Purification and Functional Reconstitution of a Seven-Subunit Mrp-Type Na +/H+ Antiporter

Updated information and services can be found at: http://jb.asm.org/content/196/1/28 These include: SUPPLEMENTAL MATERIAL REFERENCES

CONTENT ALERTS

Supplemental material This article cites 44 articles, 23 of which can be accessed free at: http://jb.asm.org/content/196/1/28#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

Masato Morino, Toshiharu Suzuki, Masahiro Ito and Terry Ann Krulwich J. Bacteriol. 2014, 196(1):28. DOI: 10.1128/JB.01029-13. Published Ahead of Print 18 October 2013.

Purification and Functional Reconstitution of a Seven-Subunit MrpType Naⴙ/Hⴙ Antiporter Masato Morino,a Toshiharu Suzuki,b,c Masahiro Ito,d Terry Ann Krulwicha

Mrp antiporters and their homologues in the cation/proton antiporter 3 family of the Membrane Transporter Database are widely distributed in bacteria. They have major roles in supporting cation and cytoplasmic pH homeostasis in many environmental, extremophilic, and pathogenic bacteria. These antiporters require six or seven hydrophobic proteins that form heterooligomeric complexes, while most other cation/proton antiporters require only one membrane protein for their activity. The resemblance of three Mrp subunits to membrane-embedded subunits of the NADH:quinone oxidoreductase of respiratory chains and to subunits of several hydrogenases has raised interest in the evolutionary path and commonalities of their protontranslocating domains. In order to move toward a greater mechanistic understanding of these unusual antiporters and to rigorously demonstrate that they function as secondary antiporters, powered by an imposed proton motive force, we established a method for purification and functional reconstitution of the seven-subunit Mrp antiporter from alkaliphilic Bacillus pseudofirmus OF4. Naⴙ/Hⴙ antiporter activity was demonstrated by a fluorescence-based assay with proteoliposomes in which the Mrp complex was coreconstituted with a bacterial FoF1-ATPase. Proton pumping by the ATPase upon addition of ATP generated a proton motive force across the membranes that powered antiporter activity upon subsequent addition of Naⴙ.

A

variety of cation/proton antiporters have been described for both eukaryotic cell membranes and organelles as well as bacterial cells (1–3). In bacteria, cation/proton antiporters generally exchange a cytoplasmic cation, e.g., Na⫹, Li⫹, K⫹, or Ca2⫹, for one or more external protons, i.e., H⫹. These antiporters are secondary transporters that derive the energy for antiporter activity from an electrochemical gradient of protons, the proton motive force (PMF), with the inside of the cell being alkaline and negative relative to the outside. The PMF is generated by primary proton pumps such as the proton-pumping respiratory chain complexes or H⫹-coupled ATPases (4). The secondary antiporters use the energy of the PMF to extrude potentially cytotoxic cations, such as Na⫹, in exchange for external protons, thus avoiding toxic levels of accumulation. Cation/proton antiporters also play a major role in cytoplasmic pH homeostasis, especially in bacteria growing in alkaline media or niches, a condition which necessitates active H⫹ import from that relatively proton-poor external milieu (5, 6). There are over a half dozen distinct families of cation/proton antiporters in the Transporter Classification Database, based upon shared structural features (7, 8). The structural complexity of the Mrp-type antiporters, which comprise cation/proton antiporter family 3 (CPA3) of the database, is unique. Most other cation/ proton antiporters function with only one hydrophobic membrane protein, sometimes assembled as an oligomer, such as the intensively characterized homodimeric NhaA protein from Escherichia coli (9). In contrast, the CPA3 family of antiporters, which are commonly referred to by the name of the initial example, Mrp (10), are the products of operons that carry either seven genes, the mrpA to -G genes, or six genes, the mrpA= to -G genes, in which MrpA= is a fused version of MrpA and MrpB (11). All of the genes are required for full activity, and all but MrpE are required for any significant activity (12–15). Studies of seven-subunit Bacillus Mrp antiporters show that they form hetero-oligomeric complexes containing all seven subunits, and the active form of Mrp appears

28

jb.asm.org

Journal of Bacteriology

to be a dimer of the hetero-oligomeric Mrp complex (15, 16). Mrp-type antiporters have been found in bacteria and archaea from diverse ecological niches and genera and are among the antiporters that have critical roles in bacterial pathogens (11, 12, 17–22). However, the structural complexity of Mrp antiporters has made it difficult to unravel the antiport mechanism, which is needed to gain an understanding of the advantages conferred by its unusual complexity in settings in which it is important and often essential. Another feature of the Mrp antiporters that has enhanced investigative interest in them is the striking resemblance of three subunits of these antiporters, MrpA, -D, and -C, to subunits NuoL, NuoM/N, and NuoK, respectively, of the membrane-embedded, proton-translocating segment of complex I (NADH:quinone oxidoreductase) of bacterial and eukaryotic respiratory chains (23–26). MrpA and -D also resemble subunits of a group of membrane-bound hydrogenases whose energization involves transmembrane proton translocation (27, 28). Bayer et al. (29) even suggested that the Mrp-type antiporter of Staphylococcus aureus, the CPA3 antiporter Mnh, might recruit an electron-injecting module and function as a Na⫹-pumping NADH:quinone oxidoreductase rather than as a secondary antiporter that catalyzes PMF-dependent Na⫹ efflux. This idea was advanced as an explanation for a higher transmembrane potential in the presence of a

Received 30 August 2013 Accepted 9 October 2013 Published ahead of print 18 October 2013 Address correspondence to Terry Ann Krulwich, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /JB.01029-13. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/JB.01029-13

p. 28 –35

January 2014 Volume 196 Number 1

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

‹Department of Pharmacology and System Therapeutics, Icahn School of Medicine at Mount Sinai, New York, New York, USAa; Department of Molecular Bioscience, KyotoSangyo University, Miraikan, Aomi, Tokyo, Japanb; Chemical Resources Laboratory, Tokyo Institute of Technology, Nagatsuta, Yokohama, Japanc; Graduate School of Life Sciences and Bio-Nano Electronics Research Center, Toyo University, Oura-Gun, Gunma, Japand

Functional Reconstitution of an Mrp-Type Antiporter

TABLE 1 Bacterial strains and plasmids used in this study Genotype

Reference or source

Escherichia coli strains DH5␣ MCR KNabc DK8

F⫺ mcrA⌬1 (mrr-hsd RMS-mcrBC) ␾80dlacZ⌬(lacZYA-argF)U169 deoR recA1 endA1 supE44 ␭ thi-1 gyr-496 relA1 TG1 (⌬nhaA ⌬nhaB ⌬chaA) 1100 (⌬uncBC ilv::Tn10)

