0021-972X/90/7101-0223$02.00/0 Journal of Clinical Endocrinology and Metabolism Copyright © 1990 by The Endocrine Society
Vol. 71, No. 1 Printed in U.S.A.
H-Ras Protooncogene Mutations in Human Thyroid Neoplasms* HIROYUKI NAMBA, RAUL A. GUTMAN, KEIICHI MATSUO, ADRIANA ALVAREZ, AND JAMES A. FAGIN Department of Medicine, Cedars-Sinai Medical Center, University of California School of Medicine (H.N., K.M., J.A.F.), Los Angeles, California 90048; and the Division of Endocrinology, Hospital Italiano (R.A.G., A.A.), Buenos Aires, Argentina
ABSTRACT. Structural alterations of protooncogene sequences may be involved in the pathogenesis of human neoplasms. We screened 64 thyroid tumors (36 benign and 18 malignant) for gene rearrangements of the protooncogenes cmyc, c-myb, c-fos, c-erb-Bl, c-erb-B2, c-erb-A, N-ras, K-ras, and H-ras. Only mutations of H-ras were observed. None of the 15 colloid adenomas examined had detectable H-ras rearrangements. Of the remaining tumors, we observed mutations of H-ras in 4 benign and 4 malignant neoplasms. Gene amplification was found in 5 tumors. An aggressive recurrent papillary carcinoma had a marked amplification of one of the H-ras alleles. The amplified allele was truncated, in that the 3' variable tandem repeat was not a part of the amplification unit, and
E
contained a codon 12 point mutation leading to a valine for glycine substitution. We also observed the association of low copy gene amplification with a codon 12 valine for glycine mutation in a follicular adenoma. Two tumors contained H-ras EcoRl polymorphisms not present in the DNA of normal thyroid from the same individuals, and one follicular carcinoma showed loss of an H-ras allele. Ras protooncogenes may become transforming by quantitative mutations, leading to increased expression, or qualitative mechanisms, through activating point mutations. Both of these appear to coexist in thyroid neoplasms, and it may be that a combination of both mechanisms is capable of inducing a more complete spectrum of neoplastic phenotypes. (J Clin Endocrinol Metab 7 1 : 223-229, 1990)
under regulatory growth control by TSH and other growth factors (4-9), but there is presently no clear understanding of the events that may disrupt this process. Thyroid neoplasms for the most part originate from a single cell type, the thyroid follicular cell. Indeed, follicular cells give rise to benign and malignant thyroid tumors of different phenotypic characteristics and variable biological and clinical behaviors. Environmental factors, such as exposure to radiation and iodine deficiency, play a role in the pathogenesis of some of these tumors. There is little information regarding the molecular mechanisms that may be involved in the generation of thyroid neoplasms. In particular, there have been few studies examining structural alterations in protooncogene sequences in human thyroid tumors. In this paper we examined the DNA of 53 benign and malignant thyroid tumors for structural mutations of the cellular protooncogenes c-myc, c-myb, c-fos, c-er6-Bl, c-erb-B2, c-erb-A, N-ras, K-ras, and H-ras. We report the presence of gene rearrangements of H-ras in 4 benign and 4 malignant neoplasms. A detailed characterization of a complex mutation of H-ras in an aggressive papillary carcinoma is described, showing the unusual association of marked gene amplification of a truncated segment of H-ras with a point mutation of codon 12. Our data
VALUATION of thyroid nodules represents a common and important clinical problem. Between 510% of individuals will develop a thyroid nodule in their lifetime. Only 10-20% of patients with thyroid tumors sent to surgery, however, harbor malignant thyroid neoplasms (1). The distinction among thyroid hyperplastic nodules, adenomas, and follicular carcinomas is often difficult even after careful histological examination. These diagnostic difficulties stem from major gaps in our understanding of the biology and cellular pathophysiology of thyroid growth disorders. Tumor development may result from a series of genetic alterations that affect the normal mechanisms controlling growth. Molecular events that have been identified include deletions of chromosome regions believed to contain tumor-suppressor genes (2) as well as alterations in the structure of cellular protooncogenes (3). The thyroid provides an attractive model to study the steps that may be involved in the neoplastic process. Thyroid cells are Received January 4,1990. Address all correspondence and requests for reprints to: James A. Fagin, M.D., Division of Endocrinology, Cedars-Sinai Medical Center, Becker Building 131, 8700 Beverly Boulevard, Los Angeles, California 90048. * This work was supported in part by NIH Grants CA-50706 and DK-41906.
223
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
NAMBA ET AL.
224
support a role for mutations of H-ras in the pathogenesis of thyroid neoplasms. Materials and Methods Tissues Thyroid tissues were obtained at the time of surgery and immediately frozen in liquid N2. Wherever possible, samples were taken from both the tumor and the normal thyroid from each individual. The histological diagnosis of the 53 patients studied is shown in Table 1. Nucleic acid extractions Tissues were ground under liquid N2using mortar and pestle. DNA was extracted from a cesium chloride ultracentrifugation gradient (11). The DNA layer was immediately precipitated in 2.5 vol ethanol and recovered by spooling. The DNA pellet was then rinsed in 10 mL 80% ethanol and recovered by centrifugation at 3000 x g at room temperature. DNA was digested at 37 C overnight with 1 Mg/mL proteinase-K in a buffer containing 150 mM NaCl, 10 mM Tris (pH 7.5), 10 mM EDTA, and 0.4% sodium dodecyl sulfate (SDS). The mixture was then phenol-chloroform extracted. Sodium acetate (final concentration, 0.3 mM) was added to the aqueous layer, which was then ethanol precipitated. DNA was pelleted, air dried, and resuspended in H2O. After quantification by absorption at 260 nm, extracts were stored at 4 C until assayed. Southern and Northern blot hybridizations DNA (10 jig) was digested to completion with the appropriate restriction enzymes, subjected to electrophoresis on 0.8% agarose gels, and transferred to nylon membrane filters by Southern blotting. The filters were hybridized in a buffer containing 50% formamide, 5 x SSPE (43.8 g/L NaCl, 6.9 g/L NaN2PO4N2O, and 1.85 g/L EDTA), 5 x Denhardt's solution (1 g/L polyvinyl-pyrrolidone, 1 g/L BSA, and 1 g/L Ficoll 400), 0.1% SDS, and 200 ng/mL salmon sperm DNA for 48 h at 42 C with 32 P-labeled DNA probes. After hybridization the filters were washed twice in 2 x SSC (0.3 M NaCl and 30 mM sodium citrate)-0.1% SDS at room temperature, and then twice in 0.1 X SSC-0.1% SDS at 55 C. Blots were then exposed to film for autoradiography. DNA probes The following human DNA probes were used: c-erb-A (pHEal; Spurr), c-er6-B (pAE-PuuII; J. Yokota), c-erb-B-2 (KpnlTABLE 1. Histological characteristics of thyroid neoplasms Adenomas: Colloid Follicular Carcinomas: Papillary Follicular Medullary Total
15 21 13 4 1 54
J C E & M • 1990 Vol 71 • No 1
