carl Zeiss, Shanghai, China) attached to a Zeiss microscope. Oocyte RNA isolation and semi-quantitative RT-PCR At 14–16 h after injection, total RNA was acquired by directly adding oocytes in 5 l lysis buffer, followed by treatment with RNase-free DNase I (Fermentas) and RT-PCR of H1foo and -actin. Every pool contained five oocytes from each group. The linear range of the amplification curve was validated using different numbers of PCR cycles and different amounts of RNA template. The optimized parameters were used for semi-quantitative RT-PCR.
Effects of H1foo on oocyte maturation
419
Figure 1 Efficiency of siRNAs on relative mRNA expression level in HeLa cells. (A) Gel electrophoresis analysis. (B) Semiquantitative analysis of (A). NC: HeLa cells without transfection used for negative control. H1foo: positive control with pVenus–H1foo transfection. siRNA-NC, siRNA-1, siRNA-2, siRNA-3: cells cotransfected with plasmid pVenus-H1foo and siRNAs of negative control, siRNA-1, siRNA-2, siRNA-3, respectively. Note: H1foo expression is quantified using a value of H1foo/actin, and the value in the H1foo group is set to 1. Different letters (a, b, c) indicate significant difference (P < 0.05) among groups, and the same letter (b) indicates no significant difference (P > 0.05) between the groups.
Statistical analysis To avoid the variable oocyte quality from different batch of collection, side-by-side experiments were always performed among groups. All experiments were repeated at least three times independently. Student’s t-test and chi-squared test were used to evaluate the results. For all analyses, a value of P < 0.05 was considered to be significant. Quantitative analysis of band intensity in western blotting and RT-PCR was conducted using GeneSnap software (SynGene).
Results Effect of H1foo siRNAs on mRNA and protein expression in HeLa cells Before microinjection into oocytes, we examined the effects of individual siRNAs on H1foo mRNA and protein expression levels using RT-PCR (Fig. 1) and western blotting (Fig. ),2 respectively. The results showed that H1foo mRNA and protein levels were down-regulated by all three siRNAs, and confirmed that siRNA-3 was the most effective in suppressing H1foo expression. Therefore, in the subsequent experi-
ments, we used siRNA-3 to suppress H1foo expression and determine its biological effects on bovine oocyte maturation. Temporal expression pattern of H1foo transcripts during bovine oocyte maturation H1foo mRNA expression was measured throughout oocyte maturation, from 0 h (GV-stage oocyte) to 24 h (MII oocyte). Unlike the previous report that found the metaphase II (MII) oocytes conserved only 59% of the initial quantity of mRNA compared with the GV-stage oocytes (McGraw et al., 2006); our results here showed that the H1foo transcripts maintained high values and were stable during oocyte maturation (Fig. )3. Therefore, we presumed that abundance of H1foo is required throughout meiotic maturation and subsequently designed the experiments for H1foo RNAi and overexpression at 8 h. Effect of microinjection of H1foo mRNA and siRNA on bovine H1foo expression and oocyte maturation In order to assess the effect of mRNA and siRNA microinjection on H1foo expression, the transcript
420
Yan Yun et al.
Figure 2 Efficiency of siRNAs on relative protein expression level in HeLa cells. (A) Gel electrophoresis analysis. (B) Semiquantitative analysis of (A) as above. NC, H1foo, siRNA-NC, siRNA-1, siRNA-2 and siRNA-3: as in Figure 1. Note: Efficiency of siRNAs on H1foo protein expression was analyzed indirectly by checking Venus expression using goat anti-GFP antibody.
Figure 3 Bovine H1foo transcript expression profiles during oocyte meiotic maturation. The transcript expression levels were measured at differential time-points (0, 4, 8, 12 or 24 h) during bovine oocyte maturation in vitro by RT-PCR and its quantitative analysis.
Effects of H1foo on oocyte maturation
421
Figure 4 Detection and analysis of H1foo mRNA and siRNA-3 microinjection in oocytes. (A) Gel electrophoresis analysis. (B) Quantitative analysis of (A) as above (the value in Venus injected group is set to 1). Note: Different letters (a, b, c) indicate significant difference (P < 0.05) among groups.
Figure 5 Effect of H1foo expression on bovine oocyte maturation. PB1E (%) for different treatment groups. Note for bar chart: Different letters (a, b, c) indicate significant difference (P < 0.05) among groups, and the same letter (c) indicates no significant difference (P > 0.05) between the groups.
was tested among the different groups by semiquantitative RT-PCR with the optimized parameters (Fig. S1). Compared with the Venus injection group (Control), H1foo transcript was increased by 200% in the H1foo-Venus group, and reduced by 70% in the siRNA-3 group (Fig. 4). Having established H1foo overexpression and knockdown in bovine oocytes, we next sought to determine whether H1foo expression level had any effect on meiotic maturation. Consistent with the previous observation in mouse oocytes (Furuya et al., 2007), we found that knockdown of H1foo by siRNA-3 impaired bovine oocyte maturation (Fig. 5). Intriguingly, our data additionally showed that its overexpression significantly promoted meiotic progression (Fig. 5), a process in which maturation processing factor (MPF) activity regulation might be involved. Maturation processing factor is a heterodimer that consists of Cdk1 kinase and its regulatory partner cyclin B1; its activity is regulated by accumulation and degradation of cyclin B1, which then drives the events of meiosis including nuclear envelope breakdown and chromosome segregation at anaphase (Liu et al., 2012). It has been shown that H1foo depletion arrested mouse oocytes at MI, and in these arrested oocytes MPF activity remained low
(Furuya et al., 2007). Therefore together with the previous data, our results suggested an association of H1foo expression and MPF activity via unknown pathways. Effect of H1e overexpression on bovine oocyte maturation Having known that H1foo overexpression promoted bovine oocyte maturation, we wondered whether the somatic linker histones had the similar effect. To address this question, H1e was overexpressed in bovine oocytes, using the same procedure as for H1foo, to determine its effect on maturation. Our data showed that expressed exogenous H1e-Venus proteins cannot specifically bind to oocyte chromatin, while H1foo-Venus does bind (Fig. 6A). Moreover, H1e overexpression could not improve bovine oocyte maturation as H1foo was shown to do (Fig. 6B). H1foo RNAi-induced PB1E decrease can be rescued by co-injection of M-H1foo-Venus mRNA Consistent with the previous report in mouse oocytes (Furuya et al., 2007), down-regulation of H1foo also significantly impaired oocyte maturation in the bovine; our study further demonstrated that only
422
Yan Yun et al.