Stratagene 33 32

Cloning vector; Ampr Ampr pGEM7zf(⫹) plus mrp operon from B. pseudofirmus OF4 (MrpA-T7, MrpB-FLAG, MrpC–c-myc, MrpD-HA, and MrpG-His) pET21b(⫹) plus mrp operon from B. pseudofirmus OF4 (MrpG-His) pGEM7zf(⫹) plus mrp operon from B. pseudofirmus OF4 (MrpD-S and MrpG-His) pGEM7zf(⫹) plus mrp operon from B. pseudofirmus OF4 (MrpA-T7, MrpB-FLAG, MrpC–c-myc, MrpD-S, and MrpG-His) pGEM7zf(⫹) plus mrp operon from B. pseudofirmus OF4 (MrpA-T7, MrpB-FLAG, MrpC–c-myc, MrpD-His, and MrpG-S) pGEMmrp TFCHAH plus MrpG-Y111C mutation

Promega Novagen This study

pTrc99A (Amersham Pharmacia, CA) plus uncIBEFHAGDC from Bacillus sp. PS3; lacks C-terminal region of the ε subunit; Ampr

32

Plasmids pGEM7zf(⫹) pET21b(⫹) pGEMmrp TFCHAH pETOF4Mrp pGEMmrp SH pGEMmrp TFCSH pGEMmrp TFCHS7 pGEMmrp TFCHAH MrpG-Y111C pTR19-ASDS-ε⌬c

functional Mnh operon than in its absence, but that observation could reflect a cell-wide reaction to the increased demand for membrane potential, leading to a large increase in proton pumping by the established respiratory chain components (30). Negation of the idea of primary pumping for a staphylococcal CPA3 antiporter comes from an elegant bioinformatic study by Moparthi and Hägerhall (31) which showed that the genomes of S. aureus stains lack a subunit that is critical for assembly of a functional bona fide complex I. Still, it is important to show rigorously that a purified and functionally reconstituted Mrp antiporter relies upon a source of PMF generated by imposed electrochemical ion gradients. Here we report on functional reconstitution of the seven-subunit Mrp antiporter from alkaliphilic Bacillus pseudofirmus OF4, which specifically couples Na⫹ efflux to H⫹ influx in vivo and in everted membrane vesicles. The antiporter activity in vesicles was energized by a transmembrane pH gradient (⌬pH) and was also shown to be electrogenic, which is important for its function in the native alkaliphile host at pH values at which the ⌬⌿ is the sole driving force (4, 5, 30). For generation of a PMF in the proteoliposomes, purified FoF1-ATPase derived from Bacillus PS3 (32) was coreconstituted into the liposomes with the Mrp antiporter. MATERIALS AND METHODS Bacterial strains, culture conditions, and plasmids. The bacterial strains and plasmids used in this study are listed in Table 1, along with their properties and sources. Escherichia coli strains DH5␣ MCR (GibcoBRL) (wild type), KNabc (antiporter deficient), and DK8 (ATP synthase deficient) were used in this study for routine genetic manipulations, growth of transformants expressing various tagged versions of the B. pseudofirmus OF4 Mrp antiporter, and growth of transformants expressing the Bacillus PS3 ATP synthase used in the reconstitution, respectively. The FoF1ATPase expressed from the plasmid was a mutant that had a fused His10 tag at the N terminus of the ␤ subunit and was deleted in part of the ε subunit C-terminal region in order to minimize ε-mediated inhibition of the ATP hydrolysis that generates the PMF (32). Two plasmids, pGEMmrp TFCHAH and pTR19-ASDS-ε⌬c, were used to express the

January 2014 Volume 196 Number 1

This study This study This study 15 This study

Mrp antiporter and FoF1-ATPase, respectively. The E. coli KNabc transformant with pGEMmrp TFCHAH was grown in LBK-Na medium (1% tryptone, 0.5% yeast extract, 83 mM KCl, and 200 mM NaCl, pH 7.5) supplemented with 0.1 mg/ml ampicillin and 0.25 mg/ml kanamycin (33). The E. coli DK8 transformant with pTR19-ASDS-ε⌬c was grown in 2⫻ YT medium (2% tryptone, 1% yeast extract, and 200 mM NaCl, pH 7.2) supplemented with 0.1 mg/ml ampicillin. For the preparation of membrane vesicles for purification, the bacterial transformants were grown at 37°C for 20 h. The E. coli KNabc transformant was grown until the optical density at 600 nm (OD600) reached 0.8 for right-side-out membrane preparation. Construction of pGEMmrp TFCHAH and the MrpG-Y111C mutant. We constructed a pGEM7zf(⫹)-based expression plasmid, named pGEMmrp TFCHAH, which contained an inserted B. pseudofirmus OF4 mrp operon with a T7 tag, FLAG tag, c-myc tag, hemagglutinin (HA) tag, and His6 tag sequence fused to the mrpA, mrpB, mrpC, mrpD, and mrpG genes, respectively. PCR steps were performed using AccuPrime pfx DNA polymerase (Invitrogen). The scheme of construction of pGEMmrp TFCHAH is shown in Fig. S1 in the supplemental material, and a description follows here. For the construction of pETOF4Mrp (with an MrpGHis tag), PCR was performed using B. pseudofirmus OF4 genomic DNA with primers pETOF4Mrp-F and pETOF4Mrp-R. The amplified PCR product was digested with EcoRI-XhoI and then ligated into EcoRI-XhoIdigested pET21b(⫹) vector (Novagen). This resulted in cloned MrpG with a His6 tag sequence fused at its C terminus. To fuse an S tag to the C terminus of MrpD, two independent PCRs were performed with pETOF4Mrp as the template, using two sets of primers: MrpD-S-F and pETOF4Mrp-R plus OF4Mrp3 and MrpD-S-R. The two purified PCR products were used as the template for a second PCR with primers OF4Mrp3 and pETOF4Mrp-R. The purified PCR product of this reaction was digested with BamHI and then cloned into BamHIdigested pGEM7zf(⫹). This resulted in pGEMmrp SH (MrpD-S tag and MrpG-His tag). For construction of pGEMmrp TFCSH (with the MrpA-T7, MrpBFLAG, MrpC– c-myc, MrpD-S, and MrpG-His tags), pGEMmrp SH was digested with BamHI and then cloned into BamHI-digested pGEMmrp TFCHS. The construction of pGEMmrp TFCHS was described previously (15). Next, we replaced the S-tag sequence with an HA tag at the C terminus of MrpD because the S tag was not detectable using an available

jb.asm.org 29

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

Strain or plasmid

Morino et al.