Hindlll fragment of pCER204; T. Yamamoto), c-fos (pc-/bs-l; T. Curran), c-myc [9 kilobases (kb) pHSR-1; J. M. Bishop], cH-ras (BamHI fragment of pUC EJ 6.6; R. Weinberg or probe pTBB-2; Y. Nakamura), c-K-ras (p640; R. Weinberg), c-N-ras (p52.C; R. Weinberg), c-myb (pHM.2.6; D. Stehelin), 7-actin (L. Kedes), and chromosome lOq VNTR probe pEFD-75 (Y. Nakamura). Probes were labeled with [32P]dCTP using the random primer technique (14) following the manufacturer's protocol (Boehringer Mannheim, Indianapolis, IN) Polymerase chain reaction (PCR) amplification of thyroid tissue DNA (15) Genomic DNA (1 fig) was amplified for 30 cycles with 2.5 U Taq polymerase (Perkin Elmer-Cetus, Norwalk, CT) and 1 ^M of the following oligonucleotide primers: 5' H-ras codon 12/13: ATGACGGAATATAAGCTGGT and 3' H-ras codon 12/13: CTCTATAGTGGGGTCGTATT; or 5' H-ras codon 61: AGGTGGTCATTGATGGGGAG and 3' H-ras codon 61: AGGAAGCCCTCCCCGGTGCG (Clontech Laboratories, Palo Alto, CA) in a total volume of 100 nL. The PCR mix contained 10 mM Tris (pH 8.3), 50 mM KC1, 1.5 mM MgCl2, 0.1% gelatin, and 10 mM each of dATP, dCTP, dTTP, and dGTP. The first cycle was performed as follows. Denaturation was carried out for 5 min at 95 C, annealing at 55 C for 2 min, and extension at 70 C for 2 min. In subsequent cycles, denaturation was for 2 min at 94 C, annealing for 2 min at 55 C, and extension for 2 min at 70 C. After completion, 10 ^L PCR product were electrophoresed on 4% NuSieve agarose (FMC, Rockland, ME) gels, and the size of the amplified DNA was compared to that of appropriate molecular size markers by ethidium bromide staining. Oligonucleotide probe hybridization Twenty microliters of the PCR mixture were denatured by heating (95 C; 2 min) in 100 fiL 0.4 N NaOH-25 mM EDTA, and then cooled rapidly to 4 C. One hundred microliters of 2 M Tris-HCl (pH 7.4) were then added, and the mixture was applied to nylon transfer membrane filters (Micron Separations, Inc., Westboro, MA) under vacuum using a slot blot apparatus. DNA was fixed by UV light illumination. Oligonucleotides specific for the wild-type and possible point mutants of codons 12,13, and 61 of H-ras were purchased from Clontech Laboratories (Palo Alto, CA) or the UCLA Molecular Biology Institute (Los Angeles, CA). Oligonucleotide probes were prepared by end labeling with [7-32P]ATP (6000 Ci/mmol; DuPont, Claremont, CA) (16). Briefly, 200 ng oligonucleotide were incubated with 10 nL [7-32P]ATP and 2 nL T4 polynucleotide kinase (BRL, Bethesda, MD) in 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 5 mM dithiothreitol, 0.1 mM spermidine, and 0.1 mM EDTA at 37 C for 60 min. After incubation, the probes were isolated with Sep-Pak 18 columns (Waters Associates, Milford, MA). Membranes were hybridized with 5 x 106 cpm/ mL end-labeled probe in 10 mL hybridization mix (5 X SSPE, 5 x Denhardt's, and 0.5% SDS) for 12 h at 50 C. The membranes were washed twice with 250 mL 6 X SSC-0.1% SDS at Td-2C (17) for 30 min and then autoradiographed at -70 C for 6-18 h.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
H-ras PROTOONCOGENE MUTATIONS IN HUMAN THYROID NEOPLASMS
225
Sequencing The sequencing of the PCR products was performed using 5 pmol 7-z32P-labeledsequencing primer ATGACGGAATATAHGCTGGT, using chain termination sequencing with dideoxinucleotides and T7 DNA polymerase (Sequenase, U.S. Biochemical Corp., Cleveland, OH) according to manufacturers instructions with the modifications described (18).
Results Studies with c-myc, c-myb, c-fos, c-er6-Bl, c-erfe-B2, and c-er6-A Thyroid tumors from the 54 patients were examined for the presence of major structural gene rearrangements of the above protooncogenes. We found no cases of DNA amplification or EcoRl polymorphisms for any of the above protooncogenes within the regions explored by the appropriate probes in our sample of tumors (data not shown). Studies with K-ras, N-ras, and H-ras Figure 1 shows a representative Southern blot of DNA from thyroid tissue (both normal and tumor from each patient) cohybridized with DNA probes for both K-ras and N-ras. No amplification or rearrangement of either of these two oncogenes was observed in this blot or in any of the 54 thyroid tumors studied. The H-ras gene has a region of variable tandem repeats (VTR) of a 28-basepair consensus sequence, located approximately 1 kb 3' of the polyadenylation signal (19). This VTR is the basis for a BamHl (or an EcoRl) H-ras polymorphism, an example of which is seen in EcoRlrestricted DNA from normal and tumor thyroid tissues of patient A3 (Fig. 2). A 3-fold amplification was observed in one of the H-ras alleles from the follicular adenoma removed from this patient (Figs. 2 and 5A).
FlG. 1. Southern blot of 10 Mg^coRI-restricted DNA of paired samples of normal thyroid (N) and thyroid tumor (T) from each patient cohybridized with both human c-K-ras and c-N-ras probes. The top arrow corresponds to the 7.2-kb N-ras band; the lower arrow to 3.2-kb K-ras.
FIG. 2. Southern blot of 10 fig .EcoRI-digested DNA from paired samples of normal thyroid (N) and thyroid tumor (T) hybridized with the c-H-ras probe. Arrows indicate H-ras bands of 8.1 and 6.8 kb. The 6.8-kb allele is amplified in tumor A3 (follicular adenoma). Tumors from patients 19 (papillary carcinoma) and A5 (follicular adenoma) show the appearance of different sized alleles of about 4 and 6.8 kb, respectively, which were not present in normal thyroid tissue from the same individuals.
Tumor DNA from patients 19 (papillary carcinoma) and A5 (atypical follicular adenoma; Fig. 2) shows the appearance of EcoRl H-ras bands of about 4 and 6.8 kb, respectively, which were not present in the surrounding normal thyroid from the same individuals, pointing to a mutation occurring in one of the H-ras alleles of each of these tumors. DNA from an aggressive recurrent papillary adenocarcinoma that had proven resistant to radioactive 131I therapy (patient A4) showed a striking amplification of one of the two H-ras alleles, which were differentially resolved due to an EcoRl polymorphism (Fig. 3). We further characterized this mutation by restriction mapping (Fig. 3D). Digestion of tumor DNA with BamHl showed 8.1- and 6.8-kb H-ras bands, the latter corresponding to the amplified allele. Interestingly, additional Sad digestion seems to indicate that the amplification unit consists of the promoter and four exons, but excludes the 3' VTR region. The evidence for this is that the amplified 0.8and 3.2-kb bands are likely to correspond to an area 5' to the promoter and to the promoter and the whole coding sequence, respectively; in contrast, the two larger bands (4.5 and 6.6 kb), which are not amplified, probably correspond to sequences up-stream of the most proximal Sad site and down-stream to the 3' VTR region (Fig. 3E). The major mechanism of mutational activation of ras genes is due to single base substitutions in codon 12, 13, or 61. We, therefore, examined whether the amplified and truncated H-ras gene present in the papillary carcinoma DNA of patient A4 also contained such point mutations. Genomic DNA from normal thyroid and the thyroid tumor was amplified by PCR using primers flanking codons 12 and 13 or codon 61 of H-ras. The amplified DNA was blotted and sequentially hybridized with a battery of oligonucleotide probes specific for the wild-type and possible point mutants. As shown in Fig.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
NAMBA ET AL.
226
A4 FIG. 3. A-D, Southern blot of 10 ng DNA from normal (N) and thyroid tumor (T). A-C, EcoRl digests. A and B show a longer and shorter autoradiographic exposure, respectively, of the same blot hybridized with the c-H-ras probe. Arrows indicate H-ras bands of 8.1 and 6.8 kb. C, Rehybridization of same blot with 7-actin. Arrow markers indicate 7-actin bands of 8.8, 6.5, 4.4, and 2.3 kb. D, DNA (10 ng) from the tumor of patient A4 was digested with BamHl (B) or Sad (S) and hybridized with c-H-ras. Arrows indicate band sizes of 8.1 and 6.8 kb (B) and 3.2 and 0.8 kb (S). E, Schematic representation of the human H-ras gene. B, BamHI. S, Sad. Black boxes, Exons I-IV.
A16
A18
JCE & M • 1990 Vol 71 • No 1
£19 N~*~T
A17 N T
B
B
H12wt
H12wnl
G
A
T
C
FlG. 4. A, Slot blot of thyroid tissue DNA amplified with primers flanking H-ras codon 12,13 hybridized with 7-32P-labeled oligonucleotides for the H-ras codon 12,13 wild-type (Hl2wt) or the codon 12 valine point mutant (Hl2val). Upper row, DNA from normal thyroid tissues. Arrow indicates slot containing amplified DNA from papillary carcinoma A4. B, Sequencing gel of amplified DNA of tumor A4. Arrow indicates a T for G substitution in codon 12, confirming the codon 12 valine mutation.