Figure 6 Effect of H1e expression on bovine oocyte maturation. (A) MII eggs microinjected with H1e-Venus or H1foo-Venus mRNA (green). Oocytes were incubated with Hoechst 33342 (blue) to stain chromatin. Note: Bar = 50 m. (B) Effect of H1e or H1foo overexpression on bovine oocyte maturation given as PB1E(%). Table 3 Modified Hlfoo tagged sequence for rescue from siRNA3 (letters in italics show the modified sequence) Target sequence location 971–1009
Sequence source
Nucleotides sequence
Wild type Modified type
GCATCCCCACCAAGTCTTCAGTGTCCAAAGCGGCCAGCA GCATCCCCACTAAATCATCGGTCTCAAAGGCGGCCAGCA
oocyte-specific types of linker histone H1foo overexpression rather than any somatic types could promote oocyte maturation (Fig. 6). To further confirm the function of H1foo, we applied a rescue experiment in H1foo-depleted oocytes, using a modified H1foo cDNA (M-H1foo) that encoded a functional protein but could not be targeted for degradation by siRNA3 (sequence in Table 3). Similar to what was observed in the H1foo overexpression group, co-injection of M-
H1foo mRNA with siRNA-3 significantly increased the PB1E rate when compared with the control groups (Fig. 7).
Discussion Down-regulation of H1foo expression during bovine oocyte maturation impaired meiotic progression, a
Effects of H1foo on oocyte maturation
423
Figure 7 PB1E reduction was rescued by co-injection of M-H1foo mRNA. Effect of different versions of H1foo mRNA expression with siRNA-3 on bovine oocyte maturation.
conclusion that is consistent with a previous report (Furuya et al., 2007). Moreover, our results showed that only H1foo rather than somatic type of linker histones overexpression could stimulate extrusion of the first polar body, suggesting its indispensible role during bovine oocyte meiotic progression. Based on our data, it is possible that a threshold level of H1foo expression is required for oocyte maturation, such that only those oocytes that possess more than the threshold limit will be able to or have a higher chance to continue for maturation. This hypothesis would, in some way, explain why individual GV oocytes have different fates (arrested at GV, MI or matured to MII) after in vitro maturation. The in vitro collected GV-stage oocytes come from different follicles or different ovaries with diverse conditions, thus accumulating variable level of H1foo; this factor may finally decide their fate. Only the proportion of oocytes that had accumulated sufficient H1foo could mature to MII eggs ready for fertilization. It is also a reason to explain why in vitro matured oocytes are comparatively not as successful as in vivo oocytes, because the former might experience sub-optimal conditions during in vitro maturation, resulting in the loss of components globally, including H1foo. Our observations that H1foo overexpression stimulated meiotic maturation in vitro added evidence to the H1foo-threshold hypothesis, although further investigations are needed to reveal the unknown pathways. Compared with somatic linker histones, which can compensate for each other (Fu et al., 2003), H1foo is indispensable in the process of oocyte maturation (Furuya et al., 2007). One explanation is related to the abnormal ratio of H1 to nucleosomes that has been shown to be essential for mammalian development
(Fan et al., 2003). Oocytes are transcriptionally silent, and H1foo is the unique, or at least the predominant, linker-histone subunit required for oocyte maturation (Tanaka et al., 2001, 2003b). Therefore, down-regulation of H1foo would directly result in a dramatic decrease in the total amount of H1. The other explanation for the importance of H1foo in oocyte maturation is demonstrated by the lack of functional H1foo studies. It has been reported that only H1foo, rather than somatic linker histones, is capable of correcting chromatin association in oocytes because of the presence of divergent N-terminal and globular domains (Becker et al., 2005). A study that used fluorescence recovery after photobleaching (FRAP) showed that H1foo binds chromatin more tightly, this finding provided molecular evidence for the replacement of somatic histones with H1foo during fertilization and nuclear transfer (Gao et al., 2004; Teranishi et al., 2004; Becker et al., 2005; Jullien et al., 2010; Mizusawa et al., 2010; Yun et al., 2012). All these observations indicated that H1foo possesses both structure and function diversity compared with somatic types histones, and performs an indispensable role during oocyte maturation and early embryo development. Due to the absence of a bovine H1foo antibody, we performed the co-transfection of plasmid pH1fooVenus (GFP variant) and siRNA in HeLa cells to screen out an effective siRNA against H1foo in order that the GFP antibody could be used to detect the interference efficiency (Yun et al., 2008). The RNAi results in bovine oocytes showed that H1foo transcripts decreased by 70%, consistent with the data on HeLa cells. Here, we have developed a way of overcoming the dilemma of having no standard antibody.
424
Yan Yun et al.
In mice, antisense morpholino oligonucleotides (MO) against H1foo were injected into GV oocytes. After arrest for 20 h, dbcAMP was washed off from the culture medium to allow the spontaneous resumption of meiosis. Only 33.1% of H1foo-depleted oocytes extruded a first polar body, compared with 81.1% in the control (Furuya et al., 2007). However, the GV was not visible in bovine oocytes. Recently we showed that the removal of cumulus cells at the GV stage did not impair bovine oocyte maturation. Here, we denuded the granulose cells and microinjected siRNA or mRNA at 8 h after in vitro maturation of oocytes, when the majority of the oocytes had completed GV breakdown (GVBD; Liu et al., 2012). In our H1foo knockdown group, the oocytes had a 41.2% first polar body extrusion rate, compared with 67.1% in the control. Our data indicate that H1foo expression after GVBD is still essential for bovine oocyte meiotic progression. This investigation demonstrates conclusively that H1foo is essential for the process of bovine oocyte maturation.