TABLE 2 Primers used in this study Sequence (5=–3=)

Accession no. (corresponding site [nucleotides])

pETOF4Mrp-F pETOF4Mrp-R MrpD-S-F MrpD-S-R OF4Mrp3 MrpD-HA-F MrpD-HA-R SP6-R Y111C-F Y111C-R

GAATTCGATGACCGTATTACATTGGGC CTCGAGGTTGCTTCCTTTCATTTTC GCTGCTGCGAAATTTGAACGCCAGCACATGGACTCGTAATTAAGGAGTAGATGCTAATGGCTT CATGTGCTGGCGTTCAAATTTCGCAGCAGCGGTTTCTTTCTCCTTAAGTACAGATTCGATATA GGGACAAAGTATCAACTTCGCG TATCCGTATGATGTGCCGGATTATGCGTAATTAAGGAGTAGATGCTAA TTACGCATAATCCGGCACATCATACGGATACTCCT TAAGTACAGATTCATTTAGGTGACACTATAGAATACTCAAGCT AAGAAGATGTGTGAGAAGAAA TTTCTTCTCACACATCTTCTT

AF097740.3 (823–843) AF097740.3 (6569–6587) AF097740.3 (5473–5497) AF097740.3 (5463–5481) AF097740.3 (4452–4474) AF097740.3 (5473–5491) AF097740.3 (5463–5481) X65310 (111–140) AF097740.3 (6551–6572) AF097740.3 (6551–6572)

commercial antibody. Two independent PCRs were performed with pGEMmrp TFCSH as the template, using two sets of primers: MrpDHA-F and SP6-R plus OF4Mrp3 and MrpD-HA-R. The two purified PCR products were used as the template for a second PCR with primers OF4Mrp3 and SP6-R. The purified PCR product of this reaction was digested with EcoRV/KpnI and then cloned into EcoRV/KpnI-digested pGEMmrpTFCSH. This resulted in pGEMmrp TFCHAH (with the MrpA-T7, MrpB-FLAG, MrpC– c-myc, MrpD-HA, and MrpG-His tags). An MrpG-Y111C mutant was constructed by a PCR using pGEMmrp TFCHAH as the template. Two independent PCRs were performed, using the primers Y111C-F and SP6-R plus OF4Mrp3 and Y111C-R. The two purified PCR products were used as the template for a second PCR with primers OF4Mrp3 and SP6-R. The purified PCR product of this reaction was digested with EcoRI/NruI and then cloned into EcoRI/NruI-digested pGEMmrp TFCHAH. The primers used are listed in Table 2. Membrane preparation from E. coli transformant cells. E. coli KNabc cells were grown for the specified times and then washed and suspended in PA3-8 buffer (10 mM HEPES-KOH, pH 8.0, 5 mM MgCl2, and 10% glycerol). The cells were ruptured using a French press (180,000 lb/in2). DNase I (0.3 mg/ml) and proteinase inhibitor cocktail (3 tablets of EDTA-free Complete inhibitor cocktail [Roche]) were added to the lysates. Unbroken cells were removed by centrifugations at 7,000 ⫻ g and 26,000 ⫻ g, each for 10 min. The membrane fraction was collected by ultracentrifugation at 180,000 ⫻ g for 90 min and then suspended in fresh PA3-8 buffer. The membrane fraction was stored at ⫺80°C. For membrane preparation from DK8 transformants, PA3 buffer (10 mM HEPESKOH, pH 7.5, 5 mM MgCl2, and 10% glycerol) was used instead of PA3-8. Right-side-out membrane vesicles for sidedness assays were prepared by a modification of a previously reported procedure (34). E. coli KNabc transformant cells expressing the tagged mrpG gene as part of a full mrp operon were grown to late log phase. They were then harvested and resuspended in a high-osmolarity buffer (10 mM HEPES-KOH, pH 7.0, 50 mM KCl, 30% sucrose, 10 mM EDTA, and 0.5 mg/ml lysozyme). After incubating at room temperature for 30 min, the spheroplasts were collected by centrifugation at 5,000 ⫻ g. The spheroplasts were then resuspended in a low-osmolarity buffer (10 mM HEPES-KOH, pH 7.5, 50 mM KCl, 15 mM MgCl2, 0.3 mg/ml DNase I, and proteinase inhibitor cocktail) by use of a syringe with a 19 1/2-gauge needle. After standing at 4°C for 30 min, the lysate was centrifuged at 45,000 ⫻ g for 30 min. The pellets were suspended in fresh PA3 buffer and subjected to centrifugation at 800 ⫻ g for 30 min to remove unbroken cells. Finally, right-side-out membrane vesicles were concentrated by centrifugation at 45,000 ⫻ g for 30 min. Purification of Mrp antiporter. The membranes (10 mg/ml) from the particular transformant cells were solubilized by incubation for 30 min at 4°C in PA3-8 buffer to which 1.0% decylmaltoside (DM; Anatrace) and 0.3 M KCl had been added. Extracted proteins were separated by ultracentrifugation at 180,000 ⫻ g for 15 min. The supernatant was transferred to a new tube with a Talon resin (Clontech) preequilibrated according to the manufacturer’s instructions. The mixture was stirred for 2 h at 4°C.

30

jb.asm.org

The resin was packed into an empty column and washed with 2 column volumes of W1 buffer (10 mM HEPES-KOH, pH 8.0, 5 mM MgCl2, 100 mM KCl, 10% glycerol, 0.15% DM, and 20 mM imidazole). Mrp proteins were eluted with 3 column volumes of E1 buffer (10 mM HEPES-KOH, pH 8.0, 5 mM MgCl2, 100 mM KCl, 10% glycerol, 0.15% DM, and 200 mM imidazole). The eluted fraction was concentrated by ultrafiltration through 100-kDa-cutoff membranes (GE Healthcare). To remove excess imidazole, the concentrated fraction was diluted 10-fold in D1 buffer (10 mM HEPES-KOH, pH 8.0, 5 mM MgCl2, 100 mM KCl, 10% glycerol, and 0.15% DM) and concentrated again. This step was repeated once more. Freshly prepared Mrp was used for the reconstitution experiments. Purification of FoF1-ATPase. Purification of FoF1-ATPase was carried out by a modification of a previously reported procedure (35). The membrane fraction (10 mg/ml) was solubilized by incubation in PA3 buffer with 2% Triton X-100 (Anatrace) and 0.5% sodium cholate (Sigma-Aldrich) for 60 min at 4°C. After ultracentrifugation at 180,000 ⫻ g for 15 min, the supernatant was diluted 5-fold in PA3 buffer with 100 mM KCl and 25 mM imidazole. Preequilibrated Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen) was added to the diluted supernatant and incubated at 4°C for 60 min. The resin was packed into an empty column and washed with 10 column volumes of W2 buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl2, 100 mM KCl, 10% glycerol, 0.15% DM, and 20 mM imidazole). Fractions containing FoF1-ATPase were eluted with 3 column volumes of E2 buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl2, 100 mM KCl, 10% glycerol, 0.15% DM, and 200 mM imidazole). The eluted fraction was concentrated by ultrafiltration through 50-kDa-cutoff membranes (Millipore). To remove excess imidazole, the concentrated fraction was diluted 10-fold in D1 buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl2, 100 mM KCl, 10% glycerol, and 0.15% DM) and concentrated again. This dilution and concentration step was then repeated. The final purified fraction was stored as aliquots at ⫺80°C, conditions under which it maintained its proton-pumping activity. Lipid preparation and reconstitution. Phosphatidylcholine from soybean (type II-S; Sigma-Aldrich) was dissolved in buffer (10 mM HEPES-KOH, pH 8.0, 5 mM MgCl2, and 0.5 mM dithiothreitol) with a final concentration of 44 mg/ml. The suspension was stirred at room temperature for 30 min and then sonicated using a tip-type sonicator. The dispersed lipid solution was dialyzed against the same buffer with 400 times the volume at 4°C for 2 days. The lipid was frozen and stored at ⫺80°C. Fresh purified Mrp antiporter, at the indicated concentrations, and purified FoF1-ATPase (0.1 mg) were added to 0.3 ml of lipid solution that had been solubilized during a 30-min incubation with 1.0% DM. After stirring for 30 min with the lipids, 200 mg of BioBeads (Bio-Rad) was added, and the mixture was again stirred for 30 min, followed by addition of an additional 200 mg of BioBeads and stirring at 4°C overnight. The proteoliposomes were diluted in 6 ml of assay buffer (10 mM HEPESKOH, pH 8.0, 100 mM KCl, and 5 mM MgCl2) and ultracentrifuged at