4A, amplified DNA from both normal and tumor tissues hybridized with the codon 12,13 wild-type probe (upper panel). In contrast, only the amplified DNA from the tumor tissue hybridized with the oligonucleotide probe for the codon 12 valine mutation (lower panel). This
FIG. 5. A, Southern blot of 10 ng Tagl-digested DNA from paired samples of normal thyroid (N) and thyroid tumor tissue (T) hybridized with the H-ras probe. Patients A3 (follicular adenoma) and A6 and 66 (papillary carcinomas) have amplification of H-ras. Arrows indicate 2.3- to 4.3-kb bands. B, Rehybridization with chromosome lOq probe pEFD-75. Arrows indicate bands of 2-3 kb. C, Southern blot of BamHI and Sphl restricted DNA of normal thyroid (N) and a follicular carcinoma (T) hybridized with H-ras. The two lower bands correspond to the polymorphic VTR region of each allele, one of which is lost in the tumor tissue.
finding was confirmed by sequencing the amplified DNA, where a T for G substitution was observed in H-ras codon 12 in the tumor DNA fragment (Fig. 4B). An H-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
H-ras PROTOONCOGENE MUTATIONS IN HUMAN THYROID NEOPLASMS ras codon 12 valine mutation was also present in the DNA of the follicular adenoma from patient A3, which also contained an H-ras amplification. Two other papillary carcinomas had low copy number amplifications of the H-ras gene: patients A6 and 66 (Fig. 5A), as did the follicular adenomas of patients A3 (Fig. 5A) and 29 (not shown). We could not detect any other structural abnormalities of these H-ras genes by restriction mapping. The increase in band intensity was not due to differences in DNA loading, since rehybridization of these blots with a chromosome lOq probe showed equivalent band densities (Fig. 5B). Finally, DNA from a follicular carcinoma (Fig. 5C) showed the loss of one of the H-ras alleles. Normal thyroid DNA from the patient contained a BamHl polymorphism which allowed resolution of the two alleles, one of which was lost in the tumor tissue DNA.
Discussion There is scant information on the putative role of structural alterations in protooncogene sequences in human thyroid tumorigenesis. Four of 10 thyroid tumors studied by del Senno et al. (20) presented abnormalities of the c-myc gene (3 of them had an EcoRl polymorphism, and 1 a large gene deletion). They also reported that 3 of the 10 tumors considered had minor 2-fold amplifications of c-myc. In contrast, Terrier et al. (21) found no evidence of c-/os or c-myc gene amplification in tumor specimens from 22 patients with thyroid adenoma and 23 with thyroid carcinoma. This latter study is in accord with the observations described in our present report, where no cases of structural mutations of cmyc, c-myb, c-fos, c-erb-Bl, c-er6-B2, or c-erb-A were found. Recently, a transforming gene was identified with the NIH 3T3 cell focus assay in the DNA of specimens of papillary thyroid carcinoma (22). The transforming DNA did not hybridize with probes for any of the known oncogenes, including those coding for the ras genes. No sequence information, however, was provided on this putative novel transforming gene. Microfollicular adenomas and follicular carcinomas have a 50% prevalence, and papillary carcinomas a 20% prevalence of point mutations of the three human ras genes (23, 24). Our observation that structural mutations of c-H-ras were present in four benign and four malignant thyroid tumors is, therefore, of particular interest. Five of these tumor DNA specimens had amplification of c-H-ras. Yokota et al. (25) found no tumors containing amplification of cH-ras among 176 human cancers, illustrating the infrequency of this mutation event. There are controversial data regarding the ability of multiple copies of the normal H-ras protooncogene to transform cells in vitro (26, 27).
227
It is estimated that a 30- to 100-fold overexpression of ras proteins is required to induce cellular transformation (27), levels that are unlikely to have occurred in our tumor series. Expression of ras genes may be increased in a variety of human primary neoplasms. The three ras oncogenes, H-ras, N-ras, and K-ras, all code for 21,000 mol wt proteins designated p21 (28). Johnson et al. (29) examined p21 immunoreactivity in paraffin-embedded sections of human thyroid specimens. They reported that normal thyroid tissues showed the least immunoreactivity, whereas papillary, follicular, and Hurthle cell carcinomas stained relatively more intensely than thyroid adenomas. It remains to be established whether the presumed increased levels of ras protein in thyroid neoplasms reflect structural alterations of the ras genes or factors affecting their regulation. It is important to note that 3- to 4-fold increases in gene copy number, as found in three of our tumors, could be due to polysomy of chromosome 11 rather than true gene amplification. Although we did not specifically exclude this, it is noteworthy that in two recent reports (30, 31), no cases of chromosome 11 polysomy were found on cytogenetic analysis of a number of follicular and papillary neoplasms. Although ras genes may become transforming by quantitative or qualitative mechanisms, in general terms neoplastic properties are more readily conferred by alleles activated by specific missense mutations (27). However, it may be that a combination of both mechanisms is capable of inducing a more complete spectrum of neoplastic phenotypes (27). Such a case may be that of papillary carcinoma A4, which contained an amplification of an H-ras allele truncated at some point between the polyadenylation signal and the region of VTR sequences. VTR sequences are interspersed throughout the genome and are believed to be hot spots for recombination (32). It has also been suggested that in the H-ras gene, the VTR may have regulatory properties (27), and that it may be in linkage disequilibrium with regions containing missense mutations (33). However, experimental evidence indicating that the hypervariable VTR of H-ras may be involved in the induction of neoplasia is still lacking. The markedly amplified allele found in this thyroid tumor also contained a point mutation of codon 12, leading to a valine for glycine substitution. We cannot be certain which of the two alleles contained the point mutation. However, the fact that the T for G substitution was readily observed in a sequencing gel that included both sense and antisense strands suggests that the mutation was in the amplified allele. There has been a previous report of amplification of a point-mutated allele of a H-ras gene in a primary pancreatic carcinoma (34). The clinical and biological behavior of this particular thyroid neoplasm deserves special com-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
228
NAMBA ET AL.
ment. The tumor was an invasive papillary adenocarcinoma which recurred locally after surgery and radioactive iodine therapy. Recently, Sklar (35) reported that transfection of NIH 3T3 cells withrasoncogenes activated by missense mutations increased the resistance of the cells to damage by ionizing radiation, and it is tempting to speculate that the activated, amplified, and overexpressed H-ras gene present in this tumor may have been instrumental in making it radioresistant. It is noteworthy, however, that a follicular adenoma (A3) also contained a similar combination of mutations, although the magnitude of the amplification was not as great, and the amplified allele was not truncated. Two of the thyroid tumors studied contained an EcoRl polymorphism not present in the DNA from the normal surrounding tissue. The inheritance of rare H-ras DNA
polymorphisms has been suggested to be associated with a predisposition to human cancer (33, 36). However, we are unaware of any reports of somatic cell mutations leading to the generation of H-ras restriction fragment length polymorphisms. Unfortunately, we did not have sufficient tumor DNA to further map these mutations, and therefore, we cannot elaborate on the potential significance of these mutations to thyroid tumorigenesis. Loss ofrasalleles occurs infrequently in human neoplasms (25). Such deletions have been identified in tumors where the remaining allele was activated (37, 38) as well as in tumors where the remaining allele was apparently normal (25, 33, 39). We identified an H-ras deletion in a follicular carcinoma, which appeared to contain a normal remaining allele (it contained no point mutations). Deletion of a ras gene may predispose to neoplasia by permiting the unopposed action of its mutated counterpart. Interestingly, Larsson et al. (40) have recently mapped the locus of multiple endocrine neoplasia type 1 to chromosome 11. DNA from insulinomas tissue from the patients studied had a deletion of a chromosomal fragment which included the gene for Hras, believed to be contiguous to a putative tumor suppressor gene (40). Thus, although deletion of H-ras may be a random event, it may also be a marker for the loss of a neighboring gene associated with growth control. The role of cellular protooncogenes in normal growth of thyroid cells has recently attracted considerable attention. TSH and cAMP evoke a transient induction of cmyc, c-fos, and c-H-ras mRNA content (5, 41-43) in rat FRTL5 thyroid cells. Of particular interest is the fact that the transformed state can be induced in FRTL5 cells by the cooperative interaction of the v-H-ras and human c-myc oncogenes, as shown by DNA transfection studies (44). A clearer understanding of the role of mutations of the ras genes in the various human thyroid tumor phenotypes will be gained by careful studies on the prevalence of point mutations of these genes in a
JCE & M • 1990 Vol 71 • No 1
large series of benign and malignant tumors and the significance of their coexistence with other genetic aberrations.