Supplementary material To view supplementary material for this article, please visit http://dx.doi.org/10.1017/S0967199414000021
Acknowledgements This work was supported by the National Natural Science Foundation of China (grant no. 31172280). References Becker, M., Becker, A., Miyara, F., Han, Z., Kihara, M., Brown, D.T., Hager, G.L., Latham, K., Adashi, E.Y. & Misteli, T. (2005). Differential in vivo binding dynamics of somatic and oocyte-specific linker histones in oocytes and during ES cell nuclear transfer. Mol. Biol. Cell 16, 3887–95. Dworkin-Rastl, E., Kandolf, H. & Smith, R.C. (1994). The maternal histone H1 variant, H1M (B4 protein), is the predominant H1 histone in Xenopus pregastrula embryos. Dev. Biol. 161, 425–39. Fan, Y., Sirotkin, A., Russell, R.G., Ayala, J. & Skoultchi, A.I. (2001). Individual somatic H1 subtypes are dispensable for mouse development even in mice lacking the H1(0) replacement subtype. Mol. Cell. Biol. 21, 7933–43. Fan, Y., Nikitina, T., Morin-Kensicki, E.M., Zhao, J., Magnuson, T.R., Woodcock, C.L. & Skoultchi, A.I. (2003). H1 linker histones are essential for mouse development and affect nucleosome spacing in vivo. Mol. Cell. Biol. 23, 4559–72. Fu, G., Ghadam, P., Sirotkin, A., Khochbin, S., Skoultchi, A.I. & Clarke, H.J. (2003). Mouse oocytes and early embryos express multiple histone H1 subtypes. Biol. Reprod. 68, 1569–76.
Furuya, M., Tanaka, M., Teranishi, T., Matsumoto, K., Hosoi, Y., Saeki, K., Ishimoto, H., Minegishi, K., Iritani, A. & Yoshimura, Y. (2007). H1foo is indispensable for meiotic maturation of the mouse oocyte, J. Reprod. Dev. 53, 895– 902. Gao, S., Chung, Y.G., Parseghian, M.H., King, G.J., Adashi, E.Y. & Latham, K.E. (2004). Rapid H1 linker histone transitions following fertilization or somatic cell nuclear transfer: evidence for a uniform developmental program in mice, Dev. Biol. 266, 62–75. Godde, J.S. & Ura, K. (2009). Dynamic alterations of linker histone variants during development. Int. J. Dev. Biol. 53, 215–29. Happel, N. & Doenecke, D. (2009). Histone H1 and its isoforms: contribution to chromatin structure and function. Gene 431, 1–12. Izzo, A., Kamieniarz, K. & Schneider, R. (2008). The histone H1 family: specific members, specific functions? Biol. Chem. 389, 333–43. Jullien, J., Astrand, C., Halley-Stott, R.P., Garrett, N. & Gurdon, J.B. (2010). Characterization of somatic cell nuclear reprogramming by oocytes in which a linker histone is required for pluripotency gene reactivation. Proc. Natl. Acad. Sci. USA 107, 5483–8. Khochbin, S. & Wolffe, A.P. (1994). Developmentally regulated expression of linker-histone variants in vertebrates. Eur. J. Biochem. 225, 501–10. Liu, W.Q., Yin, J.Q., Zhao, G.M., Yun, Y., Wu, S.J., Jones, K.T. & Lei, A.M. (2012). Differential regulation of cyclin B1 degradation between the first and second meiotic divisions of bovine oocytes. Theriogenology 78, 1171–81. McGraw, S., Vigneault, C., Tremblay, K. & Sirard, M.A. (2006). Characterization of linker histone H1FOO during bovine in vitro embryo development. Mol. Reprod. Dev. 73, 692–9. Medrzycki, M., Zhang, Y., Cao, K. & Fan, Y. (2012). Expression analysis of mammalian linker-histone subtypes. J. Vis. Exp. DOI: 10.3791/3577. Mizusawa, Y., Kuji, N., Tanaka, Y., Tanaka, M., Ikeda, E., Komatsu, S., Kato, S. & Yoshimura, Y. (2010). Expression of human oocyte-specific linker histone protein and its incorporation into sperm chromatin during fertilization. Fertil. Steril. 93, 1134–41. Paradis, F., Vigneault, C., Robert, C. & Sirard, M.A. (2005). RNA interference as a tool to study gene function in bovine oocytes. Mol. Reprod. Dev. 70, 111–21. Tanaka, M., Hennebold, J.D., Macfarlane, J. & Adashi, E.Y. (2001). A mammalian oocyte-specific linker histone gene H1oo: homology with the genes for the oocyte-specific cleavage stage histone (cs-H1) of sea urchin and the B4/H1M histone of the frog. Development 128, 655–64. Tanaka, Y., Kato, S., Tanaka, M., Kuji, N. & Yoshimura, Y. (2003a). Structure and expression of the human oocytespecific histone H1 gene elucidated by direct RT-nested PCR of a single oocyte. Biochem. Biophys. Res. Commun. 304, 351–7. Tanaka, M., Kihara, M., Meczekalski, B., King, G.J. & Adashi, E.Y. (2003b). H1oo: a pre-embryonic H1 linker histone in search of a function. Mol. Cell. Endocrinol. 202, 5–9. Tanaka, M., Kihara, M., Hennebold, J.D., Eppig, J.J., Viveiros, M.M., Emery, B.R., Carrell, D.T., Kirkman, N.J.,
Effects of H1foo on oocyte maturation Meczekalski, B., Zhou, J., Bondy, C.A., Becker, M., Schultz, R.M., Misteli, T., De La Fuente, R., King, G.J. & Adashi, E.Y. (2005). H1FOO is coupled to the initiation of oocytic growth. Biol. Reprod. 72, 135–42. Teranishi, T., Tanaka, M., Kimoto, S., Ono, Y., Miyakoshi, K., Kono, T. & Yoshimura, Y. (2004). Rapid replacement of somatic linker histones with the oocyte-specific linker histone H1foo in nuclear transfer. Dev. Biol. 266, 76–86. Terme, J.M., Sese, B., Millan-Arino, L., Mayor, R., Belmonte, J.C., Barrero, M.J. & Jordan, A. (2011). Histone H1
425
variants are differentially expressed and incorporated into chromatin during differentiation and reprogramming to pluripotency. J. Biol. Chem. 286, 35347–57. Yun, Y., Zheng, X.B., Liu, W.Q., Dou, Z.Y. & Lei, A.M. (2008). Construction of eukaryotic expression vector of bovine Nanog gene and screening for effective siRNA. Scientia Agricultura Sinica 41, 4180–6. [in Chinese] Yun, Y., Zhao, G.M., Wu, S.J., Li, W. & Lei, A.M. (2012). Replacement of H1 linker histone during bovine somatic cell nuclear transfer. Theriogenology 78, 1371–80.