Journal of Bacteriology

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

Primer

Functional Reconstitution of an Mrp-Type Antiporter

January 2014 Volume 196 Number 1

density at 450 nm, reflecting oxidation by OPD, was measured using a Power Wave XS2 instrument (BioTek). The density at 450 nm was normalized to the maximal value obtained with all samples. No significant signal was detected in a control experiment using proteoliposomes reconstituted with the wild-type Mrp antiporter. The background signal of a sample without added proteoliposomes was subtracted from the values for each of the other samples. Apparent half-saturation constants of intact proteoliposomes and solubilized proteoliposomes (hint and hsol) were calculated from a plot of normalized values at 450 nm versus the concentration of proteoliposomes. Starting with the original labeled proteoliposome suspension, which had 44 mg lipid/ml, samples were diluted as shown on the x axis of Fig. 3. Other procedures. Protein assays were carried out using a Pierce bicinchoninic acid (BCA) protein assay kit (Thermo Scientific). Blue native PAGE (BN-PAGE) was performed as described previously (15). In Western blots, each Mrp subunit was detected using commercially available polyclonal antibodies; anti-T7-tag, -FLAG-tag, -c-myc-tag, -HA-tag, and -His6-tag antibodies conjugated with HRP were purchased from Abcam. MrpE and MrpF proteins were detected using antibodies specific for their peptide sequences (15). Precast 4 to 16% native PAGE bis-Tris gels were purchased from Invitrogen.

RESULTS AND DISCUSSION

Purification of the alkaliphile Mrp antiporter. A Mrp variant with a fused His tag at the C terminus of the MrpG subunit was used for purification. The B. pseudofirmus OF4 Mrp antiporter had earlier been shown to form three hetero-oligomeric complexes: a full-Mrp complex containing all seven subunits; MrpAMrpG, a dimer containing two full complexes; and smaller but significant amounts of an inactive complex composed of only MrpA, MrpB, MrpC, and MrpD subunits (15). The full-Mrp complexes were expected to be selectively purified via the MrpGHis tag. As shown in Fig. 1A and B, all 7 Mrp proteins were detected in the purified fraction. The major form in the purified fraction was the full-Mrp dimer complex (Fig. 1C). Approximately 0.1 mg of purified Mrp protein was obtained from 60 mg of membrane protein fraction. Fluorescence assays of Naⴙ/Hⴙ antiporter activity in proteoliposomes. In preliminary experiments, we attempted to energize Mrp proteoliposomes by using an imposed artificial gradient, i.e., a ⌬pH gradient established upon dilution of ammonium chloride-loaded proteoliposomes or a ⌬⌿ gradient established by valinomycin-mediated efflux of potassium ions from preloaded proteoliposomes, as has been used to assay other reconstituted cation/ proton antiporters (38–42). The failure of these energization strategies to work with the Mrp proteoliposomes suggested that the transient formation of a transmembrane gradient was not efficacious enough to energize proteoliposomes with the large reconstituted Mrp complex, which might cause some proton leakage across the membrane. We therefore reconstituted the FoF1ATPase together with the Mrp antiporter in order to generate a more sustained PMF that could better compensate for such leakage. The FoF1-ATPase of Bacillus PS3 was purified from the E. coli transformants. As noted in Materials and Methods, the orientation of the PMF generated by the FoF1-ATPase, i.e., acidic inside relative to outside, is reversed relative to the orientation of a proton-pumping ATPase in whole cells but is the same orientation used for comparable assays of antiporter activity in membrane vesicles. In the proteoliposomes with FoF1-ATPase and no added Mrp antiporter, ATP-dependent proton pumping was observed to produce a substantial ⌬pH, as shown by quenching of the fluorescence of the ACMA ⌬pH probe in proteoliposomes (Fig. 2A).

