Fish Physiol Biochem (2014) 40:1917–1926 DOI 10.1007/s10695-014-9979-7
GRP94 is encoded by two differentially expressed genes during development of rainbow trout (Oncorhynchus mykiss) Alexander Rebl • Andreas Brietzke • Tom Goldammer • Hans-Martin Seyfert
Received: 8 January 2014 / Accepted: 19 August 2014 / Published online: 3 September 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract The glucose-regulated protein, 94 kDa (GRP94), is an endoplasmic reticulum (ER)-localized heat shock protein that plays among other functions a crucial role in folding and exports of Toll-like receptors (TLRs) and some other immune-relevant factors. We identified two copies of the GRP94encoding gene in rainbow trout sharing 91 % DNA sequence identity. The conceptually translated ORFs encode a 795-aa GRP94a and a 510-aa GRP94b protein variant, respectively, with characteristic domains and amino acid residues. However, the shorter variant lacks motifs required for its localization in the ER and might thus represent an isoform of the putative mammalian ortholog GRP94a. Heat stress only slightly affects the expression of the two GRP94encoding trout genes, as reported for mammals. We recorded the abundances of transcripts coding for both GRP94 variants as well as for a broad panel of TLRs representing their potential targets. In embryonic and
Electronic supplementary material The online version of this article (doi:10.1007/s10695-014-9979-7) contains supplementary material, which is available to authorized users. A. Rebl A. Brietzke T. Goldammer (&) H.-M. Seyfert Leibniz Institute for Farm Animal Biology (FBN), Institute of Genome Biology, Wilhelm-Stahl-Allee 2, 18196 Dummerstorf, Germany e-mail: [email protected]
larval trout, only the mRNAs encoding TLR1, -2, -9, and -20 were found in significant concentrations, while the expression of nine other TLRs was hardly detectable. The GRP94a-encoding gene showed constantly high expression levels indicating that this isoform is vitally required throughout the life cycle of rainbow trout. The concentration of the GRP94bencoding mRNA was only *0.1 % compared to the GRP94a mRNA level. These structural and gene expression data together suggest that the two GRP94 gene products fulfill different physiological roles. Keywords Glucose-regulated protein Heat shock protein Rainbow trout Salmonid development Toll-like receptor Abbreviations Aa BLAST DAMP dpf ER GRP94 HATPase HSP HSP90B1 PAMP TLR
Amino acid Basic local alignment search tool Damage-associated molecular patterns Days post-fertilization Endoplasmic reticulum Glucose-regulated protein 94 Histidine kinase-like adenine nucleotide binding Heat shock proteins Heat shock protein 90 kDa beta, member 1 Pathogen-associated molecular patterns Toll-like receptors
123
1918
Introduction Heat shock proteins (HSPs) belong to the most conserved proteins in evolution (Robert and Cohen 1998). It has been well documented for fish and shellfish that HSPs not only fold newly synthesized polypeptide chains and repair denatured proteins but also inhibit apoptosis and initiate inflammatory mechanisms (Roberts et al. 2010). GRP94 (glucose-regulated protein, 94 kDa; other aliases: gp96, ERp99, Tra1, and endoplasmin) is an endoplasmic reticulum (ER)-resident paralog of the cytosolic HSP90. The GRP94-encoding gene HSP90B1 is assumed to have arisen by gene duplication very early in evolution and is therefore present in all eukaryotes except fungi (Gupta 1995). GRP94 acts either as a homodimer or it associates with other factors such as chaperones, then assembling into a multichaperone complex with GRP78, GRP94, and GRP170 as the most abundant components (Meunier et al. 2002). Misfolded proteins may arise as a consequence of glucose starvation (Shiu et al. 1977) or a variety of reagents disrupting intracellular calcium stores (Drummond et al. 1987) and are known to induce GRP94 expression. In addition, mammalian GRP94 chaperone controls specific pathways critical for cell growth and differentiation (Eletto et al. 2010). GRP94 has also a role in immune regulation, since it is a chaperone for several membrane-bound and endoplasmic Toll-like receptors (TLRs) (Randow and Seed 2001). These receptors are crucial sensors of pathogen-associated and danger-associated molecular patterns (PAMPs and DAMPs) (Tang et al. 2012). The subsequent signaling cascade activates the innate immune system and is conserved from fish to man (Rebl et al. 2010). It has been demonstrated that mammalian GRP94 plays a critical role in folding TLR1, -2, -4, -5, -7, and -9 (Yang et al. 2007), but not TLR3 (Liu et al. 2010). GRP94 chaperones, in addition, also integrins (Liu and Li 2008). Previous expression studies during teleost embryogenesis revealed that relevant TLR mRNA copies are detectable very early after fertilization (Jault et al. 2004; Phelan et al. 2005; van der Sar et al. 2006). This suggests, by inference, that abundant HSP90B1 gene products should be available during these stages to ensure the proper structural folding of newly synthesized TLRs.
123
Fish Physiol Biochem (2014) 40:1917–1926
Our long-term interest is the structural and functional characterization of innate immune cascades in rainbow trout, an aquaculture species of high economic value. The knowledge of structure and expression characteristics of two GRP94 factors from trout represents the basis for detailed studies on these auxiliary factors required for proper functioning of specific pathways.