H1foo is essential for in vitro meiotic maturation of bovine oocytes Yan Yun2,3,4 , Peng An2,4 , Jing Ning2,4 , Gui-Ming Zhao2 , Wen-Lin Yang2 and An-Min Lei1 College of Veterinary Medicine, Shaanxi Stem Cell Engineering and Technology Center, Northwest A&F University, Yangling, China; and School of Biomedical Sciences, University of Newcastle, Callaghan, New South Wales, Australia Date submitted: 14.08.2013. Date revised: 19.12.2013. Date accepted: 27.12.2013
Summary Oocyte-specific linker histone, H1foo, is localized on the oocyte chromosomes during the process of meiotic maturation, and is essential for mouse oocyte maturation. Bovine H1foo has been identified, and its expression profile throughout oocyte maturation and early embryo development has been established. However, it has not been confirmed if H1foo is indispensable during bovine oocyte maturation. Effective siRNAs against H1foo were screened in HeLa cells, and then siRNA was microinjected into bovine oocytes to down-regulate H1foo expression. H1foo overexpression was achieved via mRNA injection. Reverse transcription polymerase chain reaction (RT-PCR) results indicated that H1foo was up-regulated by 200% and down-regulated by 70%. Based on the first polar body extrusion (PB1E) rate, H1foo overexpression apparently promoted meiotic progression. The knockdown of H1foo significantly impaired bovine oocyte maturation compared with H1foo overexpression and control groups (H1foo overexpression = 88.7%, H1foo siRNA = 41.2%, control = 71.2%; P < 0.05). This decrease can be rescued by co-injection of a modified H1foo mRNA that has escaped from the siRNA target. However, the H1e (somatic linker histone) overexpression had no effect on PB1E rate when compared with the control group. Therefore we concluded that H1foo is essential for bovine oocyte maturation and its overexpression stimulates the process. Keywords: Bovine oocyte, H1foo, Meiotic maturation, Overexpression, RNAi
Introduction The linker histone H1 maintains the higher-order chromatin and plays an essential role in the development and stabilization of the chromatin structure (Izzo et al., 2008; Happel & Doenecke, 2009; Medrzycki et al., 2012). In mammals, at least eight H1 subtypes have been identified: the somatic variants H1a, H1b, H1c, H1d, H1e, and H10; the testis-specific variant H1t; and the oocyte-specific variant H1foo (Tanaka et al., 2001; Happel & Doenecke, 2009). It has been reported that 1 All correspondence to: An-Min Lei. College of Veterinary Medicine, Shaanxi Stem Cell Engineering and Technology Center, Northwest A&F University, Yangling 712100, China. Tel.: +86 29 87080068. Fax: +86 29 87080068. e-mail: [email protected] 2 College of Veterinary Medicine, Shaanxi Stem Cell Engineering and Technology Center, Northwest A&F University, Yangling 712100, China. 3 School of Biomedical Sciences, University of Newcastle, Callaghan, New South Wales 2308, Australia. 4 These authors contributed equally to this work.
the composition of the linker histone is tissue specific, as well as developmentally regulated (Khochbin & Wolffe, 1994; Terme et al., 2011). During oogenesis and embryogenesis, the type and expression level of linker-histone composition undergoes a dramatic change in many organisms (Godde & Ura, 2009; Terme et al., 2011). In Xenopus, oocyte-specific linker histone B4 is the predominant subunit during the first division, however B4 is replaced by the somatic linker histones at midblastula transition (Dworkin-Rastl et al., 1994), demonstrating the tight developmental regulation of linker-histone expression and composition. In contrast, knockout mice studies have shown that any individual somatic linker histone H1, or even two, is dispensable for mouse development – as different subunits can compensate for each other’s absence (Fan et al., 2001). Oocyte-specific linker histone, H1foo in mammals, is the homolog of cs-H1 in sea urchins and B4 in Xenopus laevis (Tanaka et al., 2001, 2003a; McGraw et al., 2006). H1foo is localized to the nucleus of germinal vesicle (GV) stage oocytes and binds to chromosomes
Effects of H1foo on oocyte maturation
417
Table 1 Details of siRNA sequences that target bovine H1foo coding sequence siRNA name siRNA-1(229–249) siRNA-2(468–488) siRNA-3(980–1000) Negative control (NC)
in the subsequent stages (Tanaka et al., 2001). H1foo is synthesized and accumulates during oogenesis, and its presence is maintained until some stage of the early embryo, at which rapid degradation follows (Tanaka et al., 2001, 2005; Fu et al., 2003). Unlike somatic linker histones, H1foo has been proven to be indispensable for meiotic maturation of mouse GV oocytes (Furuya et al., 2007). Here, up-regulation and down-regulation of H1foo expression in bovine oocytes were performed to examine the function of H1foo during oocyte maturation.
siRNA sequences 5 →3 GCCAUCAAGGUCUACAUCCTT GCCGAGUGAGUCAAAGAAGTT CCAAGUCUUCAGUGUCCAATT UUCUCCGAACGUGUCACGUTT
Cotransfection of siRNA and plasmids into Hela cells
Materials and methods
HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; HyClone) and 2 mM Lglutamine (Sigma) until 70% confluency. Three H1foo siRNAs and the negative control were cotransfected with plasmids into HeLa cells, using LipofectamineTM 2000 (Invitrogen) in accordance with the manufacturer’s procedure. The medium was changed with fresh DMEM at 5 h after transfection and cells were harvested at 48 h to determine the interference efficiency on RNA and protein expression, based on semi-quantitative RT-PCR and western blotting.
Construction of the expression vector for H1foo and preparation of siRNA
Effect of the different siRNA on H1foo mRNA and protein expression
Bovine H1foo (NM001035372) cDNA was synthesized by reverse transcription polymerase chain reaction (RT-PCR; Fermentas-China, Shenzhen, China) from GV-stage oocytes, and then inserted into pMD19-T (Takara, Dalian, China) vectors. The desired recombinants were sent to the Shanghai Sangon Biotechnology Co. (Shanghai, China) for DNA sequencing. pH1foo– Venus was constructed by inserting H1foo cDNA into pVenus. The vector pVenus is adapted from eukaryotic expression vector pcDNA3.1, inserted coding sequence (CDS) region of the fluorescent protein Venus between BamHI and EcoRI. Three siRNA sequences that targeted bovine H1foo mRNA were designed and synthesized by GenePharma-a siRNA, and the siRNA stock solutions were diluted to a concentration of 20 M. The siRNA sequences are listed in Table 1.