jb.asm.org 31

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

180,000 ⫻ g for 15 min. Finally, the proteoliposomes were resuspended in 0.3 ml of fresh assay buffer. Naⴙ/Hⴙ antiporter activity assay using a fluorescent ⌬pH probe. A fluorescent ⌬pH probe, 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen), was used for the assay of cation/H⫹ antiporter activity. Proteoliposomes (40 ␮l) or membrane vesicles (66 ␮g) were diluted in 2 ml of assay buffer supplemented with 1 ␮M ACMA and incubated for 30 min to equilibrate. The assay was initiated by adding ATP-K2 to a final concentration of 0.1 mM. This resulted in quenching of ACMA fluorescence, reflecting the ATP-dependent establishment of a transmembrane pH gradient (⌬pH), with the inside being acidic relative to the outside. The orientation of this ⌬pH is the opposite of the physiological orientation, in which the FoF1-ATP synthase would pump protons outward in hydrolytic ATPase mode. The opposite orientation established in the proteoliposomes is that commonly used for antiporter assays of both proteoliposomes and everted membrane vesicles (5). NaCl or KCl (to check for any unexpected K⫹/H⫹ antiporter activity) was then added to the assay mixture, and any dequenching of fluorescence, representing antiporter activity, was assessed. Finally, 1 mM NH4Cl was added to the assay buffer to abolish any ⌬pH and establish a baseline. The use of NH4Cl is a classic method of establishing the baseline (36) without using K⫹ or Na⫹ fluxes. It takes advantage of the permeability of the membrane to uncharged NH3, which is protonated upon its entry into proteoliposomes or vesicles. The resulting charged NH4⫹ is trapped in the proteoliposomes, as its formation abolishes the ⌬pH, which had been acidic inside relative to outside. A baseline is thus established. Using that baseline, the cation/ proton antiporter activity is expressed as % dequenching of fluorescence, i.e., a decrease in the ATPase-dependent ⌬pH, due to Na⫹ or K⫹ addition. Measurements of fluorescence were made using a Shimazu RF-5301 PC spectrofluorophotometer. Sidedness assay of C terminus of MrpG by cysteine labeling. The membrane-impermeative, thiol-specific reagent 3-(N-maleimido-propionyl) biocytin (MPB; Invitrogen) was used to label the cysteine residue of the MrpG protein. Membrane vesicles (10 mg/ml) were treated with 2 mM MPB in PA3 buffer at room temperature for 30 min in the presence or absence of 1.0% DM. To prepare samples with complete reaction between MPB and cysteine residues, the DM-solubilized membrane vesicles were sonicated briefly before adding 20 mM 2-mercaptoethanol to stop the labeling reaction. The vesicles incubated without DM were also solubilized by 1.0% DM, but after the addition of 2-mercaptoethanol. After ultracentrifugation at 180,000 ⫻ g for 15 min, the supernatant was diluted 10-fold in PA3-8 buffer and incubated with preequilibrated Ni-NTA resin for 60 min. The Ni-NTA resin was washed with 10 column volumes of W2 buffer and eluted with 3 column volumes of E2 buffer. The eluted proteins were applied to gels for Tricine SDS-PAGE (10% acrylamide) (37) and detected by Western blotting using either horseradish peroxidase (HRP)conjugated anti-His-tag polyclonal antibodies (Abcam) or streptavidinperoxidase polymer (Sigma-Aldrich). For MPB labeling of proteoliposomes containing MrpG subunits with an introduced cysteine in the C-terminal segment, the proteoliposomes (300 ␮l) were mixed with 0.1 mM MPB and dispensed as two aliquots (150 ␮l each). The aliquots were incubated at room temperature for 30 min after one of the two aliquots was solubilized by 1.0% DM and sonicated briefly. To stop the labeling reaction, 2-mercaptoethanol was added to a final concentration of 20 mM, followed by 30 min of incubation. The proteoliposomes from the aliquot that had been incubated without DM treatment were then solubilized by 1.0% DM. Finally, both sets of proteoliposomes were completely denatured by 4 M guanidine thiocyanate. The labeled proteoliposomes were diluted 10 to 1,000 times with TTBS buffer (20 mM Tris base, 0.5 M NaCl, and 0.1% Tween 20, pH 7.3). The diluted samples, supplemented with bovine serum albumin to 0.2%, were incubated in a Ni-NTA-coated plate (Qiagen) at room temperature for 60 min. Streptavidin-peroxidase polymer was added to all the wells where it could bind to MPB-labeled MrpG. After addition of o-phenylenediamine (OPD) (Thermo Scientific), which is a substrate for HRP, the optical

Morino et al.

Tricine SDS-PAGE (16% acrylamide) followed by silver staining. Lanes: M, protein standard marker; Mf, membrane fraction (3 ␮g); Ex, DM-extracted fraction (3 ␮g); Ft, flowthrough fraction (3 ␮g); Wa, washed fraction (3 ␮g); El, eluted fraction (0.3 ␮g); Pu, final purified fraction concentrated by ultrafiltration (0.3 ␮g). (B) Mrp subunits were detected by Western blotting. Lanes 1, purified Mrp fraction; lanes 2 and 3, membrane vesicles of E. coli KNabc with pGEM7zf(⫹) (lanes 2) or with pGEMmrp TFCHAH (lanes 3) were subjected to Tricine SDS-PAGE, and the subunits were detected using the specific antibodies described in Materials and Methods. The asterisk indicates the protein band that corresponds to the correct position for MrpE. (C) Purified Mrp was subjected to BN-PAGE (precast 4 to 16% native PAGE bis-Tris gels) fractionation, followed by Coomassie brilliant blue staining; the positions for monomeric and dimeric Mrp complexes are indicated. Lanes: M, protein standard marker; Pu, final purified fraction concentrated by ultrafiltration (3 ␮g).

No significant change was observed upon addition of NaCl to these proteoliposomes, indicating that no detectable Na⫹/H⫹ antiporters, e.g., from the E. coli strain in which the ATPase had been expressed, were present as contaminants in the proteoliposomes.

A.

B.

ATP

ATP 0.025 mg 0 mg

100

450

80

400

60

350

40

300

20

% dequenching

0.2 mg

500

Fluorescent intensity (a.u.)

All the proteoliposomes were reconstituted with 0.1 mg FoF1ATPase and 13.2 mg lipid. The negative control had no antiporter coreconstituted, and the other two samples had either 0.025 mg or 0.2 mg of purified Mrp antiporter coreconstituted with the

0

250 0

10

20

30

0

40

Time (min)

5

Time (min)

C.

D. 0.5

80 60 40

% dequenching

100

1/ % dequenching

ATP

0.4 0.3 0.2 0.1

20 0 0

5

Time (min)

-10

0

10 20 1/Na+ (mM-1)

30

40

FIG 2 Fluorescence assays of the ATP-dependent proton-pumping and cation/H⫹ antiporter activities in FoF1-ATPase-containing proteoliposomes. Each experiment was initiated by addition of ATP-K2 (0.1 mM). The first downward-facing arrow indicates the time of addition of ATP, and the later downward-facing arrows indicate the time of addition of 10 mM NaCl (A and B) or KCl (C). (A) ATP-dependent proton pumping in proteoliposomes. Purified Mrp proteins (0.025 mg or 0.2 mg) were reconstituted into proteoliposomes containing FoF1-ATPase. These coreconstituted proteoliposomes and proteoliposomes without Mrp proteins (0 mg), which were reconstituted with FoF1-ATPase alone, were also assessed with respect to both the initial ATP-dependent quenching and subsequent dequenching upon addition of NaCl. a.u., arbitrary units. (B) Enlargement of the trace of the assay for panel A in which 0.2 mg of purified antiporter was added. (C) A control assay of K⫹/H⫹ antiporter activity was performed with coreconstituted proteoliposomes. (D) Double-reciprocal plot to estimate kinetic parameters for Na⫹ in proteoliposomes (closed squares) and membrane vesicles (open circles). Each value shows the average for three independent experiments: for the vesicles, independent preparations from different transformations were used; and for the proteoliposomes, freshly and independently prepared proteoliposomes were used. Error bars indicate standard deviations (SD).

32

jb.asm.org

Journal of Bacteriology

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

FIG 1 Tricine SDS-PAGE and BN-PAGE analyses of Mrp antiporter purified using Talon resin. (A) Fractions from each purification step were analyzed by

Functional Reconstitution of an Mrp-Type Antiporter

January 2014 Volume 196 Number 1

A.