Materials and methods Trout sampling and RNA extraction Rainbow trout (strain BORN, Germany) were grown from eyed eggs to 2-year-old fish at the Institute for Fisheries LFA-MV (Born and Hohen Wangelin, Germany). In the course of trout development, we sampled ‘eyed eggs’ (*2 weeks before start of hatching) 21 days post-fertilization (dpf) maintained at 8 °C in upwelling incubators; 42-dpf and 49-dpf ‘sac fry’ larvae (1 day and 1 week, respectively, after final hatching) were maintained at 14 °C in standard troughs; 56-dpf fry fish without yolk sac (*1 week after first feeding) were maintained at 14 °C in holding tanks; and adult rainbow trout (11 months, 27.4 ± 1.1 cm; 309.3 ± 38.8 g) were maintained at 16–18 °C in 300-L tanks. Embryos, larvae (n = 4) and tissue samples from adult fish (brain, gills, head kidney, liver, muscle, spleen, trunk kidney; n = 8) were immediately transferred into RNAlaterTM (Qiagen, Hilden, Germany) and stored at -80 °C. An additional experiment was conducted to induce mild cold stress at 8 °C and mild heat stress at 23 °C in healthy 10-month-old BORN trout as previously described (Rebl et al. 2013). In brief, rainbow trout were maintained in experimental 300-L tanks with 15 °C-tempered water 2 weeks before temperature change. The temperature of both tanks was then lowered or raised to 8 °C or to 23 °C (1 °C per day) until trout were adapted to constant water temperatures at 8 or 23 °C for 1 week. Eight tissues from four trout (brain, gills, head kidney, liver, muscle, spleen, and trunk kidney) were selected for individual RNA extraction. RNA extraction was performed utilizing first TRIzolTM (Invitrogen, Karlsruhe, Germany) and subsequently cleaned using the RNeasyÒ Mini Kit (Qiagen,
Fish Physiol Biochem (2014) 40:1917–1926
Hilden, Germany) including in-column RNase-free DNase (Qiagen) treatment for 30 min. RNA quality was checked by denaturing agarose gel electrophoresis. Isolation and analysis of two HSP90B1 cDNA sequences from rainbow trout The human HSP90B1 cDNA sequence (NCBI accession: NM_003299) coding for GRP94 was used as BLAST query to search the NCBI EST database (http://www.ncbi.nlm.nih.gov/). The ESTs BX889311 and CU072387 from rainbow trout were clearly homologous to the query, albeit both shared only 91 % identical nucleotides within a 773-bp overlap indicating the expression of two different, yet related genes. Hence, both ESTs were used to derive HSP90B1a- and HSP90B1b-specific primers (Table 1). RACE experiments were conducted with the Gene Racer SuperScriptTM II RT Module (Invitrogen, Karlsruhe, Germany) producing overlapping fragments in two PCR rounds, essentially as described in Rebl et al. 2011). To ensure the correctness of the coding sequences for GRP94a and GRP94b, we amplified eventually [2-kb ORFs of each gene. We utilized oligonucleotides derived from the flanking UTRs (Table 1) and the OneTaqÒ Hot Start Polymerase (New England Biolabs, Frankfurt am Main, Germany) following the manufacturer’s suggested PCR protocols. The resulting cDNA sequences were submitted to GenBank (HSP90B1a, HG421285 and HSP90B1b, HG421286). Each nucleotide position was sequenced at least four times based on independent PCR events. Protein characterization was conducted using the Expert Protein Analysis System Proteomics server (Wilkins et al. 1999), and the programs SignalP 3.0 (Bendtsen et al. 2004), SMART (Letunic et al. 2009) and ClustalW (Combet et al. 2000). The phylogenetic tree was constructed with Molecular Evolutionary Genetics Analysis package MEGA 5 (Kumar et al. 2004). The dendrogram was created with the Neighbor-Joining method using 1,000 bootstrap replicates. Real-time fluorescence quantitative RT-PCR Specific oligonucleotides were derived to measure the HSP90B1a and HSP90B1b copy numbers in selected tissues. We designed additionally primer pairs
1919
amplifying sequence fragments of 13 TLRs from rainbow trout (Table 1) including four sequences for TLR2, TLR19, TLR22a1, and TLR22a2, having been identified in our lab. A comprehensive comparison of trout TLR expression profiles in different tissues after experimental infection will be published elsewhere. Prior to cDNA synthesis, the concentration of total RNA was accurately determined in repeated measurements using NanoDropÒ ND-1000 spectrophotometer (NanoDropÒ Technologies, Wilmington, DE, USA) and the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Complementary DNA was synthesized using an oligo-d(T) primer [25 pmol/ lL] and Super ScriptTM II kit (Invitrogen, Karlsruhe, Germany). Adjusted pipetting for each sample according to the measured RNA concentrations eventually ensured the use of 75 ng total RNA per reaction. After cDNA purification with High Pure PCR Product Purification Kit (Roche, Basel, Switzerland), quantification reactions were carried out on the LightCyclerÒ 480 Instrument utilizing LightCyclerÒ 480 SYBR Green I Master Kit (Roche, Mannheim, Germany). Thermal cycling included the following steps: initial activation of the Taq DNA Polymerase (95 °C for 10 min), followed by 40 cycles of denaturation (95 °C, 15 s), annealing (60 °C, 10 s), and extension (72 °C, 20 s). The qRT-PCR assays included both positive controls and non-template controls. Melting curve analyses indicated single products. Copy numbers were titrated against serial dilutions of specific, PCR-generated reference fragments as external standards. The correlation coefficient R2 of the respective standard curves was higher than 0.99 in each case (Table 1). PCR efficiencies for the used genes were above 80 %. The parallel recording of transcripts encoding EEF1A1 (eukaryotic translation elongation factor 1 alpha 1) served to generate a normalization factor to correct for possible variations in reverse transcription efficiencies during cDNA synthesis from adult tissue and temperature stress RNA samples (Bowers et al. 2008), as EEF1A1 copy numbers did not vary between those samples. In contrast, for embryonic and larval samples, we and others (Heinecke et al. 2014) could not find a suitable internal reference gene. In the present study, EEF1A1, ACTB, GAPDH, RPS5, RPS20, RPL4, and ubiquitin were tested and found to show inconsistent expression between developmental stages. Expression measurements of embryos and
123
123
HG421285
HG421286
NM_001166101
HE979560
DQ459470
NM_001124208
GQ422119
GQ422121
GQ422120 NM_001129991
HF952170
CA356384*
CX261318*
AJ628348
AJ878915
HSP90B1a
TLR1
TLR2
TLR3
TLR5
TLR7
TLR8a1
TLR8a2 TLR9
TLR19
TLR20
TLR21
TLR22a1
TLR22a2
HG421286
HSP90B1b
HG421285
HSP90B1b
CU072387*
HSP90B1b
HSP90B1a
BX889311*
CU072387*
HSP90B1b
HSP90B1a
BX889311*
HSP90B1a
CU072387*
HSP90B1b
* EST sequence
qRT-PCR
Long template PCR
30 RACE nested PCR
30 RACE PCR