Acknowledgments We are particularly indebted to Dr. Alfred Katz for his generous cooperation in providing us with thyroid tissue specimens. We are also grateful to the members of the Department of Pathology at CedarsSinai for their continued support, and to Dr. Norman Arnheim (University of Southern California) for helpful discussions.
References 1. Rojeski MT, Gharib H. Nodular thyroid disease. Evaluation and management. N Engl J Med. 1985;313:428-36. 2. Klein G. The approaching era of the tumor suppressor genes. Science. 1987;238:1539-45.
3. Bishop JM. The molecular genetics of cancer. Science. 1987;235:305-ll. 4. Roger PO, Dumont JE. Factors controlling proliferation and differentiation of canine thyroid cells cultured in reduced serum conditions: effect of thyrotropin and growth factors. Mol Cell Endocrinol. 1984;36:79-93. 5. Dere WH, Hirayu H, Rapoport B. TSH and cAMP enhance expression of the myc proto-oncogene in cultured thyroid cells. Endocrinology. 1985;117:2249-51. 6. Errick JA, Ing KWA, Eggo MC, Burrow GN. Growth and differentiation in cultured human thyroid cells: effects of epidermal growth factor and thyrotropin. In Vitro Cell Dev Biol. 1986;22:2836. 7. Tramontano D, Cushing GW, Moses AC, Ingbar SH. Insulin-like growth factor I stimulates the growth of rat thyroid cells in culture and synergizes the stimulation of DNA synthesis induced by TSH and Graves'-IgG. Endocrinology. 1986;122:127-32. 8. Maciel RMB, Moses AC, Villone G, Tramontano D, Ingbar H. Demonstration of the production and physiological role of insulinlike growth factor II in rat thyroid follicular cells in culture. J Clin Invest. 1989;82:1546-53. 9. Smith P, Wynford-Thomas D, Stringer BMJ, Williams ED. Growth factor control of rat thyroid follicular cell proliferation. Endocrinology. 1986;119:1439-45. 10. Deleted in proof 11. Davis LG, Dibner MD, Battey JF. Basic methods in molecular biology. New York: Elsevier; 1986;133-5. 12. Deleted in proof 13. Fagin JA, Pixley S, Slanina S, Ong J, Melmed S. Insulin-like growth factor I gene expression in GH3 rat pituitary cells: messenger ribonucleic acid content, immunohistochemistry and secretion. Endocrinology. 1987;120:2037-43. 14. Feinberg AP, Vogelstein B. A technique for labeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 1983;132:6-13. 15. Saiki RK, Scharf S, Faloona F, et al. Enzymatic amplification of beta globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 1985;230:1350-3. 16. Garrett Miyada C, Bruce Wallace R. Oligonucleotide hybridization techniques. In: Berger SL, Kimmel AR, eds. Methods in enzymology. San Diego: Academic Press; 1987;152:94-107. 17. DiLella AG, Woo SLC. Hybridization of genomic DNA to oligonucleotide probes in the presence of tetramethylammonium chloride. In: Berger SL, Kimmel AR, eds. Methods in enzymology. San Diego: Academic Press; 1987;152:447-51. 18. Innis MA, Myambo KB, Gelfand DH, Brow MAD. DNA sequencing with thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction amplified DNA. Proc Natl Acad Sci USA. 1988;85:9436-40. 19. Capon DJ, Chen EY, Levinson AD, Seeburg PH, Goeddel DV. Complete nucleotide sequences of the T24 human bladder card-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
H-ras PROTOONCOGENE MUTATIONS IN HUMAN THYROID NEOPLASMS noma oncogene and its normal homologue. Nature. 1983;302:33-7. 20. del Senno L, degli Uberti E, Bernardi F, et al. c-Myc oncogene alterations in human thyroid carcinomas. Cancer Detect Prevent. 1987;10:159-66. 21. Terrier P, Sheng ZM, Schlumberger M, et al. Structure and expression of c-myc and c-fos proto-oncogenes in thyroid carcinomas. Br J Cancer. 1988;57:43-7. 22. Fusco A, Grieco M, Santoro M, et al. A new oncogene in human thyroid papillary carcinomas and their lymphnodal metastases. Nature. 1987;328:170-2. 23. Lemoine MR, Mayall ES, Wyllie JS, et al. High frequency of ras oncogene activation in all stages of human thyroid tumorigenesis. Oncogene. 1989;4:159-64. 24. Lemoine NR, Mayall ES, Wyllie FS, et al. Activated ras oncogenes in human thyroid cancers. Cancer Res. 1988;48:4459-63. 25. Yokota J, Tsunetsugu-Yokota Y, Battifora H, Le Fevre C, Cline MJ. Alterations of myc, myb, and Ha ras proto-oncogenes in cancers are frequent and show clinical correlation. Science. 1986;231:261-4. 26. Pulciani S, Santos E, Long LK, Sorrentino V, Barbacid M. Ras gene amplification and malignant transformation. Mol Cell Biol. 1985;5:2836-41. 27. Barbacid M. Ras genes. Annu Rev Biochem. 1987;56:779-827. 28. Slamon DJ, deKernion JB, Verma IM, Cline MJ. Expression of cellular oncogenes in human malignancies. Science. 1984;224:25662. 29. Johnson TL, Lloyd RV, Thor A. Expression of ras oncogene p21 antigen in normal and proliferative thyroid tissue. Am J Pathol. 1987;127:60-5. 30. Olah E, Balogh E, Bojan F, Juhasz F, Stenszky V, Farid NR. Cytogenetic analyses of three papillary carcinomas and a follicular adenoma of the thyroid. Cancer Genet Cytogenet. 1990;44:119-29. 31. Van den Berg E, Oosterhuis JW, De jong B, et al. Cytogenetics of thyroid follicular adenomas. Cancer Genet Cytogenet. 1990;44:21722. 32. Jeffreys AJ, Wilson V, Thein SL. Hypervariable "mini-satellite"
229
regions in human DNA. Nature. 1985;314:67-73. 33. Krontiris TG, DiMartino NA, Colb M, Parkinson DR. Unique allelic restriction fragments of the human Ha-ras locus in leukocyte and tumor DMAs of cancer patients. Nature. 1985;313:369-74. 34. Yamada H, Sakamoto H, Taira M, et al. Amplifications of both cKi-ras with a point mutation and c-myc in a primary pancreatic cancer and its metastatic tumors in lymph nodes. Jpn J Cancer Res. 1986;77:370-5. 35. Sklar MD. The ras oncogenes increase the intrinsic resistance of NIH 3T3 cells to iodine radiation. Science. l988;239:645-7. 36. Heighway J, Thatcher N, Cerny T, Hasleton PS. Genetic predisposition to human lung cancer. Br J Cancer. 1986;53:453-7. 37. Feinberg AP, Vogelstein B, Droller MJ, Baylin SB, Nelkin BD. Mutation of the 12th amino acid of the c-Ha-ras-1 oncogene occurs infrequently in human cancer. Science. 1983;220:1175-7. 38. Fearon ER, Feinberg AP, Hamilton SH, Vogelstein B. Loss of genes in the short arm of chromosome 11 in bladder cancer. Nature. 1985;318:377-80. 39. Yoshimoto K, Iizuka M, Iwahana H, et al. Loss of the same alleles of H-ros-1 and D11S151 in two independent pancreatic cancers from a patient with multiple endocrine neoplasia type 1. Cancer Res. 1989;49:2716-21. 40. Larsson C, Skogsied B, Oberg K, Nakamura Y, Nordenskjold MC. Multiple endocrine neoplasia type I gene maps to chromosome 11 and is lost in insulinoma. Nature. 1988;332:85-7. 41. Colletta G, Cirafici AM, Vecchio G. Induction of the c-fos oncogene by thyrotropic hormone in rat thyroid cells in culture. Science. 1986;233:458-60. 42. Tramontano D, Chin WW, Moses AC, Ingbar SH. Thyrotropin and cyclic AMP increase levels of c-fos and c-myc mRNAs in cultured rat thyroid cells. J Biol Chem. 1986;261:3919-22. 43. Dere WH, Hirayu H, Rapoport B. Thyrotropin and cyclic AMP regulation of ras proto-oncogene expression in cultured thyroid cells. FEBS Lett. 1986;196:305-8. 44. Fusco A, Berlingieri MT, Di Fiore P, Portella G, Grieco M. Vecchio G. One- and two-step transformations of rat thyroid epithelial cells by retroviral oncogenes. Mol Cell Biol. 1987;9:3365-70.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
Vol. 71, No. 1 Printed in U.S.A.