RNA was isolated from about 1.0 × 106 HeLa cells. Extraction of RNA was performed using Trizol (Invitrogen) in accordance with the manufacturer’s protocol. Total RNA was dissolved in diethylpyrocarbonate (DEPC)-treated water, and quantified by means of ultraviolet (UV) light spectrophotometry. Reverse transcription of purified RNA (1 g) was performed using oligo(dT) priming and Moloney murine leukemia virus (M-MLV) in accordance with the kit procedure (TaKaRa). The PCR reaction was conducted in accordance with the manufacturer’s instructions (Fermentas). The sequences of the bovine H1foo and -actin primers are listed in Table 2; PCR products were separated by electrophoresis on 2.0% agarose gels, which were run in Tris–acetic acid–EDTA (TAE) buffer. Protein was extracted from about 1.0 × 106 HeLa cells in lysis buffer. The samples were boiled and loaded onto a 12% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS–PAGE) gel, and were transferred onto a polyvinylidene difluoride (PVDF) membrane (0.45-m, Millipore) using semidry transfer cells (Bio-Rad). The membranes were stained with Ponceau S and blocked with Trisbuffered saline–Tween 20 (TTBS) that contained 10% skimmed milk, then the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-green fluorescent protein (GFP) antibody (1:10,000
Construction of the expression vector for H1e Bovine H1e (NM_001098989) cDNA was synthesized by RT-PCR (Fermentas-China, Shenzhen, China) from cattle skin fibroblasts, and then inserted into pMD19T vectors (TaKaRa, Dalian, China). The desired recombinants were sent to the Shanghai Sangon Biotechnology Co. (Shanghai, China) for DNA sequencing. As for pH1foo-Venus, pH1e-Venus was constructed by inserting H1e cDNA into pVenus.
418
Yan Yun et al.
Table 2 Details of primers used for RNA expression detection Gene name H1foo Beta-actin
GenBank accession no.
Primer sequences
Annealing temperature (°C)
Product size (bp)
NM_001035372
CCCAAGAAGCCGAGTGAGTC; CTTGGTATCTGCTTGGCGGC TCCTCCCTGGAGAAGAGCTA; GTAGAGGTCCTTGCGGATGT
60
279
60
183
NM_173979
dilution, Abcam). The immunoreactive bands were detected by the ECL Plus Western Blotting Detection System (Amersham Bioscience) in accordance with the manufacturer’s instructions and visualized using Kodak BioMax XAR film. Quantitative analysis was performed by densitometric measurement (Gene). Expression profiles of H1foo mRNA during bovine oocyte maturation Before overexpressing or inhibiting H1foo expression in bovine oocytes, endogenous mRNA expression was identified by semi-quantitative RT-PCR. Specifically, bovine ovaries were obtained from a local slaughterhouse and transported to the laboratory within 6– 10 h after slaughter in a thermo flask that contained 0.9% saline solution supplemented with penicillin and streptomycin. The cumulus oocyte complexes (COCs) were aspirated from follicles (2–8 mm in diameter) with a 12-gauge needle and COCs with multiple layers of cumulus cells were selected for in vitro maturation. The COCs were cultured in maturation medium that consisted of M199 (Earle’s salts, Gibco) supplemented with 10% FBS, human menopausal gonadotrophins (HMG) (follicle stimulating hormone (FSH):leuteinizing hormone (LH) = 1:1) (0.1 IU/ml), estradiol (1.0 g/ml), epidermal growth factor (EGF; 50 ng/ ml), uracil (50 g/ml), and insulin–transferrin– selenium (ITS) in groups of 50–100 in four-well dishes (Nunc) at 38.5°C under a humidified atmosphere of 5% CO2 . The naked oocyte samples (zona pellucida free) in pools of five were collected at 0 h, 4 h, 8 h, 12 h and 24 h, and added in 5 l lysis buffer (5 mM dithiothreitol (DTT), 20 U/ml RNase inhibitor, 1% NP40), and stored at –80°C until RNA extraction. H1foo-Venus, M-H1foo-Venus and H1e-Venus mRNA constructs To construct pH1foo-Venus and pH1e-Venus, fulllength coding sequence for bovine H1foo and H1e was amplified from GV-stage oocytes or cattle skin fibroblasts and cloned into the plasmid pVenus. Using linearised plasmids as templates, capped mRNAs were R synthesized using the T7 mMESSAGE mMACHINE Kit (Ambion) and dissolved in nuclease-free water to a final concentration of 1 g/l.
H1foo and H1e overexpression and H1foo-siRNA knockdown in bovine oocytes Prior to microinjection, the COCs were cultured in maturation media at 38.5°C for 8 h. Then the COCs were completely denuded by gently pipetting in 0.3% hyaluronidase. The naked oocytes were incubated for 15 min in M-199 supplemented with 10% FBS and 7.5 g/ml cytochalasin B before microinjection in order to reduce mechanical damage during injection (Paradis et al., 2005). During microinjection, a group of 20–30 oocytes were placed in a 10 l droplet of M-199 supplemented with 10% FBS and 7.5 g/ml cytochalasin B under mineral oil (Sigma). Oocytes were either injected with mRNAs only or mix of siRNA and mRNA using Eppendorf Femtojet with EggJek injection needles (Eppendorf) and Precision Micro Devices holding pipets (Eppendorf). In total, 40– 50 oocytes were injected per group. Before being transferred to maturation medium for further culture, the injected oocytes were incubated for 1 h to remove the oocytes with damaged plasma membranes following microinjection. Oocytes without microinjection were matured as controls. The rate of meiotic maturation was calculated based on first polar body extrusion at 22–24 h post oocyte maturation. Oocyte imaging Live oocytes were incubated with 10 g/ml Hoechst 33342 stain in M-199 to stain chromatin. Brightfield, Hoechst 33342 and Venus fluorescence images were recorded with a charge coupled device (CCD) camera (Axiocam MRm; Carl Zeiss, Shanghai, China) attached to a Zeiss microscope. Oocyte RNA isolation and semi-quantitative RT-PCR At 14–16 h after injection, total RNA was acquired by directly adding oocytes in 5 l lysis buffer, followed by treatment with RNase-free DNase I (Fermentas) and RT-PCR of H1foo and -actin. Every pool contained five oocytes from each group. The linear range of the amplification curve was validated using different numbers of PCR cycles and different amounts of RNA template. The optimized parameters were used for semi-quantitative RT-PCR.