BX889311*
HSP90B1a
HSP90B1b
50 RACE nested PCR
BX889311*
CU072387*
HSP90B1a
50 RACE PCR
Accession number
Gene
Application
TAGAAGTCGTACCAAAAGACATTC
TGGACAATGACGCTCTTTTACC
CTCAAAGGAGGTTTTTGGGAATC
ACCCTCCGTCTGCTGGTGGA
GAGAGGAGGAGGTGAGGTATG
TCTCGAATATGAGCAACCTTGTC TGGTATTGCTTCCAGGTGCTGT
CTGTGTCACTTCCTGGTCATAAA
TGCACAGAGAGTGTGACTATCAA
CAACTTCTTCGTTTGGCTGATAAT
AGTCCTCCACCTGTCGAATCTA
AGTTCTTGGGAGTAGAGGATGC
AAAGACAGAGATGAGGGCTGTG
AGACTGTTGAGGAGCCCATCG
AGACTGTTGAGGAGCCCATCG
CCGCCCTAAGAACCCGACTC
TGTGTGTGCGCTTTTATACGGC
TAATCTACCTGACAGAACCAGTG
TCCTGTTTGTCCCCGCTGCC
ACTCTGATGATCTGCCACTGAAT
CTGTGTGGGACTGGGAGCTG
Sense primer sequence (50 –30 )
Table 1 Gene-specific primers used in this study
GAGAGACCCATCATCCACTGAA
GAGCTGATGGTTGCAATGAGG
CTGTTGAGGCAGGTGCAACTAA
CCACAGACGGTCCCAGAAGG
ATGCCCTTCCCTACCTCAAAGT
AGTCCTTTTGGAACACGAGTTAAA CTCCAGGTGGACCAGCAGCT
TTTTCTGATAGGTCCAGCACAGT
ATGTCAGAGAGGTTCGTTTTCAG
ACCAGAGAAACTCAATGTGCATTA
GATCGCTGTCCCAGAAAGCTC
CAGTAGAAACCCCACAGGCAG
CGGTGCATGGAGGTAGGTTTC
TCTCGTCCAGATAGGCTTGAC
GTCTCGTCCAGATCGGCTTAAT
AACTTTCTCAATAGTCAACGGTCT
CACCCTTCCTCATTTACAGTGC
AGCATGTTCTTCTCTTTGTCCAT
CAGCTCCCAGTCCCACACAG
CTTCACCTCGGTGTCCTCGAT
CACCCTCGGCTGTGAAGTGG
Antisense primer sequence (50 –30 )
161
151
156
174
154
183 155
187
179
160
154
141
161
152
180
2,155
2,486
*770
*1,740
*1,150
*1,900
*240
*1,070
*700
*1,200
Fragment size (bp)
2.0
2.0
2.1
1.9
2.1
2.0 2.0
2.0
2.0
1.9
2.0
1.8
2.0
2.1
1.8
Amplification factor
0.99990
0.99982
0.99989
0.99982
0.99985
0.99977 0.99989
0.99946
0.99895
0.99988
0.99997
0.99937
0.99995
0.99866
0.99868
R2 of calibration curves
1920 Fish Physiol Biochem (2014) 40:1917–1926
Fish Physiol Biochem (2014) 40:1917–1926
1921
Fig. 1 Phylogenetic relationship of GRP94 aa sequences. The NCBI and ENSEMBLE (E) accession numbers of the protein sequences used to generate the Neighbor-Joining tree are listed on the right. Additionally, protein lengths and aa identities shared with trout GRP94a protein are listed for the respective
sequence. Human HSP90 gene was used as outgroup. Bootstrap confidence values represent the percent frequency of appearances of each clade in 1,000 replicas. The scale bar represents a genetic distance of 0.05 aa substitutions per site. Teleost GRP94 proteins are highlighted in light gray
larvae were therefore normalized against total RNA concentration as described in Ref. (Bustin 2000). Expression data were eventually subjected to a oneway ANOVA applying Bonferroni multiple testing correction as provided by GraphPad PrismÒ version 5.01.
second gene variant in trout encodes a putative 59-kDa protein (CDG41618) lacking 116 N-terminal aa and 160 C-terminal aa compared to its paralog. As a consequence, GRP94b is missing a 21-aa long signal peptide as predicted for GRP94a, targeting this factor to the ER (Eletto et al. 2010). Furthermore, GRP94b lacks the C-terminal ER targeting sequence ‘KDEL’ (PROSITE accession: PS00014), which is conserved across all vertebrate GRP94 proteins including GRP94a from rainbow trout. These findings indicate a different spatial distribution of both GRP94 paralogs. The HSP90 family signature ‘YKNKEIFLRE,’ presents in trout GRP94a (position 94–103; PROSITE: PS00298), is also absent in its paralog. On the other hand, the characteristic N-terminal HATPase (histidine kinase-like adenine nucleotide binding) domain (Suppl. Figure 1) has been predicted for both, trout GRP94a (position 97–225) and GRP94b (position 1–109). It comprises the ten critical residues L104/-, N107/-, A111/-, D149/33, G153/37, M154/38, N162/46, G196/-, F199/83, and T245/130 making up the adeninebinding cavity (Soldano et al. 2003), which are
Results and discussion HSP90B1 gene is duplicated in rainbow trout Two homologous HSP90B1-like cDNA sequences from rainbow trout were identified and submitted to GenBank, HSP90B1a (GRP94a; HG421285), and HSP90B1b (GRP94b; HG421286). Trout HSP90B1a seems to be a true ortholog of HSP90B1 having been described in many eukaryotes (Gupta 1995). The ORF of trout HSP90B1a gene translates into 795 amino acids (aa) with a hypothetical molecular weight of 91 kDa (CDG41617). This corresponds to vertebrate GRP94 protein sequences comprising about 800 aa residues (Fig. 1, second column). Strikingly, HSP90B1b, the
123
1922
completely conserved in GRP94a and partially in GRP94b, respectively. The prototypical HATPase domain contains in addition two conserved motifs, G151V152G153 and G196V197G198. These are only conserved in GRP94a and may define the top and bottom of the ATP-binding site (Obermann et al. 1998). ATP binding allows N-terminal dimerization and the subsequent binding of client proteins. Hence, this GRP94b apparently lacks this property. The chaperoning function depends significantly on the ATPase activity (Ostrovsky et al. 2009). Crucial for ATP hydrolysis is a conformational change mediated through a highly charged domain (Biswas et al. 2007) present in GRP94a (position 293–319) and GRP94b (position 177–197) with 48 and 43 % glutamic acid residues, respectively. A second charged domain according to Chen et al. (2005) is only present within trout GRP94a protein (position 667–680 containing 3 tyrosine residues). These structural data show that the rainbow trout genome encodes a GRP94 protein (GRP94a) that is very similar to its ortholog in other eukaryotes. Presumably, due to a salmonid-specific genome duplication (Allendorf and Thorgaard 1984), a second gene expresses a truncated GRP94 variant, GRP94b, which lacks a signal peptide, typical signature motifs, and essential residues for ATP binding. At first glance, it appears that HSP90B1b gene is still transcribed though predetermined for decay, a fate that share about 50 % of duplicated genes in salmonid fishes (Bailey et al. 1978). However, we cannot rule out the possibility that both genes either fulfill specialized tasks in different cellular compartments (ER, cytoplasm) or chaperone different spectra of clients according to the neofunctionalization/subfunctionalization theory by Force et al. (1999). Indeed, Marzec et al. (2012) hypothesized that a distinct cytosolic subpopulation of GRP94 equipped with a new function might exist in higher vertebrates. GRP94a from rainbow trout shares high homology with its orthologs In general, GRP94 is well conserved among vertebrates emphasizing its essential biological role. This structural similarity is reflected by an aa sequence comparison in Fig. 1 revealing that the GRP94a protein from trout shares 80 % identity with its human counterpart and even 47 % with its homologue in maize. However, trout GRP94a protein shares highest
123
Fish Physiol Biochem (2014) 40:1917–1926