ISO DM

+

RSO

-

+

-

St-HRP Anti His-HRP

Reactive MPB amount (Normalized A450 )

B.

1

0.5 + detergent - detergent 0 0

0.01 0.02 0.03 0.04 0.05 Proteoliposome concentration (a.u.)

FIG 3 Sidedness of the Mrp antiporter reconstituted in proteoliposomes. (A) Topology determination for the C-terminal region of the MrpG subunit by using MPB in inside-out (ISO) and right-side-out (RSO) membrane vesicles. The MrpG subunit was detected using an anti-His-tag polyclonal antibody (Anti His-HRP). MPB-labeled MrpG protein was detected by using streptavidin-peroxidase polymer (St-HRP). (B) Sidedness assay of Mrp antiporter in proteoliposomes. Proteoliposomes were labeled by MPB in the presence (closed circles) or absence (open circles) of 1.0% DM. MPB binding to the MrpG protein was quantified colorimetrically using streptavidin-peroxidase polymer, with o-phenylenediamine as the substrate. The normalized values of A450 were plotted against the amount of proteoliposomes (arbitrary units). The calculated hint and hsol values are 0.018 and 0.010, respectively. Each value shows the average for three independent experiments. Error bars indicate SD.

portion of Mrp proteins with an inside-out orientation could be represented as the ratio of the labeled MrpG concentration in the intact proteoliposomes (Cint) to the concentration in the solubilized proteoliposomes (Csol). As previously reported for a determination of sidedness of the E. coli NhaA antiporter (44), the percentage of Mrp that was in the inside-out orientation was calculated from two apparent half-saturating constants, for the intact proteoliposomes and solubilized proteoliposomes, i.e., hint and hsol, respectively: Cint/Csol ⫽ hsol/hint. The calculated percentage of Mrp with an inside-out orientation was 55% (⫾7%) in the proteoliposomes (hsol/hint ⫽ 0.010/0.018 ⫽ 0.55). These data suggest that the Mrp antiporter was incorporated into liposomes with a random orientation (Fig. 3B). This could account for much of the discrepancy between the Vmax of antiporter activity in proteoliposomes versus vesicles, while lipids that were optimal for the FoF1ATPase but perhaps not for the antiporter may have contributed to the difference in Km. In conclusion, the results reported here contribute a purification procedure that results primarily in a dimeric Mrp that functions as a secondary sodium/proton antiporter in proteoliposomes in which a PMF is established by a coreconstituted FoF1-ATPase. The sodium specificity of the B. pseudofirmus OF4 Mrp antiporter is retained by the purified antiporter. With further refinements, purified Mrp-type antiporter preparations should provide access to more detailed information about the antiporter’s mechanism and structure, as well as the value it brings to the host. ACKNOWLEDGMENTS This work was supported by research grant GM28454 and a subcontract on grant GM093825 (T.A.K.) from the National Institute of General Med-

jb.asm.org 33

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

ATPase. Significant quenching was observed in ATPase-containing proteoliposomes in which either 0.025 or 0.2 mg of purified Mrp antiporter was also coreconstituted. There was also a significant reduction in the level of quenching, i.e., in the steady-state ⌬pH, which was consistent with increased leakiness paralleling incorporation of larger amounts of Mrp antiporter (Fig. 2A). Evidence from other reconstitution efforts have similarly shown that the protein density during reconstitution affected the capacity to maintain the transmembrane H⫹ gradient in proteoliposomes (43). Since the ATPase-dependent proton pumping was expected to generate a membrane potential, ⌬⌿, that might also limit the steady-state ACMA quenching that reflects the ⌬pH, the proteoliposomes were assayed after treatment with valinomycin (to 0.5 ␮M) in the K⫹-containing buffer to abolish any constraining ⌬⌿. This treatment indeed increased the magnitude of the initial quench but also decreased the antiporter activity by 40% relative to that with untreated proteoliposomes (see Fig. S2 in the supplemental material). The reduced antiporter activity reflects the contribution of ⌬⌿ to the activity of electrogenic antiporters (5). When NaCl was added to proteoliposomes in which a ⌬pH gradient had been established, partial dequenching of the fluorescence was observed (Fig. 2A and B). Such dequenching was not observed for addition of KCl, which is not a substrate for the B. pseudofirmus OF4 Mrp antiporter (Fig. 2C). This confirms that the dequenching caused by added NaCl was not mediated by an elevation of ionic strength. The Na⫹/H⫹ antiporter activity in the proteoliposomes was assessed from the magnitude of the Na⫹dependent dequenching in the ACMA fluorescence assays, which showed that the apparent Km value for Na⫹ was 0.40 mM, and the Vmax was 16.0% dequenching (Fig. 2D). The values obtained in parallel assays of everted membrane vesicles of E. coli KNabc expressing the Mrp antiporter and energized by addition of ATP were 0.24 mM for the Km value for Na⫹ and 40.9% dequenching for the Vmax. The differences between the parameters observed in the proteoliposomes and vesicles could in part reflect the apparent proton leak in the proteoliposomes (Fig. 2A) and might also reflect some loss of activity during purification and/or effects of a different lipid milieu from that in the native host for the antiporter. Another important variable for the proteoliposomes is the extent to which Mrp complexes were incorporated into the proteoliposomes in the inside-out direction that corresponds to the orientation of the FoF1-ATPase. Therefore, we next determined the sidedness of Mrp complexes in the proteoliposomes. Sidedness of Mrp antiporters incorporated into proteoliposomes. In the proteoliposomes energized by FoF1-ATPase, only an Mrp antiporter with an inside-out orientation would contribute to the antiporter activity measured. The sidedness of the Mrp antiporter incorporated into the proteoliposomes was assessed using a hydrophilic biotinylated maleimide, MPB. A single cysteine replacement was introduced at the MrpG Y111 residue, which is in the C-terminal hydrophilic region and is not a conserved residue. The cysteine residue that was introduced was labeled by MPB in inside-out membrane vesicles and was much less significantly labeled in right-side-out membrane vesicles (Fig. 3A), indicating that the labeled hydrophilic region is situated in the cytoplasm in vivo. The experiment using membrane vesicles indicated that the cysteine introduced into the MrpG C-terminal segment would be accessible from outside the proteoliposomes if the transporter was correctly oriented in the everted proteoliposome system. The pro-

Morino et al.

ical Sciences, a grant from the Japan Society for the Promotion of Science Research Fellowships for Young Scientists (M.M.), a special research grant (2010) from Toyo University, a Grant-in-Aid for Scientific Research on Innovative Areas (grant 24117005) of the Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT) (M.I.), and the Japan Society for the Promotion of Science (JSPS) KAKENHI (grant 24570149) (T.S.).

REFERENCES

34

jb.asm.org

19.