Effects of H1foo on oocyte maturation
419
Figure 1 Efficiency of siRNAs on relative mRNA expression level in HeLa cells. (A) Gel electrophoresis analysis. (B) Semiquantitative analysis of (A). NC: HeLa cells without transfection used for negative control. H1foo: positive control with pVenus–H1foo transfection. siRNA-NC, siRNA-1, siRNA-2, siRNA-3: cells cotransfected with plasmid pVenus-H1foo and siRNAs of negative control, siRNA-1, siRNA-2, siRNA-3, respectively. Note: H1foo expression is quantified using a value of H1foo/actin, and the value in the H1foo group is set to 1. Different letters (a, b, c) indicate significant difference (P < 0.05) among groups, and the same letter (b) indicates no significant difference (P > 0.05) between the groups.
Statistical analysis To avoid the variable oocyte quality from different batch of collection, side-by-side experiments were always performed among groups. All experiments were repeated at least three times independently. Student’s t-test and chi-squared test were used to evaluate the results. For all analyses, a value of P < 0.05 was considered to be significant. Quantitative analysis of band intensity in western blotting and RT-PCR was conducted using GeneSnap software (SynGene).
Results Effect of H1foo siRNAs on mRNA and protein expression in HeLa cells Before microinjection into oocytes, we examined the effects of individual siRNAs on H1foo mRNA and protein expression levels using RT-PCR (Fig. 1) and western blotting (Fig. ),2 respectively. The results showed that H1foo mRNA and protein levels were down-regulated by all three siRNAs, and confirmed that siRNA-3 was the most effective in suppressing H1foo expression. Therefore, in the subsequent experi-
ments, we used siRNA-3 to suppress H1foo expression and determine its biological effects on bovine oocyte maturation. Temporal expression pattern of H1foo transcripts during bovine oocyte maturation H1foo mRNA expression was measured throughout oocyte maturation, from 0 h (GV-stage oocyte) to 24 h (MII oocyte). Unlike the previous report that found the metaphase II (MII) oocytes conserved only 59% of the initial quantity of mRNA compared with the GV-stage oocytes (McGraw et al., 2006); our results here showed that the H1foo transcripts maintained high values and were stable during oocyte maturation (Fig. )3. Therefore, we presumed that abundance of H1foo is required throughout meiotic maturation and subsequently designed the experiments for H1foo RNAi and overexpression at 8 h. Effect of microinjection of H1foo mRNA and siRNA on bovine H1foo expression and oocyte maturation In order to assess the effect of mRNA and siRNA microinjection on H1foo expression, the transcript
420
Yan Yun et al.
Figure 2 Efficiency of siRNAs on relative protein expression level in HeLa cells. (A) Gel electrophoresis analysis. (B) Semiquantitative analysis of (A) as above. NC, H1foo, siRNA-NC, siRNA-1, siRNA-2 and siRNA-3: as in Figure 1. Note: Efficiency of siRNAs on H1foo protein expression was analyzed indirectly by checking Venus expression using goat anti-GFP antibody.
Figure 3 Bovine H1foo transcript expression profiles during oocyte meiotic maturation. The transcript expression levels were measured at differential time-points (0, 4, 8, 12 or 24 h) during bovine oocyte maturation in vitro by RT-PCR and its quantitative analysis.
Effects of H1foo on oocyte maturation
421
Figure 4 Detection and analysis of H1foo mRNA and siRNA-3 microinjection in oocytes. (A) Gel electrophoresis analysis. (B) Quantitative analysis of (A) as above (the value in Venus injected group is set to 1). Note: Different letters (a, b, c) indicate significant difference (P < 0.05) among groups.
Figure 5 Effect of H1foo expression on bovine oocyte maturation. PB1E (%) for different treatment groups. Note for bar chart: Different letters (a, b, c) indicate significant difference (P < 0.05) among groups, and the same letter (c) indicates no significant difference (P > 0.05) between the groups.
was tested among the different groups by semiquantitative RT-PCR with the optimized parameters (Fig. S1). Compared with the Venus injection group (Control), H1foo transcript was increased by 200% in the H1foo-Venus group, and reduced by 70% in the siRNA-3 group (Fig. 4). Having established H1foo overexpression and knockdown in bovine oocytes, we next sought to determine whether H1foo expression level had any effect on meiotic maturation. Consistent with the previous observation in mouse oocytes (Furuya et al., 2007), we found that knockdown of H1foo by siRNA-3 impaired bovine oocyte maturation (Fig. 5). Intriguingly, our data additionally showed that its overexpression significantly promoted meiotic progression (Fig. 5), a process in which maturation processing factor (MPF) activity regulation might be involved. Maturation processing factor is a heterodimer that consists of Cdk1 kinase and its regulatory partner cyclin B1; its activity is regulated by accumulation and degradation of cyclin B1, which then drives the events of meiosis including nuclear envelope breakdown and chromosome segregation at anaphase (Liu et al., 2012). It has been shown that H1foo depletion arrested mouse oocytes at MI, and in these arrested oocytes MPF activity remained low
(Furuya et al., 2007). Therefore together with the previous data, our results suggested an association of H1foo expression and MPF activity via unknown pathways. Effect of H1e overexpression on bovine oocyte maturation Having known that H1foo overexpression promoted bovine oocyte maturation, we wondered whether the somatic linker histones had the similar effect. To address this question, H1e was overexpressed in bovine oocytes, using the same procedure as for H1foo, to determine its effect on maturation. Our data showed that expressed exogenous H1e-Venus proteins cannot specifically bind to oocyte chromatin, while H1foo-Venus does bind (Fig. 6A). Moreover, H1e overexpression could not improve bovine oocyte maturation as H1foo was shown to do (Fig. 6B). H1foo RNAi-induced PB1E decrease can be rescued by co-injection of M-H1foo-Venus mRNA Consistent with the previous report in mouse oocytes (Furuya et al., 2007), down-regulation of H1foo also significantly impaired oocyte maturation in the bovine; our study further demonstrated that only
422
Yan Yun et al.