overall identity ([85 %) with its piscine orthologs. The alignment of six GRP94 protein sequences from bony fish (Suppl. Figure 1) stresses this high degree of conservation, although fish-specific features were uncovered, especially in two glutamic acid-rich regions. The N-terminally situated charged domain for example comprises only seven residues in Spotted green pufferfish, but 29 residues in Japanese flounder. A similar variation is obvious in the C-terminus proximal to the ER retention signal. These two regions show also sequence variation when the alignment is expanded to include higher vertebrates. Phylogenetic analysis of all piscine full-length GRP94 aa sequences reported in databases, and their homologue proteins from representatives of different animal classes and a plant species produced a Neighbor-Joining tree (Fig. 1) assigning GRP94 proteins from bony fish to a specific cluster with 99 % bootstrap support, as opposed to their homologues in higher vertebrates. GRP94 proteins from trout form a subcluster with GRP94 proteins from zebrafish and grass carp. As expected, GRP94 from Pacific hagfish E. stoutii, a jawless primitive vertebrate, is separated from its counterparts in teleosts and higher vertebrates with a bootstrap confidence level of 100 %. This phylogenetic analysis reveals in general the close evolutionary relatedness of GRP94 aa sequences among eukaryotes. HSP90B1a expression dominates over its paralog’s expression Quantitative RT-PCR analyses were carried out to investigate the expression profile of both HSP90B1 genes encoding GRP94 isoforms. During the development of rainbow trout (Fig. 2a), we recorded a high abundance of the HSP90B1a mRNA in embryos (3.8 9 107 HSP90B1a copies per lg RNA), while decreasing during the larval development (down to 2.6 9 106 copies/lg RNA). In contrast, HSP90B1b copy number was strikingly lower (with values between 5.4 9 103 and 1.9 9 104/lg RNA) reaching a peak value 42 days after hatching (P \ 0.001) (Fig. 2b). In adult rainbow trout, both HSP90B1 genes showed a similar discrepancy regarding the extent of their expression levels. In essence, the HSP90B1a mRNA concentration was 613- to 1,473-fold above the HSP90B1b mRNA level. Transcripts of both HSP90B1 genes were most abundant in liver, spleen,
Fish Physiol Biochem (2014) 40:1917–1926
1923
Fig. 2 Quantitative RT-PCR analysis of a HSP90B1a, b HSP90B1b, and c TLR transcript levels in trout embryos or larvae (n = 4; dotted bars) and in selected tissues of adult trout (n = 8; filled bars; highlighted in light gray). The bar graphs
display the mean copy numbers per lg RNA (±SEM). Differences in expression with P B 0.05 between the developmental stages (lowercase letters) or between tissues (uppercase letters) are indicated with different letters above the bars
and gills, whereas white muscle contained Cfourfold lower copy numbers (P \ 0.05). Since mammalian GRP94 has been demonstrated to assist TLR folding (Yang et al. 2007), we hypothesized that the abundant expression of the HSP90B1a gene during the development of trout larvae might correlate with an explicit TLR expression. Determining the copy numbers of all currently known trout TLR sequences in the investigated egg and larval samples (Fig. 2c), we found for most of these mRNA species very low levels near the detection limit. Relevant mRNA concentrations were recorded only for TLR1, -2, -9, and -20. These might be sufficient to provide a basic protection against potential pathogens, since they detect a broad range of ligands. The heterodimer
of TLR1 and TLR2 is known to sense bacterial lipopeptides, TLR9 recognizes viral or bacterial DNA (Rebl et al. 2010), and TLR20 likely detects protozoan parasites (Pietretti et al. 2011). The copy numbers of HSP90B1a exceed, however, at least 30 times those encoding TLRs, which is at odds with the hypothesis of a more or less balanced chaperone/client ratio of 1–1. It seems less plausible that TLR-encoding transcripts are less stable than HSP-encoding mRNAs to compensate those discrepant expression levels. It is rather imaginable that trout HSP90B1a product chaperones not only TLRs, but also a number a further clients. Moreover, it might also be indispensable for responses to metabolic stress situations. Organogenesis and differentiation processes require an adequate
123
1924
Fish Physiol Biochem (2014) 40:1917–1926
Fig. 3 The mRNA abundance of HSP90B1a (filled columns) and HSP90B1b (hatched columns) genes in selected tissues of adult trout (n = 4) at 23 °C (black columns) is compared with
the respective copy number at 8 °C (gray columns). EEF1A1 was used as internal reference. Data are expressed as foldchanges ±SEM
energy supply and might be reflected by the induction of typical stress genes such as HSP90B1 along with HSPA5 (coding for GRP78) as reported for mammalian embryos (Kim et al. 1990). On the other hand, in keeping with the theory of subfunctionalization by Force et al. (1999), the low level of HSP90B1b expression conceivably provides a specialized HSP factor exclusively for supporting the folding of TLRs. We examined also the effect of mild temperature stress at 8 or 23 °C on HSP90B1 expression. HSP90B1 expression was found only slightly regulated in some of the investigated tissues (Fig. 3). HSP90B1a copy number decreased 1.5-fold in liver (P = 0.01), while increasing slightly in brain (0.7-fold; P = 0.04). The concentration of HSP90B1b-derived mRNA was 2.4fold decreased in head kidney (P = 0.03). This is in line with previous publications reporting that mammalian HSP90B1 induction is scarcely detectable after high temperatures (Marzec et al. 2012) in contrast to its relatives HSP90AA1 or HSP90AA, which are also induced in trout (Rebl et al. 2013). Our expression data allow initial estimates about the biological significance of both HSP90B1 genes in rainbow trout, though a larger sample number would
yield more reliable results with an increased level of statistical significance. A general conclusion drawn from the expression data is that both HSP90B1a and b genes underlie a regulation under different physiological conditions indicating distinct functional spectra for both HSPs. The abundant presence of HSP90B1a transcripts suggests a crucial importance of GRP94a for cell homeostasis.
123
Acknowledgments We would like to thank the LFA-MV Institute for Fisheries (Born and Hohen Wangelin, Germany) and the fish farm BIMES (Frauenmark, Germany) for breeding and providing the fish sample material. We are grateful to B. Scho¨pel, I. Hennings, and M. Fuchs for dedicated technical assistance. This work benefited equally from funding by the DFG-Grant SE 326/16-1 from the German Research Foundation and by Grant No. AU11040 from the European Social Fund (ESF) and Ministry of Education, Science and Culture of Mecklenburg-Western Pomerania.