20.

21.

22.

23.

24. 25.

26. 27. 28.

29.

30.

31.

32.

33.

34. 35.

Journal of Bacteriology

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

1. Padan E, Venturi M, Gerchman Y, Dover N. 2001. Na⫹/H⫹ antiporters. Biochim. Biophys. Acta 1505:144 –157. http://dx.doi.org/10.1016/S0005 -2728(00)00284-X. 2. Brett CL, Donowitz M, Rao R. 2005. Evolutionary origins of eukaryotic sodium/proton exchangers. Am. J. Physiol. Cell Physiol. 288:C223–C239. http://dx.doi.org/10.1152/ajpcell.00360.2004. 3. Orlowski J, Grinstein S. 2007. Emerging roles of alkali cation/proton exchangers in organellar homeostasis. Curr. Opin. Cell Biol. 19:483– 492. http://dx.doi.org/10.1016/j.ceb.2007.06.001. 4. Slonczewski JL, Fujisawa M, Dopson M, Krulwich TA. 2009. Cytoplasmic pH measurement and homeostasis in bacteria and archaea. Adv. Microb. Physiol. 55:1–79, 317. http://dx.doi.org/10.1016/S0065-2911(09)05501-5. 5. Padan E, Bibi E, Ito M, Krulwich TA. 2005. Alkaline pH homeostasis in bacteria: new insights. Biochim. Biophys. Acta 1717:67– 88. http://dx.doi .org/10.1016/j.bbamem.2005.09.010. 6. Krulwich TA, Sachs G, Padan E. 2011. Molecular aspects of bacterial pH sensing and homeostasis. Nat. Rev. Microbiol. 9:330 –343. http://dx.doi .org/10.1038/nrmicro2549. 7. Ren Q, Chen K, Paulsen IT. 2007. TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels. Nucleic Acids Res. 35:D274 –D279. http://dx.doi.org /10.1093/nar/gkl925. 8. Saier MH, Jr, Yen MR, Noto K, Tamang DG, Elkan C. 2009. The Transporter Classification Database: recent advances. Nucleic Acids Res. 37:D274 –D278. http://dx.doi.org/10.1093/nar/gkn862. 9. Rimon A, Tzubery T, Padan E. 2007. Monomers of the NhaA Na⫹/H⫹ antiporter of Escherichia coli are fully functional yet dimers are beneficial under extreme stress conditions at alkaline pH in the presence of Na⫹ or Li⫹. J. Biol. Chem. 282:26810 –26821. http://dx.doi .org/10.1074/jbc.M704469200. 10. Hamamoto T, Hashimoto M, Hino M, Kitada M, Seto Y, Kudo T, Horikoshi K. 1994. Characterization of a gene responsible for the Na⫹/H⫹ antiporter system of alkalophilic Bacillus species strain C-125. Mol. Microbiol. 14:939 –946. http://dx.doi.org/10.1111/j.1365-2958.1994 .tb01329.x. 11. Swartz TH, Ikewada S, Ishikawa O, Ito M, Krulwich TA. 2005. The Mrp system: a giant among monovalent cation/proton antiporters? Extremophiles 9:345–354. http://dx.doi.org/10.1007/s00792-005-0451-6. 12. Hiramatsu T, Kodama K, Kuroda T, Mizushima T, Tsuchiya T. 1998. A putative multisubunit Na⫹/H⫹ antiporter from Staphylococcus aureus. J. Bacteriol. 180:6642– 6648. 13. Ito M, Guffanti AA, Wang W, Krulwich TA. 2000. Effects of nonpolar mutations in each of the seven Bacillus subtilis mrp genes suggest complex interactions among the gene products in support of Na⫹ and alkali but not cholate resistance. J. Bacteriol. 182:5663–5670. http://dx.doi.org/10.1128 /JB.182.20.5663-5670.2000. 14. Yoshinaka T, Takasu H, Tomizawa R, Kosono S, Kudo T. 2003. A shaE deletion mutant showed lower Na⫹ sensitivity compound to other deletion mutants in the Bacillus subtilis sodium/hydrogen antiporter (Sha) system. J. Biosci. Bioeng. 95:306 –309. http://dx.doi.org/10.1016/S1389 -1723(03)80035-X. 15. Morino M, Natsui S, Swartz TH, Krulwich TA, Ito M. 2008. Single gene deletions of mrpA to mrpG and mrpE point mutations affect activity of the Mrp Na⫹/H⫹ antiporter of alkaliphilic Bacillus and formation of heterooligomeric Mrp complexes. J. Bacteriol. 190:4162– 4172. http://dx.doi.org /10.1128/JB.00294-08. 16. Morino M, Natsui S, Ono T, Swartz TH, Krulwich TA, Ito M. 2010. Single site mutations in the hetero-oligomeric Mrp antiporter from alkaliphilic Bacillus pseudofirmus OF4 that affect Na⫹/H⫹ antiport activity, sodium exclusion, individual Mrp protein levels, or Mrp complex formation. J. Biol. Chem. 285:30942–30950. http://dx.doi.org/10.1074/jbc .M110.118661. 17. Fukaya F, Promden W, Hibino T, Tanaka Y, Nakamura T, Takabe T. 2009.

18.