Figure 6 Effect of H1e expression on bovine oocyte maturation. (A) MII eggs microinjected with H1e-Venus or H1foo-Venus mRNA (green). Oocytes were incubated with Hoechst 33342 (blue) to stain chromatin. Note: Bar = 50 m. (B) Effect of H1e or H1foo overexpression on bovine oocyte maturation given as PB1E(%). Table 3 Modified Hlfoo tagged sequence for rescue from siRNA3 (letters in italics show the modified sequence) Target sequence location 971–1009
Sequence source
Nucleotides sequence
Wild type Modified type
GCATCCCCACCAAGTCTTCAGTGTCCAAAGCGGCCAGCA GCATCCCCACTAAATCATCGGTCTCAAAGGCGGCCAGCA
oocyte-specific types of linker histone H1foo overexpression rather than any somatic types could promote oocyte maturation (Fig. 6). To further confirm the function of H1foo, we applied a rescue experiment in H1foo-depleted oocytes, using a modified H1foo cDNA (M-H1foo) that encoded a functional protein but could not be targeted for degradation by siRNA3 (sequence in Table 3). Similar to what was observed in the H1foo overexpression group, co-injection of M-
H1foo mRNA with siRNA-3 significantly increased the PB1E rate when compared with the control groups (Fig. 7).
Discussion Down-regulation of H1foo expression during bovine oocyte maturation impaired meiotic progression, a
Effects of H1foo on oocyte maturation
423
Figure 7 PB1E reduction was rescued by co-injection of M-H1foo mRNA. Effect of different versions of H1foo mRNA expression with siRNA-3 on bovine oocyte maturation.
conclusion that is consistent with a previous report (Furuya et al., 2007). Moreover, our results showed that only H1foo rather than somatic type of linker histones overexpression could stimulate extrusion of the first polar body, suggesting its indispensible role during bovine oocyte meiotic progression. Based on our data, it is possible that a threshold level of H1foo expression is required for oocyte maturation, such that only those oocytes that possess more than the threshold limit will be able to or have a higher chance to continue for maturation. This hypothesis would, in some way, explain why individual GV oocytes have different fates (arrested at GV, MI or matured to MII) after in vitro maturation. The in vitro collected GV-stage oocytes come from different follicles or different ovaries with diverse conditions, thus accumulating variable level of H1foo; this factor may finally decide their fate. Only the proportion of oocytes that had accumulated sufficient H1foo could mature to MII eggs ready for fertilization. It is also a reason to explain why in vitro matured oocytes are comparatively not as successful as in vivo oocytes, because the former might experience sub-optimal conditions during in vitro maturation, resulting in the loss of components globally, including H1foo. Our observations that H1foo overexpression stimulated meiotic maturation in vitro added evidence to the H1foo-threshold hypothesis, although further investigations are needed to reveal the unknown pathways. Compared with somatic linker histones, which can compensate for each other (Fu et al., 2003), H1foo is indispensable in the process of oocyte maturation (Furuya et al., 2007). One explanation is related to the abnormal ratio of H1 to nucleosomes that has been shown to be essential for mammalian development
(Fan et al., 2003). Oocytes are transcriptionally silent, and H1foo is the unique, or at least the predominant, linker-histone subunit required for oocyte maturation (Tanaka et al., 2001, 2003b). Therefore, down-regulation of H1foo would directly result in a dramatic decrease in the total amount of H1. The other explanation for the importance of H1foo in oocyte maturation is demonstrated by the lack of functional H1foo studies. It has been reported that only H1foo, rather than somatic linker histones, is capable of correcting chromatin association in oocytes because of the presence of divergent N-terminal and globular domains (Becker et al., 2005). A study that used fluorescence recovery after photobleaching (FRAP) showed that H1foo binds chromatin more tightly, this finding provided molecular evidence for the replacement of somatic histones with H1foo during fertilization and nuclear transfer (Gao et al., 2004; Teranishi et al., 2004; Becker et al., 2005; Jullien et al., 2010; Mizusawa et al., 2010; Yun et al., 2012). All these observations indicated that H1foo possesses both structure and function diversity compared with somatic types histones, and performs an indispensable role during oocyte maturation and early embryo development. Due to the absence of a bovine H1foo antibody, we performed the co-transfection of plasmid pH1fooVenus (GFP variant) and siRNA in HeLa cells to screen out an effective siRNA against H1foo in order that the GFP antibody could be used to detect the interference efficiency (Yun et al., 2008). The RNAi results in bovine oocytes showed that H1foo transcripts decreased by 70%, consistent with the data on HeLa cells. Here, we have developed a way of overcoming the dilemma of having no standard antibody.
424
Yan Yun et al.
In mice, antisense morpholino oligonucleotides (MO) against H1foo were injected into GV oocytes. After arrest for 20 h, dbcAMP was washed off from the culture medium to allow the spontaneous resumption of meiosis. Only 33.1% of H1foo-depleted oocytes extruded a first polar body, compared with 81.1% in the control (Furuya et al., 2007). However, the GV was not visible in bovine oocytes. Recently we showed that the removal of cumulus cells at the GV stage did not impair bovine oocyte maturation. Here, we denuded the granulose cells and microinjected siRNA or mRNA at 8 h after in vitro maturation of oocytes, when the majority of the oocytes had completed GV breakdown (GVBD; Liu et al., 2012). In our H1foo knockdown group, the oocytes had a 41.2% first polar body extrusion rate, compared with 67.1% in the control. Our data indicate that H1foo expression after GVBD is still essential for bovine oocyte meiotic progression. This investigation demonstrates conclusively that H1foo is essential for the process of bovine oocyte maturation.