References Allendorf F, Thorgaard G (1984) Tetraploidy and the evolution of salmonid fishes. In: Turner B (ed) Evolutionary genetics of fishes. Springer, US, pp 1–53
Fish Physiol Biochem (2014) 40:1917–1926 Bailey GS, Poulter RTM, Stockwell PA (1978) Gene duplication in tetraploid fish: model for gene silencing at unlinked duplicated loci. Proc Natl Acad Sci USA 75:5575–5579 Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795 Biswas C, Ostrovsky O, Makarewich CA, Wanderling S, Gidalevitz T, Argon Y (2007) The peptide-binding activity of GRP94 is regulated by calcium. Biochem J 405:233–241 Bowers RM, Lapatra SE, Dhar AK (2008) Detection and quantitation of infectious pancreatic necrosis virus by realtime reverse transcriptase-polymerase chain reaction using lethal and non-lethal tissue sampling. J Virol Methods 147:226–234 Bustin SA (2000) Absolute quantification of mRNA using realtime reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25:169–193 Chen B, Piel WH, Gui L, Bruford E, Monteiro A (2005) The HSP90 family of genes in the human genome: insights into their divergence and evolution. Genomics 86:627–637 Combet C, Blanchet C, Geourjon C, Deleage G (2000) NPS@: network protein sequence analysis. Trends Biochem Sci 25:147–150 Drummond IA, Lee AS, Resendez E Jr, Steinhardt RA (1987) Depletion of intracellular calcium stores by calcium ionophore A23187 induces the genes for glucose-regulated proteins in hamster fibroblasts. J Biol Chem 262:12801–12805 Eletto D, Dersh D, Argon Y (2010) GRP94 in ER quality control and stress responses. Semin Cell Dev Biol 21:479–485 Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J (1999) Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151:1531–1545 Gupta RS (1995) Phylogenetic analysis of the 90 kD heat shock family of protein sequences and an examination of the relationship among animals, plants, and fungi species. Mol Biol Evol 12:1063–1073 Heinecke RD, Chettri JK, Buchmann K (2014) Adaptive and innate immune molecules in developing rainbow trout, Oncorhynchus mykiss eggs and larvae: expression of genes and occurrence of effector molecules. Fish Shellfish Immunol 38:25–33 Jault C, Pichon L, Chluba J (2004) Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol Immunol 40:759–771 Kim KS, Kim YK, Lee AS (1990) Expression of the glucoseregulated proteins (Grp94 and Grp78) in differentiated and undifferentiated mouse embryonic-cells and the use of the Grp78 promoter as an expression system in embryoniccells. Differentiation 42:153–159 Kumar S, Tamura K, Nei M (2004) MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5:150–163 Letunic I, Doerks T, Bork P (2009) SMART 6: recent updates and new developments. Nucleic Acids Res 37:D229–D232 Liu B, Li Z (2008) Endoplasmic reticulum HSP90b1 (gp96, grp94) optimizes B-cell function via chaperoning integrin and TLR but not immunoglobulin. Blood 112:1223–1230 Liu B, Yang Y, Qiu Z, Staron M, Hong F, Li Y, Wu S, Li Y, Hao B, Bona R, Han D, Li Z (2010) Folding of Toll-like
1925 receptors by the HSP90 paralogue gp96 requires a substrate-specific cochaperone. Nat Commun 1:79 Marzec M, Eletto D, Argon Y (2012) GRP94: an HSP90-like protein specialized for protein folding and quality control in the endoplasmic reticulum. Biochim Biophys Acta 1823:774–787 Meunier L, Usherwood YK, Chung KT, Hendershot LM (2002) A subset of chaperones and folding enzymes form multiprotein complexes in endoplasmic reticulum to bind nascent proteins. Mol Biol Cell 13:4456–4469 Obermann WM, Sondermann H, Russo AA, Pavletich NP, Hartl FU (1998) In vivo function of Hsp90 is dependent on ATP binding and ATP hydrolysis. J Cell Biol 143:901–910 Ostrovsky O, Makarewich CA, Snapp EL, Argon Y (2009) An essential role for ATP binding and hydrolysis in the chaperone activity of GRP94 in cells. Proc Natl Acad Sci USA 06:11600–11605 Phelan PE, Mellon MT, Kim CH (2005) Functional characterization of full-length TLR3, IRAK-4, and TRAF6 in zebrafish (Danio rerio). Mol Immunol 42:1057–1071 Pietretti D, Scheer MH, Wiegertjes GF (2011) Molecular and functional characterization TLR20: possible role in recognition of protozoan parasites. Book of Abstracts of the 15th international conference on disease of fish and shellfish: 252 Randow F, Seed B (2001) Endoplasmic reticulum chaperone gp96 is required for innate immunity but not cell viability. Nat Cell Biol 3:891–896 Rebl A, Goldammer T, Seyfert HM (2010) Toll-like receptor signaling in bony fish. Vet Immunol Immunopathol 134:139–150 Rebl A, Ko¨bis JM, Fischer U, Takizawa F, Verleih M, Wimmers K, Goldammer T (2011) MARCH5 gene is duplicated in rainbow trout, but only fish-specific gene copy is up-regulated after VHSV infection. Fish Shellfish Immunol 6:1041–1050 Rebl A, Verleih M, Ko¨bis J, Ku¨hn C, Wimmers K, Ko¨llner B, Goldammer T (2013) Transcriptome profiling of gill tissue in regionally bred and globally farmed rainbow trout strains reveals different strategies for coping with thermal stress. Mar Biotechnol 15:445–460 Robert J, Cohen N (1998) Evolution of immune surveillance and tumor immunity: studies in Xenopus. Immunol Rev 166:231–243 Roberts RJ, Agius C, Saliba C, Bossier P, Sung YY (2010) Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J Fish Dis 33:789–801 Shiu RPC, Pouyssegur J, Pastan I (1977) Glucose depletion accounts for induction of 2 transformation-sensitive membrane proteins in rous-sarcoma virus-transformed chick-embryo fibroblasts—(glucose starvation membrane proteins). Proc Natl Acad Sci USA 74:3840–3844 Soldano KL, Jivan A, Nicchitta CV, Gewirth DT (2003) Structure of the N-terminal domain of GRP94: basis for ligand specificity and regulation. J Biol Chem 278: 48330–48338 Tang D, Kang R, Coyne CB, Zeh HJ, Lotze MT (2012) PAMPs and DAMPs: signal 0 s that spur autophagy and immunity. Immunol Rev 249:158–175
123