H-Ras Protooncogene Mutations in Human Thyroid Neoplasms* HIROYUKI NAMBA, RAUL A. GUTMAN, KEIICHI MATSUO, ADRIANA ALVAREZ, AND JAMES A. FAGIN Department of Medicine, Cedars-Sinai Medical Center, University of California School of Medicine (H.N., K.M., J.A.F.), Los Angeles, California 90048; and the Division of Endocrinology, Hospital Italiano (R.A.G., A.A.), Buenos Aires, Argentina
ABSTRACT. Structural alterations of protooncogene sequences may be involved in the pathogenesis of human neoplasms. We screened 64 thyroid tumors (36 benign and 18 malignant) for gene rearrangements of the protooncogenes cmyc, c-myb, c-fos, c-erb-Bl, c-erb-B2, c-erb-A, N-ras, K-ras, and H-ras. Only mutations of H-ras were observed. None of the 15 colloid adenomas examined had detectable H-ras rearrangements. Of the remaining tumors, we observed mutations of H-ras in 4 benign and 4 malignant neoplasms. Gene amplification was found in 5 tumors. An aggressive recurrent papillary carcinoma had a marked amplification of one of the H-ras alleles. The amplified allele was truncated, in that the 3' variable tandem repeat was not a part of the amplification unit, and
E
contained a codon 12 point mutation leading to a valine for glycine substitution. We also observed the association of low copy gene amplification with a codon 12 valine for glycine mutation in a follicular adenoma. Two tumors contained H-ras EcoRl polymorphisms not present in the DNA of normal thyroid from the same individuals, and one follicular carcinoma showed loss of an H-ras allele. Ras protooncogenes may become transforming by quantitative mutations, leading to increased expression, or qualitative mechanisms, through activating point mutations. Both of these appear to coexist in thyroid neoplasms, and it may be that a combination of both mechanisms is capable of inducing a more complete spectrum of neoplastic phenotypes. (J Clin Endocrinol Metab 7 1 : 223-229, 1990)
under regulatory growth control by TSH and other growth factors (4-9), but there is presently no clear understanding of the events that may disrupt this process. Thyroid neoplasms for the most part originate from a single cell type, the thyroid follicular cell. Indeed, follicular cells give rise to benign and malignant thyroid tumors of different phenotypic characteristics and variable biological and clinical behaviors. Environmental factors, such as exposure to radiation and iodine deficiency, play a role in the pathogenesis of some of these tumors. There is little information regarding the molecular mechanisms that may be involved in the generation of thyroid neoplasms. In particular, there have been few studies examining structural alterations in protooncogene sequences in human thyroid tumors. In this paper we examined the DNA of 53 benign and malignant thyroid tumors for structural mutations of the cellular protooncogenes c-myc, c-myb, c-fos, c-er6-Bl, c-erb-B2, c-erb-A, N-ras, K-ras, and H-ras. We report the presence of gene rearrangements of H-ras in 4 benign and 4 malignant neoplasms. A detailed characterization of a complex mutation of H-ras in an aggressive papillary carcinoma is described, showing the unusual association of marked gene amplification of a truncated segment of H-ras with a point mutation of codon 12. Our data
VALUATION of thyroid nodules represents a common and important clinical problem. Between 510% of individuals will develop a thyroid nodule in their lifetime. Only 10-20% of patients with thyroid tumors sent to surgery, however, harbor malignant thyroid neoplasms (1). The distinction among thyroid hyperplastic nodules, adenomas, and follicular carcinomas is often difficult even after careful histological examination. These diagnostic difficulties stem from major gaps in our understanding of the biology and cellular pathophysiology of thyroid growth disorders. Tumor development may result from a series of genetic alterations that affect the normal mechanisms controlling growth. Molecular events that have been identified include deletions of chromosome regions believed to contain tumor-suppressor genes (2) as well as alterations in the structure of cellular protooncogenes (3). The thyroid provides an attractive model to study the steps that may be involved in the neoplastic process. Thyroid cells are Received January 4,1990. Address all correspondence and requests for reprints to: James A. Fagin, M.D., Division of Endocrinology, Cedars-Sinai Medical Center, Becker Building 131, 8700 Beverly Boulevard, Los Angeles, California 90048. * This work was supported in part by NIH Grants CA-50706 and DK-41906.
223
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
NAMBA ET AL.
224
support a role for mutations of H-ras in the pathogenesis of thyroid neoplasms. Materials and Methods Tissues Thyroid tissues were obtained at the time of surgery and immediately frozen in liquid N2. Wherever possible, samples were taken from both the tumor and the normal thyroid from each individual. The histological diagnosis of the 53 patients studied is shown in Table 1. Nucleic acid extractions Tissues were ground under liquid N2using mortar and pestle. DNA was extracted from a cesium chloride ultracentrifugation gradient (11). The DNA layer was immediately precipitated in 2.5 vol ethanol and recovered by spooling. The DNA pellet was then rinsed in 10 mL 80% ethanol and recovered by centrifugation at 3000 x g at room temperature. DNA was digested at 37 C overnight with 1 Mg/mL proteinase-K in a buffer containing 150 mM NaCl, 10 mM Tris (pH 7.5), 10 mM EDTA, and 0.4% sodium dodecyl sulfate (SDS). The mixture was then phenol-chloroform extracted. Sodium acetate (final concentration, 0.3 mM) was added to the aqueous layer, which was then ethanol precipitated. DNA was pelleted, air dried, and resuspended in H2O. After quantification by absorption at 260 nm, extracts were stored at 4 C until assayed. Southern and Northern blot hybridizations DNA (10 jig) was digested to completion with the appropriate restriction enzymes, subjected to electrophoresis on 0.8% agarose gels, and transferred to nylon membrane filters by Southern blotting. The filters were hybridized in a buffer containing 50% formamide, 5 x SSPE (43.8 g/L NaCl, 6.9 g/L NaN2PO4N2O, and 1.85 g/L EDTA), 5 x Denhardt's solution (1 g/L polyvinyl-pyrrolidone, 1 g/L BSA, and 1 g/L Ficoll 400), 0.1% SDS, and 200 ng/mL salmon sperm DNA for 48 h at 42 C with 32 P-labeled DNA probes. After hybridization the filters were washed twice in 2 x SSC (0.3 M NaCl and 30 mM sodium citrate)-0.1% SDS at room temperature, and then twice in 0.1 X SSC-0.1% SDS at 55 C. Blots were then exposed to film for autoradiography. DNA probes The following human DNA probes were used: c-erb-A (pHEal; Spurr), c-er6-B (pAE-PuuII; J. Yokota), c-erb-B-2 (KpnlTABLE 1. Histological characteristics of thyroid neoplasms Adenomas: Colloid Follicular Carcinomas: Papillary Follicular Medullary Total
15 21 13 4 1 54
J C E & M • 1990 Vol 71 • No 1