Supplementary material To view supplementary material for this article, please visit http://dx.doi.org/10.1017/S0967199414000021
Acknowledgements This work was supported by the National Natural Science Foundation of China (grant no. 31172280). References Becker, M., Becker, A., Miyara, F., Han, Z., Kihara, M., Brown, D.T., Hager, G.L., Latham, K., Adashi, E.Y. & Misteli, T. (2005). Differential in vivo binding dynamics of somatic and oocyte-specific linker histones in oocytes and during ES cell nuclear transfer. Mol. Biol. Cell 16, 3887–95. Dworkin-Rastl, E., Kandolf, H. & Smith, R.C. (1994). The maternal histone H1 variant, H1M (B4 protein), is the predominant H1 histone in Xenopus pregastrula embryos. Dev. Biol. 161, 425–39. Fan, Y., Sirotkin, A., Russell, R.G., Ayala, J. & Skoultchi, A.I. (2001). Individual somatic H1 subtypes are dispensable for mouse development even in mice lacking the H1(0) replacement subtype. Mol. Cell. Biol. 21, 7933–43. Fan, Y., Nikitina, T., Morin-Kensicki, E.M., Zhao, J., Magnuson, T.R., Woodcock, C.L. & Skoultchi, A.I. (2003). H1 linker histones are essential for mouse development and affect nucleosome spacing in vivo. Mol. Cell. Biol. 23, 4559–72. Fu, G., Ghadam, P., Sirotkin, A., Khochbin, S., Skoultchi, A.I. & Clarke, H.J. (2003). Mouse oocytes and early embryos express multiple histone H1 subtypes. Biol. Reprod. 68, 1569–76.
Furuya, M., Tanaka, M., Teranishi, T., Matsumoto, K., Hosoi, Y., Saeki, K., Ishimoto, H., Minegishi, K., Iritani, A. & Yoshimura, Y. (2007). H1foo is indispensable for meiotic maturation of the mouse oocyte, J. Reprod. Dev. 53, 895– 902. Gao, S., Chung, Y.G., Parseghian, M.H., King, G.J., Adashi, E.Y. & Latham, K.E. (2004). Rapid H1 linker histone transitions following fertilization or somatic cell nuclear transfer: evidence for a uniform developmental program in mice, Dev. Biol. 266, 62–75. Godde, J.S. & Ura, K. (2009). Dynamic alterations of linker histone variants during development. Int. J. Dev. Biol. 53, 215–29. Happel, N. & Doenecke, D. (2009). Histone H1 and its isoforms: contribution to chromatin structure and function. Gene 431, 1–12. Izzo, A., Kamieniarz, K. & Schneider, R. (2008). The histone H1 family: specific members, specific functions? Biol. Chem. 389, 333–43. Jullien, J., Astrand, C., Halley-Stott, R.P., Garrett, N. & Gurdon, J.B. (2010). Characterization of somatic cell nuclear reprogramming by oocytes in which a linker histone is required for pluripotency gene reactivation. Proc. Natl. Acad. Sci. USA 107, 5483–8. Khochbin, S. & Wolffe, A.P. (1994). Developmentally regulated expression of linker-histone variants in vertebrates. Eur. J. Biochem. 225, 501–10. Liu, W.Q., Yin, J.Q., Zhao, G.M., Yun, Y., Wu, S.J., Jones, K.T. & Lei, A.M. (2012). Differential regulation of cyclin B1 degradation between the first and second meiotic divisions of bovine oocytes. Theriogenology 78, 1171–81. McGraw, S., Vigneault, C., Tremblay, K. & Sirard, M.A. (2006). Characterization of linker histone H1FOO during bovine in vitro embryo development. Mol. Reprod. Dev. 73, 692–9. Medrzycki, M., Zhang, Y., Cao, K. & Fan, Y. (2012). Expression analysis of mammalian linker-histone subtypes. J. Vis. Exp. DOI: 10.3791/3577. Mizusawa, Y., Kuji, N., Tanaka, Y., Tanaka, M., Ikeda, E., Komatsu, S., Kato, S. & Yoshimura, Y. (2010). Expression of human oocyte-specific linker histone protein and its incorporation into sperm chromatin during fertilization. Fertil. Steril. 93, 1134–41. Paradis, F., Vigneault, C., Robert, C. & Sirard, M.A. (2005). RNA interference as a tool to study gene function in bovine oocytes. Mol. Reprod. Dev. 70, 111–21. Tanaka, M., Hennebold, J.D., Macfarlane, J. & Adashi, E.Y. (2001). A mammalian oocyte-specific linker histone gene H1oo: homology with the genes for the oocyte-specific cleavage stage histone (cs-H1) of sea urchin and the B4/H1M histone of the frog. Development 128, 655–64. Tanaka, Y., Kato, S., Tanaka, M., Kuji, N. & Yoshimura, Y. (2003a). Structure and expression of the human oocytespecific histone H1 gene elucidated by direct RT-nested PCR of a single oocyte. Biochem. Biophys. Res. Commun. 304, 351–7. Tanaka, M., Kihara, M., Meczekalski, B., King, G.J. & Adashi, E.Y. (2003b). H1oo: a pre-embryonic H1 linker histone in search of a function. Mol. Cell. Endocrinol. 202, 5–9. Tanaka, M., Kihara, M., Hennebold, J.D., Eppig, J.J., Viveiros, M.M., Emery, B.R., Carrell, D.T., Kirkman, N.J.,
Effects of H1foo on oocyte maturation Meczekalski, B., Zhou, J., Bondy, C.A., Becker, M., Schultz, R.M., Misteli, T., De La Fuente, R., King, G.J. & Adashi, E.Y. (2005). H1FOO is coupled to the initiation of oocytic growth. Biol. Reprod. 72, 135–42. Teranishi, T., Tanaka, M., Kimoto, S., Ono, Y., Miyakoshi, K., Kono, T. & Yoshimura, Y. (2004). Rapid replacement of somatic linker histones with the oocyte-specific linker histone H1foo in nuclear transfer. Dev. Biol. 266, 76–86. Terme, J.M., Sese, B., Millan-Arino, L., Mayor, R., Belmonte, J.C., Barrero, M.J. & Jordan, A. (2011). Histone H1
425
variants are differentially expressed and incorporated into chromatin during differentiation and reprogramming to pluripotency. J. Biol. Chem. 286, 35347–57. Yun, Y., Zheng, X.B., Liu, W.Q., Dou, Z.Y. & Lei, A.M. (2008). Construction of eukaryotic expression vector of bovine Nanog gene and screening for effective siRNA. Scientia Agricultura Sinica 41, 4180–6. [in Chinese] Yun, Y., Zhao, G.M., Wu, S.J., Li, W. & Lei, A.M. (2012). Replacement of H1 linker histone during bovine somatic cell nuclear transfer. Theriogenology 78, 1371–80.