1926 van der Sar AM, Stockhammer OW, van der Laan C, Spaink HP, Bitter W, Meijer AH (2006) MyD88 innate immune function in a zebrafish embryo infection model. Infect Immun 74:2436–2441 Wilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, Hochstrasser DF (1999) Protein identification
123
Fish Physiol Biochem (2014) 40:1917–1926 and analysis tools in the ExPASy server. Methods Mol Biol 112:531–552 Yang Y, Liu B, Dai J, Srivastava PK, Zammit DJ, Lefrancois L, Li Z (2007) Heat shock protein gp96 is a master chaperone for toll-like receptors and is important in the innate function of macrophages. Immunity 26:215–226
GRP94 is encoded by two differentially expressed genes during development of rainbow trout (Oncorhynchus mykiss) Alexander Rebl • Andreas Brietzke • Tom Goldammer • Hans-Martin Seyfert
Received: 8 January 2014 / Accepted: 19 August 2014 / Published online: 3 September 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract The glucose-regulated protein, 94 kDa (GRP94), is an endoplasmic reticulum (ER)-localized heat shock protein that plays among other functions a crucial role in folding and exports of Toll-like receptors (TLRs) and some other immune-relevant factors. We identified two copies of the GRP94encoding gene in rainbow trout sharing 91 % DNA sequence identity. The conceptually translated ORFs encode a 795-aa GRP94a and a 510-aa GRP94b protein variant, respectively, with characteristic domains and amino acid residues. However, the shorter variant lacks motifs required for its localization in the ER and might thus represent an isoform of the putative mammalian ortholog GRP94a. Heat stress only slightly affects the expression of the two GRP94encoding trout genes, as reported for mammals. We recorded the abundances of transcripts coding for both GRP94 variants as well as for a broad panel of TLRs representing their potential targets. In embryonic and
Electronic supplementary material The online version of this article (doi:10.1007/s10695-014-9979-7) contains supplementary material, which is available to authorized users. A. Rebl A. Brietzke T. Goldammer (&) H.-M. Seyfert Leibniz Institute for Farm Animal Biology (FBN), Institute of Genome Biology, Wilhelm-Stahl-Allee 2, 18196 Dummerstorf, Germany e-mail: [email protected]
larval trout, only the mRNAs encoding TLR1, -2, -9, and -20 were found in significant concentrations, while the expression of nine other TLRs was hardly detectable. The GRP94a-encoding gene showed constantly high expression levels indicating that this isoform is vitally required throughout the life cycle of rainbow trout. The concentration of the GRP94bencoding mRNA was only *0.1 % compared to the GRP94a mRNA level. These structural and gene expression data together suggest that the two GRP94 gene products fulfill different physiological roles. Keywords Glucose-regulated protein Heat shock protein Rainbow trout Salmonid development Toll-like receptor Abbreviations Aa BLAST DAMP dpf ER GRP94 HATPase HSP HSP90B1 PAMP TLR
Amino acid Basic local alignment search tool Damage-associated molecular patterns Days post-fertilization Endoplasmic reticulum Glucose-regulated protein 94 Histidine kinase-like adenine nucleotide binding Heat shock proteins Heat shock protein 90 kDa beta, member 1 Pathogen-associated molecular patterns Toll-like receptors
123
1918
Introduction Heat shock proteins (HSPs) belong to the most conserved proteins in evolution (Robert and Cohen 1998). It has been well documented for fish and shellfish that HSPs not only fold newly synthesized polypeptide chains and repair denatured proteins but also inhibit apoptosis and initiate inflammatory mechanisms (Roberts et al. 2010). GRP94 (glucose-regulated protein, 94 kDa; other aliases: gp96, ERp99, Tra1, and endoplasmin) is an endoplasmic reticulum (ER)-resident paralog of the cytosolic HSP90. The GRP94-encoding gene HSP90B1 is assumed to have arisen by gene duplication very early in evolution and is therefore present in all eukaryotes except fungi (Gupta 1995). GRP94 acts either as a homodimer or it associates with other factors such as chaperones, then assembling into a multichaperone complex with GRP78, GRP94, and GRP170 as the most abundant components (Meunier et al. 2002). Misfolded proteins may arise as a consequence of glucose starvation (Shiu et al. 1977) or a variety of reagents disrupting intracellular calcium stores (Drummond et al. 1987) and are known to induce GRP94 expression. In addition, mammalian GRP94 chaperone controls specific pathways critical for cell growth and differentiation (Eletto et al. 2010). GRP94 has also a role in immune regulation, since it is a chaperone for several membrane-bound and endoplasmic Toll-like receptors (TLRs) (Randow and Seed 2001). These receptors are crucial sensors of pathogen-associated and danger-associated molecular patterns (PAMPs and DAMPs) (Tang et al. 2012). The subsequent signaling cascade activates the innate immune system and is conserved from fish to man (Rebl et al. 2010). It has been demonstrated that mammalian GRP94 plays a critical role in folding TLR1, -2, -4, -5, -7, and -9 (Yang et al. 2007), but not TLR3 (Liu et al. 2010). GRP94 chaperones, in addition, also integrins (Liu and Li 2008). Previous expression studies during teleost embryogenesis revealed that relevant TLR mRNA copies are detectable very early after fertilization (Jault et al. 2004; Phelan et al. 2005; van der Sar et al. 2006). This suggests, by inference, that abundant HSP90B1 gene products should be available during these stages to ensure the proper structural folding of newly synthesized TLRs.
123
Fish Physiol Biochem (2014) 40:1917–1926
Our long-term interest is the structural and functional characterization of innate immune cascades in rainbow trout, an aquaculture species of high economic value. The knowledge of structure and expression characteristics of two GRP94 factors from trout represents the basis for detailed studies on these auxiliary factors required for proper functioning of specific pathways.