Hindlll fragment of pCER204; T. Yamamoto), c-fos (pc-/bs-l; T. Curran), c-myc [9 kilobases (kb) pHSR-1; J. M. Bishop], cH-ras (BamHI fragment of pUC EJ 6.6; R. Weinberg or probe pTBB-2; Y. Nakamura), c-K-ras (p640; R. Weinberg), c-N-ras (p52.C; R. Weinberg), c-myb (pHM.2.6; D. Stehelin), 7-actin (L. Kedes), and chromosome lOq VNTR probe pEFD-75 (Y. Nakamura). Probes were labeled with [32P]dCTP using the random primer technique (14) following the manufacturer's protocol (Boehringer Mannheim, Indianapolis, IN) Polymerase chain reaction (PCR) amplification of thyroid tissue DNA (15) Genomic DNA (1 fig) was amplified for 30 cycles with 2.5 U Taq polymerase (Perkin Elmer-Cetus, Norwalk, CT) and 1 ^M of the following oligonucleotide primers: 5' H-ras codon 12/13: ATGACGGAATATAAGCTGGT and 3' H-ras codon 12/13: CTCTATAGTGGGGTCGTATT; or 5' H-ras codon 61: AGGTGGTCATTGATGGGGAG and 3' H-ras codon 61: AGGAAGCCCTCCCCGGTGCG (Clontech Laboratories, Palo Alto, CA) in a total volume of 100 nL. The PCR mix contained 10 mM Tris (pH 8.3), 50 mM KC1, 1.5 mM MgCl2, 0.1% gelatin, and 10 mM each of dATP, dCTP, dTTP, and dGTP. The first cycle was performed as follows. Denaturation was carried out for 5 min at 95 C, annealing at 55 C for 2 min, and extension at 70 C for 2 min. In subsequent cycles, denaturation was for 2 min at 94 C, annealing for 2 min at 55 C, and extension for 2 min at 70 C. After completion, 10 ^L PCR product were electrophoresed on 4% NuSieve agarose (FMC, Rockland, ME) gels, and the size of the amplified DNA was compared to that of appropriate molecular size markers by ethidium bromide staining. Oligonucleotide probe hybridization Twenty microliters of the PCR mixture were denatured by heating (95 C; 2 min) in 100 fiL 0.4 N NaOH-25 mM EDTA, and then cooled rapidly to 4 C. One hundred microliters of 2 M Tris-HCl (pH 7.4) were then added, and the mixture was applied to nylon transfer membrane filters (Micron Separations, Inc., Westboro, MA) under vacuum using a slot blot apparatus. DNA was fixed by UV light illumination. Oligonucleotides specific for the wild-type and possible point mutants of codons 12,13, and 61 of H-ras were purchased from Clontech Laboratories (Palo Alto, CA) or the UCLA Molecular Biology Institute (Los Angeles, CA). Oligonucleotide probes were prepared by end labeling with [7-32P]ATP (6000 Ci/mmol; DuPont, Claremont, CA) (16). Briefly, 200 ng oligonucleotide were incubated with 10 nL [7-32P]ATP and 2 nL T4 polynucleotide kinase (BRL, Bethesda, MD) in 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 5 mM dithiothreitol, 0.1 mM spermidine, and 0.1 mM EDTA at 37 C for 60 min. After incubation, the probes were isolated with Sep-Pak 18 columns (Waters Associates, Milford, MA). Membranes were hybridized with 5 x 106 cpm/ mL end-labeled probe in 10 mL hybridization mix (5 X SSPE, 5 x Denhardt's, and 0.5% SDS) for 12 h at 50 C. The membranes were washed twice with 250 mL 6 X SSC-0.1% SDS at Td-2C (17) for 30 min and then autoradiographed at -70 C for 6-18 h.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
H-ras PROTOONCOGENE MUTATIONS IN HUMAN THYROID NEOPLASMS
225
Sequencing The sequencing of the PCR products was performed using 5 pmol 7-z32P-labeledsequencing primer ATGACGGAATATAHGCTGGT, using chain termination sequencing with dideoxinucleotides and T7 DNA polymerase (Sequenase, U.S. Biochemical Corp., Cleveland, OH) according to manufacturers instructions with the modifications described (18).
Results Studies with c-myc, c-myb, c-fos, c-er6-Bl, c-erfe-B2, and c-er6-A Thyroid tumors from the 54 patients were examined for the presence of major structural gene rearrangements of the above protooncogenes. We found no cases of DNA amplification or EcoRl polymorphisms for any of the above protooncogenes within the regions explored by the appropriate probes in our sample of tumors (data not shown). Studies with K-ras, N-ras, and H-ras Figure 1 shows a representative Southern blot of DNA from thyroid tissue (both normal and tumor from each patient) cohybridized with DNA probes for both K-ras and N-ras. No amplification or rearrangement of either of these two oncogenes was observed in this blot or in any of the 54 thyroid tumors studied. The H-ras gene has a region of variable tandem repeats (VTR) of a 28-basepair consensus sequence, located approximately 1 kb 3' of the polyadenylation signal (19). This VTR is the basis for a BamHl (or an EcoRl) H-ras polymorphism, an example of which is seen in EcoRlrestricted DNA from normal and tumor thyroid tissues of patient A3 (Fig. 2). A 3-fold amplification was observed in one of the H-ras alleles from the follicular adenoma removed from this patient (Figs. 2 and 5A).
FlG. 1. Southern blot of 10 Mg^coRI-restricted DNA of paired samples of normal thyroid (N) and thyroid tumor (T) from each patient cohybridized with both human c-K-ras and c-N-ras probes. The top arrow corresponds to the 7.2-kb N-ras band; the lower arrow to 3.2-kb K-ras.
FIG. 2. Southern blot of 10 fig .EcoRI-digested DNA from paired samples of normal thyroid (N) and thyroid tumor (T) hybridized with the c-H-ras probe. Arrows indicate H-ras bands of 8.1 and 6.8 kb. The 6.8-kb allele is amplified in tumor A3 (follicular adenoma). Tumors from patients 19 (papillary carcinoma) and A5 (follicular adenoma) show the appearance of different sized alleles of about 4 and 6.8 kb, respectively, which were not present in normal thyroid tissue from the same individuals.
Tumor DNA from patients 19 (papillary carcinoma) and A5 (atypical follicular adenoma; Fig. 2) shows the appearance of EcoRl H-ras bands of about 4 and 6.8 kb, respectively, which were not present in the surrounding normal thyroid from the same individuals, pointing to a mutation occurring in one of the H-ras alleles of each of these tumors. DNA from an aggressive recurrent papillary adenocarcinoma that had proven resistant to radioactive 131I therapy (patient A4) showed a striking amplification of one of the two H-ras alleles, which were differentially resolved due to an EcoRl polymorphism (Fig. 3). We further characterized this mutation by restriction mapping (Fig. 3D). Digestion of tumor DNA with BamHl showed 8.1- and 6.8-kb H-ras bands, the latter corresponding to the amplified allele. Interestingly, additional Sad digestion seems to indicate that the amplification unit consists of the promoter and four exons, but excludes the 3' VTR region. The evidence for this is that the amplified 0.8and 3.2-kb bands are likely to correspond to an area 5' to the promoter and to the promoter and the whole coding sequence, respectively; in contrast, the two larger bands (4.5 and 6.6 kb), which are not amplified, probably correspond to sequences up-stream of the most proximal Sad site and down-stream to the 3' VTR region (Fig. 3E). The major mechanism of mutational activation of ras genes is due to single base substitutions in codon 12, 13, or 61. We, therefore, examined whether the amplified and truncated H-ras gene present in the papillary carcinoma DNA of patient A4 also contained such point mutations. Genomic DNA from normal thyroid and the thyroid tumor was amplified by PCR using primers flanking codons 12 and 13 or codon 61 of H-ras. The amplified DNA was blotted and sequentially hybridized with a battery of oligonucleotide probes specific for the wild-type and possible point mutants. As shown in Fig.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
NAMBA ET AL.
226
A4 FIG. 3. A-D, Southern blot of 10 ng DNA from normal (N) and thyroid tumor (T). A-C, EcoRl digests. A and B show a longer and shorter autoradiographic exposure, respectively, of the same blot hybridized with the c-H-ras probe. Arrows indicate H-ras bands of 8.1 and 6.8 kb. C, Rehybridization of same blot with 7-actin. Arrow markers indicate 7-actin bands of 8.8, 6.5, 4.4, and 2.3 kb. D, DNA (10 ng) from the tumor of patient A4 was digested with BamHl (B) or Sad (S) and hybridized with c-H-ras. Arrows indicate band sizes of 8.1 and 6.8 kb (B) and 3.2 and 0.8 kb (S). E, Schematic representation of the human H-ras gene. B, BamHI. S, Sad. Black boxes, Exons I-IV.
A16
A18
JCE & M • 1990 Vol 71 • No 1
£19 N~*~T
A17 N T
B
B
H12wt
H12wnl
G
A
T
C
FlG. 4. A, Slot blot of thyroid tissue DNA amplified with primers flanking H-ras codon 12,13 hybridized with 7-32P-labeled oligonucleotides for the H-ras codon 12,13 wild-type (Hl2wt) or the codon 12 valine point mutant (Hl2val). Upper row, DNA from normal thyroid tissues. Arrow indicates slot containing amplified DNA from papillary carcinoma A4. B, Sequencing gel of amplified DNA of tumor A4. Arrow indicates a T for G substitution in codon 12, confirming the codon 12 valine mutation.