An Mrp-like cluster in the halotolerant cyanobacterium Aphanothece halophytica functions as a Na⫹/H⫹ antiporter. Appl. Environ. Microbiol. 75: 6626 – 6629. http://dx.doi.org/10.1128/AEM.01387-09. Putnoky P, Kereszt A, Nakamura T, Endre G, Grosskopf E, Kiss P, Kondorosi A. 1998. The pha gene cluster of Rhizobium meliloti involved in pH adaptation and symbiosis encodes a novel type of K⫹ efflux system. Mol. Microbiol. 28:1091–1101. http://dx.doi.org/10 .1046/j.1365-2958.1998.00868.x. Kosono S, Haga K, Tomizawa R, Kajiyama Y, Hatano K, Takeda S, Wakai Y, Hino M, Kudo T. 2005. Characterization of a multigeneencoded sodium/hydrogen antiporter (sha) from Pseudomonas aeruginosa: its involvement in pathogenesis. J. Bacteriol. 187:5242–5248. http: //dx.doi.org/10.1128/JB.187.15.5242-5248.2005. Jasso-Chavez R, Apolinario EE, Sowers KR, Ferry JG. 2013. MrpA functions in energy conversion during acetate-dependent growth of Methanosarcina acetivorans. J. Bacteriol. 195:3987–3994. http://dx.doi.org /10.1128/JB.00581-13. Dzioba-Winogrodzki J, Winogrodzki O, Krulwich TA, Boin MA, Hase CC, Dibrov P. 2009. The Vibrio cholerae Mrp system: cation/proton antiport properties and enhancement of bile salt resistance in a heterologous host. J. Mol. Microbiol. Biotechnol. 16:176 –186. http://dx.doi.org/10 .1159/000119547. Fey PD, Endres JL, Yajjala VK, Widhelm TJ, Boissy RJ, Bose JL, Bayles KW. 2013. A genetic resource for rapid and comprehensive phenotype screening of nonessential Staphylococcus aureus genes. mBio 4:e00537–12. http://dx.doi.org/10.1128/mBio.00537-12. Mathiesen C, Hägerhall C. 2003. The ‘antiporter module’ of respiratory chain complex I includes the MrpC/NuoK subunit—a revision of the modular evolution scheme. FEBS Lett. 549:7–13. http://dx.doi.org/10 .1016/S0014-5793(03)00767-1. Baradaran R, Berrisford JM, Minhas GS, Sazanov LA. 2013. Crystal structure of the entire respiratory complex I. Nature 494:443– 448. http: //dx.doi.org/10.1038/nature11871. Nakamaru-Ogiso E, Kao MC, Chen H, Sinha SC, Yagi T, Ohnishi T. 2010. The membrane subunit NuoL(ND5) is involved in the indirect proton pumping mechanism of Escherichia coli complex I. J. Biol. Chem. 285:39070 –39078. http://dx.doi.org/10.1074/jbc.M110.157826. Hunte C, Zickermann V, Brandt U. 2010. Functional modules and structural basis of conformational coupling in mitochondrial complex I. Science 329:448 – 451. http://dx.doi.org/10.1126/science.1191046. Friedrich T, Weiss H. 1997. Modular evolution of the respiratory NADH: ubiquinone oxidoreductase and the origin of its modules. J. Theor. Biol. 187:529 –540. http://dx.doi.org/10.1006/jtbi.1996.0387. Mathiesen C, Hägerhall C. 2002. Transmembrane topology of the NuoL, M and N subunits of NADH:quinone oxidoreductase and their homologues among membrane-bound hydrogenases and bona fide antiporters. Biochim. Biophys. Acta 1556:121–132. http://dx.doi.org/10.1016/S0005 -2728(02)00343-2. Bayer AS, McNamara P, Yeaman MR, Lucindo N, Jones T, Cheung AL, Sahl HG, Proctor RA. 2006. Transposon disruption of the complex I NADH oxidoreductase gene (snoD) in Staphylococcus aureus is associated with reduced susceptibility to the microbicidal activity of thrombininduced platelet microbicidal protein 1. J. Bacteriol. 188:211–222. http: //dx.doi.org/10.1128/JB.188.1.211-222.2006. Swartz TH, Ito M, Ohira T, Natsui S, Hicks DB, Krulwich TA. 2007. Catalytic properties of Staphylococcus aureus and Bacillus members of the secondary cation/proton antiporter-3 (Mrp) family are revealed by an optimized assay in an Escherichia coli host. J. Bacteriol. 189:3081–3090. http://dx.doi.org/10.1128/JB.00021-07. Moparthi VK, Hägerhall C. 2011. The evolution of respiratory chain complex I from a smaller last common ancestor consisting of 11 protein subunits. J. Mol. Evol. 72:484 – 497. http://dx.doi.org/10.1007/s00239-011 -9447-2. Suzuki T, Ueno H, Mitome N, Suzuki J, Yoshida M. 2002. Fo of ATP synthase is a rotary proton channel. Obligatory coupling of proton translocation with rotation of c-subunit ring. J. Biol. Chem. 277:13281–13285. http://dx.doi.org/10.1074/jbc.M111210200. Goldberg EB, Arbel T, Chen J, Karpel R, Mackie GA, Schuldiner S, Padan E. 1987. Characterization of a Na⫹/H⫹ antiporter gene of Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 84:2615–2619. http://dx.doi.org /10.1073/pnas.84.9.2615. Kaback HR. 1971. Bacterial membranes. Methods Enzymol. 23:99 –120. Soga N, Kinosita K, Jr, Yoshida M, Suzuki T. 2011. Efficient ATP

Functional Reconstitution of an Mrp-Type Antiporter

36.

37. 38.

40.

January 2014 Volume 196 Number 1

41.

42. 43. 44.

Na⫹/H⫹ exchanger AtNHX1 catalyzes low affinity Na⫹ and K⫹ transport in reconstituted liposomes. J. Biol. Chem. 277:2413–2418. http://dx.doi .org/10.1074/jbc.M105043200. Matsushita K, Patel L, Gennis RB, Kaback HR. 1983. Reconstitution of active transport in proteoliposomes containing cytochrome o oxidase and lac carrier protein purified from Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 80:4889 – 4893. http://dx.doi.org/10.1073/pnas.80 .16.4889. Seto-Young D, Garcia ML, Krulwich TA. 1985. Reconstitution of a bacterial Na⫹/H⫹ antiporter. J. Biol. Chem. 260:11393–11395. Tsai MF, Miller C. 2013. Substrate selectivity in arginine-dependent acid resistance in enteric bacteria. Proc. Natl. Acad. Sci. U. S. A. 110:5893– 5897. http://dx.doi.org/10.1073/pnas.1301442110. Zuber D, Krause R, Venturi M, Padan E, Bamberg E, Fendler K. 2005. Kinetics of charge translocation in the passive downhill uptake mode of the Na⫹/H⫹ antiporter NhaA of Escherichia coli. Biochim. Biophys. Acta 1709: 240 –250. http://dx.doi.org/10.1016/j.bbabio.2005.07.009.

jb.asm.org 35

Downloaded from http://jb.asm.org/ on September 30, 2014 by Univ of Northern Colorado

39.

synthesis by thermophilic Bacillus FoF1-ATP synthase. FEBS J. 278:2647– 2654. http://dx.doi.org/10.1111/j.1742-4658.2011.08191.x. Perlin DS, Latchney LR, Wise JG, Senior AE. 1984. Specificity of the proton adenosinetriphosphatase of Escherichia coli for adenine, guanine, and inosine nucleotides in catalysis and binding. Biochemistry 23:4998 – 5003. http://dx.doi.org/10.1021/bi00316a026. Schägger H. 2006. Tricine-SDS-PAGE. Nat. Protoc. 1:16 –22. http://dx .doi.org/10.1038/nprot.2006.4. Nakamura T, Hsu C, Rosen BP. 1986. Cation/proton antiport systems in Escherichia coli. Solubilization and reconstitution of delta pHdriven sodium/proton and calcium/proton antiporters. J. Biol. Chem. 261:678 – 683. Goldberg M. 1999. Energetics and topology of CzcA, a cation/proton antiporter of the resistance-nodulation-cell division protein family. J. Biol. Chem. 274:26065–26070. http://dx.doi.org/10.1074/jbc.274.37 .26065. Venema K, Quintero FJ, Pardo JM, Donaire JP. 2002. The Arabidopsis