Materials and methods Trout sampling and RNA extraction Rainbow trout (strain BORN, Germany) were grown from eyed eggs to 2-year-old fish at the Institute for Fisheries LFA-MV (Born and Hohen Wangelin, Germany). In the course of trout development, we sampled ‘eyed eggs’ (*2 weeks before start of hatching) 21 days post-fertilization (dpf) maintained at 8 °C in upwelling incubators; 42-dpf and 49-dpf ‘sac fry’ larvae (1 day and 1 week, respectively, after final hatching) were maintained at 14 °C in standard troughs; 56-dpf fry fish without yolk sac (*1 week after first feeding) were maintained at 14 °C in holding tanks; and adult rainbow trout (11 months, 27.4 ± 1.1 cm; 309.3 ± 38.8 g) were maintained at 16–18 °C in 300-L tanks. Embryos, larvae (n = 4) and tissue samples from adult fish (brain, gills, head kidney, liver, muscle, spleen, trunk kidney; n = 8) were immediately transferred into RNAlaterTM (Qiagen, Hilden, Germany) and stored at -80 °C. An additional experiment was conducted to induce mild cold stress at 8 °C and mild heat stress at 23 °C in healthy 10-month-old BORN trout as previously described (Rebl et al. 2013). In brief, rainbow trout were maintained in experimental 300-L tanks with 15 °C-tempered water 2 weeks before temperature change. The temperature of both tanks was then lowered or raised to 8 °C or to 23 °C (1 °C per day) until trout were adapted to constant water temperatures at 8 or 23 °C for 1 week. Eight tissues from four trout (brain, gills, head kidney, liver, muscle, spleen, and trunk kidney) were selected for individual RNA extraction. RNA extraction was performed utilizing first TRIzolTM (Invitrogen, Karlsruhe, Germany) and subsequently cleaned using the RNeasyÒ Mini Kit (Qiagen,
Fish Physiol Biochem (2014) 40:1917–1926
Hilden, Germany) including in-column RNase-free DNase (Qiagen) treatment for 30 min. RNA quality was checked by denaturing agarose gel electrophoresis. Isolation and analysis of two HSP90B1 cDNA sequences from rainbow trout The human HSP90B1 cDNA sequence (NCBI accession: NM_003299) coding for GRP94 was used as BLAST query to search the NCBI EST database (http://www.ncbi.nlm.nih.gov/). The ESTs BX889311 and CU072387 from rainbow trout were clearly homologous to the query, albeit both shared only 91 % identical nucleotides within a 773-bp overlap indicating the expression of two different, yet related genes. Hence, both ESTs were used to derive HSP90B1a- and HSP90B1b-specific primers (Table 1). RACE experiments were conducted with the Gene Racer SuperScriptTM II RT Module (Invitrogen, Karlsruhe, Germany) producing overlapping fragments in two PCR rounds, essentially as described in Rebl et al. 2011). To ensure the correctness of the coding sequences for GRP94a and GRP94b, we amplified eventually [2-kb ORFs of each gene. We utilized oligonucleotides derived from the flanking UTRs (Table 1) and the OneTaqÒ Hot Start Polymerase (New England Biolabs, Frankfurt am Main, Germany) following the manufacturer’s suggested PCR protocols. The resulting cDNA sequences were submitted to GenBank (HSP90B1a, HG421285 and HSP90B1b, HG421286). Each nucleotide position was sequenced at least four times based on independent PCR events. Protein characterization was conducted using the Expert Protein Analysis System Proteomics server (Wilkins et al. 1999), and the programs SignalP 3.0 (Bendtsen et al. 2004), SMART (Letunic et al. 2009) and ClustalW (Combet et al. 2000). The phylogenetic tree was constructed with Molecular Evolutionary Genetics Analysis package MEGA 5 (Kumar et al. 2004). The dendrogram was created with the Neighbor-Joining method using 1,000 bootstrap replicates. Real-time fluorescence quantitative RT-PCR Specific oligonucleotides were derived to measure the HSP90B1a and HSP90B1b copy numbers in selected tissues. We designed additionally primer pairs
1919
amplifying sequence fragments of 13 TLRs from rainbow trout (Table 1) including four sequences for TLR2, TLR19, TLR22a1, and TLR22a2, having been identified in our lab. A comprehensive comparison of trout TLR expression profiles in different tissues after experimental infection will be published elsewhere. Prior to cDNA synthesis, the concentration of total RNA was accurately determined in repeated measurements using NanoDropÒ ND-1000 spectrophotometer (NanoDropÒ Technologies, Wilmington, DE, USA) and the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Complementary DNA was synthesized using an oligo-d(T) primer [25 pmol/ lL] and Super ScriptTM II kit (Invitrogen, Karlsruhe, Germany). Adjusted pipetting for each sample according to the measured RNA concentrations eventually ensured the use of 75 ng total RNA per reaction. After cDNA purification with High Pure PCR Product Purification Kit (Roche, Basel, Switzerland), quantification reactions were carried out on the LightCyclerÒ 480 Instrument utilizing LightCyclerÒ 480 SYBR Green I Master Kit (Roche, Mannheim, Germany). Thermal cycling included the following steps: initial activation of the Taq DNA Polymerase (95 °C for 10 min), followed by 40 cycles of denaturation (95 °C, 15 s), annealing (60 °C, 10 s), and extension (72 °C, 20 s). The qRT-PCR assays included both positive controls and non-template controls. Melting curve analyses indicated single products. Copy numbers were titrated against serial dilutions of specific, PCR-generated reference fragments as external standards. The correlation coefficient R2 of the respective standard curves was higher than 0.99 in each case (Table 1). PCR efficiencies for the used genes were above 80 %. The parallel recording of transcripts encoding EEF1A1 (eukaryotic translation elongation factor 1 alpha 1) served to generate a normalization factor to correct for possible variations in reverse transcription efficiencies during cDNA synthesis from adult tissue and temperature stress RNA samples (Bowers et al. 2008), as EEF1A1 copy numbers did not vary between those samples. In contrast, for embryonic and larval samples, we and others (Heinecke et al. 2014) could not find a suitable internal reference gene. In the present study, EEF1A1, ACTB, GAPDH, RPS5, RPS20, RPL4, and ubiquitin were tested and found to show inconsistent expression between developmental stages. Expression measurements of embryos and
123
123
HG421285
HG421286
NM_001166101
HE979560
DQ459470
NM_001124208
GQ422119
GQ422121
GQ422120 NM_001129991
HF952170
CA356384*
CX261318*
AJ628348
AJ878915
HSP90B1a
TLR1
TLR2
TLR3
TLR5
TLR7
TLR8a1
TLR8a2 TLR9
TLR19
TLR20
TLR21
TLR22a1
TLR22a2
HG421286
HSP90B1b
HG421285
HSP90B1b
CU072387*
HSP90B1b
HSP90B1a
BX889311*