4A, amplified DNA from both normal and tumor tissues hybridized with the codon 12,13 wild-type probe (upper panel). In contrast, only the amplified DNA from the tumor tissue hybridized with the oligonucleotide probe for the codon 12 valine mutation (lower panel). This
FIG. 5. A, Southern blot of 10 ng Tagl-digested DNA from paired samples of normal thyroid (N) and thyroid tumor tissue (T) hybridized with the H-ras probe. Patients A3 (follicular adenoma) and A6 and 66 (papillary carcinomas) have amplification of H-ras. Arrows indicate 2.3- to 4.3-kb bands. B, Rehybridization with chromosome lOq probe pEFD-75. Arrows indicate bands of 2-3 kb. C, Southern blot of BamHI and Sphl restricted DNA of normal thyroid (N) and a follicular carcinoma (T) hybridized with H-ras. The two lower bands correspond to the polymorphic VTR region of each allele, one of which is lost in the tumor tissue.
finding was confirmed by sequencing the amplified DNA, where a T for G substitution was observed in H-ras codon 12 in the tumor DNA fragment (Fig. 4B). An H-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
H-ras PROTOONCOGENE MUTATIONS IN HUMAN THYROID NEOPLASMS ras codon 12 valine mutation was also present in the DNA of the follicular adenoma from patient A3, which also contained an H-ras amplification. Two other papillary carcinomas had low copy number amplifications of the H-ras gene: patients A6 and 66 (Fig. 5A), as did the follicular adenomas of patients A3 (Fig. 5A) and 29 (not shown). We could not detect any other structural abnormalities of these H-ras genes by restriction mapping. The increase in band intensity was not due to differences in DNA loading, since rehybridization of these blots with a chromosome lOq probe showed equivalent band densities (Fig. 5B). Finally, DNA from a follicular carcinoma (Fig. 5C) showed the loss of one of the H-ras alleles. Normal thyroid DNA from the patient contained a BamHl polymorphism which allowed resolution of the two alleles, one of which was lost in the tumor tissue DNA.
Discussion There is scant information on the putative role of structural alterations in protooncogene sequences in human thyroid tumorigenesis. Four of 10 thyroid tumors studied by del Senno et al. (20) presented abnormalities of the c-myc gene (3 of them had an EcoRl polymorphism, and 1 a large gene deletion). They also reported that 3 of the 10 tumors considered had minor 2-fold amplifications of c-myc. In contrast, Terrier et al. (21) found no evidence of c-/os or c-myc gene amplification in tumor specimens from 22 patients with thyroid adenoma and 23 with thyroid carcinoma. This latter study is in accord with the observations described in our present report, where no cases of structural mutations of cmyc, c-myb, c-fos, c-erb-Bl, c-er6-B2, or c-erb-A were found. Recently, a transforming gene was identified with the NIH 3T3 cell focus assay in the DNA of specimens of papillary thyroid carcinoma (22). The transforming DNA did not hybridize with probes for any of the known oncogenes, including those coding for the ras genes. No sequence information, however, was provided on this putative novel transforming gene. Microfollicular adenomas and follicular carcinomas have a 50% prevalence, and papillary carcinomas a 20% prevalence of point mutations of the three human ras genes (23, 24). Our observation that structural mutations of c-H-ras were present in four benign and four malignant thyroid tumors is, therefore, of particular interest. Five of these tumor DNA specimens had amplification of c-H-ras. Yokota et al. (25) found no tumors containing amplification of cH-ras among 176 human cancers, illustrating the infrequency of this mutation event. There are controversial data regarding the ability of multiple copies of the normal H-ras protooncogene to transform cells in vitro (26, 27).
227
It is estimated that a 30- to 100-fold overexpression of ras proteins is required to induce cellular transformation (27), levels that are unlikely to have occurred in our tumor series. Expression of ras genes may be increased in a variety of human primary neoplasms. The three ras oncogenes, H-ras, N-ras, and K-ras, all code for 21,000 mol wt proteins designated p21 (28). Johnson et al. (29) examined p21 immunoreactivity in paraffin-embedded sections of human thyroid specimens. They reported that normal thyroid tissues showed the least immunoreactivity, whereas papillary, follicular, and Hurthle cell carcinomas stained relatively more intensely than thyroid adenomas. It remains to be established whether the presumed increased levels of ras protein in thyroid neoplasms reflect structural alterations of the ras genes or factors affecting their regulation. It is important to note that 3- to 4-fold increases in gene copy number, as found in three of our tumors, could be due to polysomy of chromosome 11 rather than true gene amplification. Although we did not specifically exclude this, it is noteworthy that in two recent reports (30, 31), no cases of chromosome 11 polysomy were found on cytogenetic analysis of a number of follicular and papillary neoplasms. Although ras genes may become transforming by quantitative or qualitative mechanisms, in general terms neoplastic properties are more readily conferred by alleles activated by specific missense mutations (27). However, it may be that a combination of both mechanisms is capable of inducing a more complete spectrum of neoplastic phenotypes (27). Such a case may be that of papillary carcinoma A4, which contained an amplification of an H-ras allele truncated at some point between the polyadenylation signal and the region of VTR sequences. VTR sequences are interspersed throughout the genome and are believed to be hot spots for recombination (32). It has also been suggested that in the H-ras gene, the VTR may have regulatory properties (27), and that it may be in linkage disequilibrium with regions containing missense mutations (33). However, experimental evidence indicating that the hypervariable VTR of H-ras may be involved in the induction of neoplasia is still lacking. The markedly amplified allele found in this thyroid tumor also contained a point mutation of codon 12, leading to a valine for glycine substitution. We cannot be certain which of the two alleles contained the point mutation. However, the fact that the T for G substitution was readily observed in a sequencing gel that included both sense and antisense strands suggests that the mutation was in the amplified allele. There has been a previous report of amplification of a point-mutated allele of a H-ras gene in a primary pancreatic carcinoma (34). The clinical and biological behavior of this particular thyroid neoplasm deserves special com-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
228
NAMBA ET AL.
ment. The tumor was an invasive papillary adenocarcinoma which recurred locally after surgery and radioactive iodine therapy. Recently, Sklar (35) reported that transfection of NIH 3T3 cells withrasoncogenes activated by missense mutations increased the resistance of the cells to damage by ionizing radiation, and it is tempting to speculate that the activated, amplified, and overexpressed H-ras gene present in this tumor may have been instrumental in making it radioresistant. It is noteworthy, however, that a follicular adenoma (A3) also contained a similar combination of mutations, although the magnitude of the amplification was not as great, and the amplified allele was not truncated. Two of the thyroid tumors studied contained an EcoRl polymorphism not present in the DNA from the normal surrounding tissue. The inheritance of rare H-ras DNA
polymorphisms has been suggested to be associated with a predisposition to human cancer (33, 36). However, we are unaware of any reports of somatic cell mutations leading to the generation of H-ras restriction fragment length polymorphisms. Unfortunately, we did not have sufficient tumor DNA to further map these mutations, and therefore, we cannot elaborate on the potential significance of these mutations to thyroid tumorigenesis. Loss ofrasalleles occurs infrequently in human neoplasms (25). Such deletions have been identified in tumors where the remaining allele was activated (37, 38) as well as in tumors where the remaining allele was apparently normal (25, 33, 39). We identified an H-ras deletion in a follicular carcinoma, which appeared to contain a normal remaining allele (it contained no point mutations). Deletion of a ras gene may predispose to neoplasia by permiting the unopposed action of its mutated counterpart. Interestingly, Larsson et al. (40) have recently mapped the locus of multiple endocrine neoplasia type 1 to chromosome 11. DNA from insulinomas tissue from the patients studied had a deletion of a chromosomal fragment which included the gene for Hras, believed to be contiguous to a putative tumor suppressor gene (40). Thus, although deletion of H-ras may be a random event, it may also be a marker for the loss of a neighboring gene associated with growth control. The role of cellular protooncogenes in normal growth of thyroid cells has recently attracted considerable attention. TSH and cAMP evoke a transient induction of cmyc, c-fos, and c-H-ras mRNA content (5, 41-43) in rat FRTL5 thyroid cells. Of particular interest is the fact that the transformed state can be induced in FRTL5 cells by the cooperative interaction of the v-H-ras and human c-myc oncogenes, as shown by DNA transfection studies (44). A clearer understanding of the role of mutations of the ras genes in the various human thyroid tumor phenotypes will be gained by careful studies on the prevalence of point mutations of these genes in a
JCE & M • 1990 Vol 71 • No 1
large series of benign and malignant tumors and the significance of their coexistence with other genetic aberrations.
Acknowledgments We are particularly indebted to Dr. Alfred Katz for his generous cooperation in providing us with thyroid tissue specimens. We are also grateful to the members of the Department of Pathology at CedarsSinai for their continued support, and to Dr. Norman Arnheim (University of Southern California) for helpful discussions.
References 1. Rojeski MT, Gharib H. Nodular thyroid disease. Evaluation and management. N Engl J Med. 1985;313:428-36. 2. Klein G. The approaching era of the tumor suppressor genes. Science. 1987;238:1539-45.
3. Bishop JM. The molecular genetics of cancer. Science. 1987;235:305-ll. 4. Roger PO, Dumont JE. Factors controlling proliferation and differentiation of canine thyroid cells cultured in reduced serum conditions: effect of thyrotropin and growth factors. Mol Cell Endocrinol. 1984;36:79-93. 5. Dere WH, Hirayu H, Rapoport B. TSH and cAMP enhance expression of the myc proto-oncogene in cultured thyroid cells. Endocrinology. 1985;117:2249-51. 6. Errick JA, Ing KWA, Eggo MC, Burrow GN. Growth and differentiation in cultured human thyroid cells: effects of epidermal growth factor and thyrotropin. In Vitro Cell Dev Biol. 1986;22:2836. 7. Tramontano D, Cushing GW, Moses AC, Ingbar SH. Insulin-like growth factor I stimulates the growth of rat thyroid cells in culture and synergizes the stimulation of DNA synthesis induced by TSH and Graves'-IgG. Endocrinology. 1986;122:127-32. 8. Maciel RMB, Moses AC, Villone G, Tramontano D, Ingbar H. Demonstration of the production and physiological role of insulinlike growth factor II in rat thyroid follicular cells in culture. J Clin Invest. 1989;82:1546-53. 9. Smith P, Wynford-Thomas D, Stringer BMJ, Williams ED. Growth factor control of rat thyroid follicular cell proliferation. Endocrinology. 1986;119:1439-45. 10. Deleted in proof 11. Davis LG, Dibner MD, Battey JF. Basic methods in molecular biology. New York: Elsevier; 1986;133-5. 12. Deleted in proof 13. Fagin JA, Pixley S, Slanina S, Ong J, Melmed S. Insulin-like growth factor I gene expression in GH3 rat pituitary cells: messenger ribonucleic acid content, immunohistochemistry and secretion. Endocrinology. 1987;120:2037-43. 14. Feinberg AP, Vogelstein B. A technique for labeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 1983;132:6-13. 15. Saiki RK, Scharf S, Faloona F, et al. Enzymatic amplification of beta globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 1985;230:1350-3. 16. Garrett Miyada C, Bruce Wallace R. Oligonucleotide hybridization techniques. In: Berger SL, Kimmel AR, eds. Methods in enzymology. San Diego: Academic Press; 1987;152:94-107. 17. DiLella AG, Woo SLC. Hybridization of genomic DNA to oligonucleotide probes in the presence of tetramethylammonium chloride. In: Berger SL, Kimmel AR, eds. Methods in enzymology. San Diego: Academic Press; 1987;152:447-51. 18. Innis MA, Myambo KB, Gelfand DH, Brow MAD. DNA sequencing with thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction amplified DNA. Proc Natl Acad Sci USA. 1988;85:9436-40. 19. Capon DJ, Chen EY, Levinson AD, Seeburg PH, Goeddel DV. Complete nucleotide sequences of the T24 human bladder card-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
H-ras PROTOONCOGENE MUTATIONS IN HUMAN THYROID NEOPLASMS noma oncogene and its normal homologue. Nature. 1983;302:33-7. 20. del Senno L, degli Uberti E, Bernardi F, et al. c-Myc oncogene alterations in human thyroid carcinomas. Cancer Detect Prevent. 1987;10:159-66. 21. Terrier P, Sheng ZM, Schlumberger M, et al. Structure and expression of c-myc and c-fos proto-oncogenes in thyroid carcinomas. Br J Cancer. 1988;57:43-7. 22. Fusco A, Grieco M, Santoro M, et al. A new oncogene in human thyroid papillary carcinomas and their lymphnodal metastases. Nature. 1987;328:170-2. 23. Lemoine MR, Mayall ES, Wyllie JS, et al. High frequency of ras oncogene activation in all stages of human thyroid tumorigenesis. Oncogene. 1989;4:159-64. 24. Lemoine NR, Mayall ES, Wyllie FS, et al. Activated ras oncogenes in human thyroid cancers. Cancer Res. 1988;48:4459-63. 25. Yokota J, Tsunetsugu-Yokota Y, Battifora H, Le Fevre C, Cline MJ. Alterations of myc, myb, and Ha ras proto-oncogenes in cancers are frequent and show clinical correlation. Science. 1986;231:261-4. 26. Pulciani S, Santos E, Long LK, Sorrentino V, Barbacid M. Ras gene amplification and malignant transformation. Mol Cell Biol. 1985;5:2836-41. 27. Barbacid M. Ras genes. Annu Rev Biochem. 1987;56:779-827. 28. Slamon DJ, deKernion JB, Verma IM, Cline MJ. Expression of cellular oncogenes in human malignancies. Science. 1984;224:25662. 29. Johnson TL, Lloyd RV, Thor A. Expression of ras oncogene p21 antigen in normal and proliferative thyroid tissue. Am J Pathol. 1987;127:60-5. 30. Olah E, Balogh E, Bojan F, Juhasz F, Stenszky V, Farid NR. Cytogenetic analyses of three papillary carcinomas and a follicular adenoma of the thyroid. Cancer Genet Cytogenet. 1990;44:119-29. 31. Van den Berg E, Oosterhuis JW, De jong B, et al. Cytogenetics of thyroid follicular adenomas. Cancer Genet Cytogenet. 1990;44:21722. 32. Jeffreys AJ, Wilson V, Thein SL. Hypervariable "mini-satellite"
229
regions in human DNA. Nature. 1985;314:67-73. 33. Krontiris TG, DiMartino NA, Colb M, Parkinson DR. Unique allelic restriction fragments of the human Ha-ras locus in leukocyte and tumor DMAs of cancer patients. Nature. 1985;313:369-74. 34. Yamada H, Sakamoto H, Taira M, et al. Amplifications of both cKi-ras with a point mutation and c-myc in a primary pancreatic cancer and its metastatic tumors in lymph nodes. Jpn J Cancer Res. 1986;77:370-5. 35. Sklar MD. The ras oncogenes increase the intrinsic resistance of NIH 3T3 cells to iodine radiation. Science. l988;239:645-7. 36. Heighway J, Thatcher N, Cerny T, Hasleton PS. Genetic predisposition to human lung cancer. Br J Cancer. 1986;53:453-7. 37. Feinberg AP, Vogelstein B, Droller MJ, Baylin SB, Nelkin BD. Mutation of the 12th amino acid of the c-Ha-ras-1 oncogene occurs infrequently in human cancer. Science. 1983;220:1175-7. 38. Fearon ER, Feinberg AP, Hamilton SH, Vogelstein B. Loss of genes in the short arm of chromosome 11 in bladder cancer. Nature. 1985;318:377-80. 39. Yoshimoto K, Iizuka M, Iwahana H, et al. Loss of the same alleles of H-ros-1 and D11S151 in two independent pancreatic cancers from a patient with multiple endocrine neoplasia type 1. Cancer Res. 1989;49:2716-21. 40. Larsson C, Skogsied B, Oberg K, Nakamura Y, Nordenskjold MC. Multiple endocrine neoplasia type I gene maps to chromosome 11 and is lost in insulinoma. Nature. 1988;332:85-7. 41. Colletta G, Cirafici AM, Vecchio G. Induction of the c-fos oncogene by thyrotropic hormone in rat thyroid cells in culture. Science. 1986;233:458-60. 42. Tramontano D, Chin WW, Moses AC, Ingbar SH. Thyrotropin and cyclic AMP increase levels of c-fos and c-myc mRNAs in cultured rat thyroid cells. J Biol Chem. 1986;261:3919-22. 43. Dere WH, Hirayu H, Rapoport B. Thyrotropin and cyclic AMP regulation of ras proto-oncogene expression in cultured thyroid cells. FEBS Lett. 1986;196:305-8. 44. Fusco A, Berlingieri MT, Di Fiore P, Portella G, Grieco M. Vecchio G. One- and two-step transformations of rat thyroid epithelial cells by retroviral oncogenes. Mol Cell Biol. 1987;9:3365-70.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 30 June 2015. at 21:14 For personal use only. No other uses without permission. . All rights reserved.