CU072387*
HSP90B1b
HSP90B1a
BX889311*
HSP90B1a
CU072387*
HSP90B1b
* EST sequence
qRT-PCR
Long template PCR
30 RACE nested PCR
30 RACE PCR
BX889311*
HSP90B1a
HSP90B1b
50 RACE nested PCR
BX889311*
CU072387*
HSP90B1a
50 RACE PCR
Accession number
Gene
Application
TAGAAGTCGTACCAAAAGACATTC
TGGACAATGACGCTCTTTTACC
CTCAAAGGAGGTTTTTGGGAATC
ACCCTCCGTCTGCTGGTGGA
GAGAGGAGGAGGTGAGGTATG
TCTCGAATATGAGCAACCTTGTC TGGTATTGCTTCCAGGTGCTGT
CTGTGTCACTTCCTGGTCATAAA
TGCACAGAGAGTGTGACTATCAA
CAACTTCTTCGTTTGGCTGATAAT
AGTCCTCCACCTGTCGAATCTA
AGTTCTTGGGAGTAGAGGATGC
AAAGACAGAGATGAGGGCTGTG
AGACTGTTGAGGAGCCCATCG
AGACTGTTGAGGAGCCCATCG
CCGCCCTAAGAACCCGACTC
TGTGTGTGCGCTTTTATACGGC
TAATCTACCTGACAGAACCAGTG
TCCTGTTTGTCCCCGCTGCC
ACTCTGATGATCTGCCACTGAAT
CTGTGTGGGACTGGGAGCTG
Sense primer sequence (50 –30 )
Table 1 Gene-specific primers used in this study
GAGAGACCCATCATCCACTGAA
GAGCTGATGGTTGCAATGAGG
CTGTTGAGGCAGGTGCAACTAA
CCACAGACGGTCCCAGAAGG
ATGCCCTTCCCTACCTCAAAGT
AGTCCTTTTGGAACACGAGTTAAA CTCCAGGTGGACCAGCAGCT
TTTTCTGATAGGTCCAGCACAGT
ATGTCAGAGAGGTTCGTTTTCAG
ACCAGAGAAACTCAATGTGCATTA
GATCGCTGTCCCAGAAAGCTC
CAGTAGAAACCCCACAGGCAG
CGGTGCATGGAGGTAGGTTTC
TCTCGTCCAGATAGGCTTGAC
GTCTCGTCCAGATCGGCTTAAT
AACTTTCTCAATAGTCAACGGTCT
CACCCTTCCTCATTTACAGTGC
AGCATGTTCTTCTCTTTGTCCAT
CAGCTCCCAGTCCCACACAG
CTTCACCTCGGTGTCCTCGAT
CACCCTCGGCTGTGAAGTGG
Antisense primer sequence (50 –30 )
161
151
156
174
154
183 155
187
179
160
154
141
161
152
180
2,155
2,486
*770
*1,740
*1,150
*1,900
*240
*1,070
*700
*1,200
Fragment size (bp)
2.0
2.0
2.1
1.9
2.1
2.0 2.0
2.0
2.0
1.9
2.0
1.8
2.0
2.1
1.8
Amplification factor
0.99990
0.99982
0.99989
0.99982
0.99985
0.99977 0.99989
0.99946
0.99895
0.99988
0.99997
0.99937
0.99995
0.99866
0.99868
R2 of calibration curves
1920 Fish Physiol Biochem (2014) 40:1917–1926
Fish Physiol Biochem (2014) 40:1917–1926
1921
Fig. 1 Phylogenetic relationship of GRP94 aa sequences. The NCBI and ENSEMBLE (E) accession numbers of the protein sequences used to generate the Neighbor-Joining tree are listed on the right. Additionally, protein lengths and aa identities shared with trout GRP94a protein are listed for the respective
sequence. Human HSP90 gene was used as outgroup. Bootstrap confidence values represent the percent frequency of appearances of each clade in 1,000 replicas. The scale bar represents a genetic distance of 0.05 aa substitutions per site. Teleost GRP94 proteins are highlighted in light gray
larvae were therefore normalized against total RNA concentration as described in Ref. (Bustin 2000). Expression data were eventually subjected to a oneway ANOVA applying Bonferroni multiple testing correction as provided by GraphPad PrismÒ version 5.01.
second gene variant in trout encodes a putative 59-kDa protein (CDG41618) lacking 116 N-terminal aa and 160 C-terminal aa compared to its paralog. As a consequence, GRP94b is missing a 21-aa long signal peptide as predicted for GRP94a, targeting this factor to the ER (Eletto et al. 2010). Furthermore, GRP94b lacks the C-terminal ER targeting sequence ‘KDEL’ (PROSITE accession: PS00014), which is conserved across all vertebrate GRP94 proteins including GRP94a from rainbow trout. These findings indicate a different spatial distribution of both GRP94 paralogs. The HSP90 family signature ‘YKNKEIFLRE,’ presents in trout GRP94a (position 94–103; PROSITE: PS00298), is also absent in its paralog. On the other hand, the characteristic N-terminal HATPase (histidine kinase-like adenine nucleotide binding) domain (Suppl. Figure 1) has been predicted for both, trout GRP94a (position 97–225) and GRP94b (position 1–109). It comprises the ten critical residues L104/-, N107/-, A111/-, D149/33, G153/37, M154/38, N162/46, G196/-, F199/83, and T245/130 making up the adeninebinding cavity (Soldano et al. 2003), which are
Results and discussion HSP90B1 gene is duplicated in rainbow trout Two homologous HSP90B1-like cDNA sequences from rainbow trout were identified and submitted to GenBank, HSP90B1a (GRP94a; HG421285), and HSP90B1b (GRP94b; HG421286). Trout HSP90B1a seems to be a true ortholog of HSP90B1 having been described in many eukaryotes (Gupta 1995). The ORF of trout HSP90B1a gene translates into 795 amino acids (aa) with a hypothetical molecular weight of 91 kDa (CDG41617). This corresponds to vertebrate GRP94 protein sequences comprising about 800 aa residues (Fig. 1, second column). Strikingly, HSP90B1b, the
123
1922
completely conserved in GRP94a and partially in GRP94b, respectively. The prototypical HATPase domain contains in addition two conserved motifs, G151V152G153 and G196V197G198. These are only conserved in GRP94a and may define the top and bottom of the ATP-binding site (Obermann et al. 1998). ATP binding allows N-terminal dimerization and the subsequent binding of client proteins. Hence, this GRP94b apparently lacks this property. The chaperoning function depends significantly on the ATPase activity (Ostrovsky et al. 2009). Crucial for ATP hydrolysis is a conformational change mediated through a highly charged domain (Biswas et al. 2007) present in GRP94a (position 293–319) and GRP94b (position 177–197) with 48 and 43 % glutamic acid residues, respectively. A second charged domain according to Chen et al. (2005) is only present within trout GRP94a protein (position 667–680 containing 3 tyrosine residues). These structural data show that the rainbow trout genome encodes a GRP94 protein (GRP94a) that is very similar to its ortholog in other eukaryotes. Presumably, due to a salmonid-specific genome duplication (Allendorf and Thorgaard 1984), a second gene expresses a truncated GRP94 variant, GRP94b, which lacks a signal peptide, typical signature motifs, and essential residues for ATP binding. At first glance, it appears that HSP90B1b gene is still transcribed though predetermined for decay, a fate that share about 50 % of duplicated genes in salmonid fishes (Bailey et al. 1978). However, we cannot rule out the possibility that both genes either fulfill specialized tasks in different cellular compartments (ER, cytoplasm) or chaperone different spectra of clients according to the neofunctionalization/subfunctionalization theory by Force et al. (1999). Indeed, Marzec et al. (2012) hypothesized that a distinct cytosolic subpopulation of GRP94 equipped with a new function might exist in higher vertebrates. GRP94a from rainbow trout shares high homology with its orthologs In general, GRP94 is well conserved among vertebrates emphasizing its essential biological role. This structural similarity is reflected by an aa sequence comparison in Fig. 1 revealing that the GRP94a protein from trout shares 80 % identity with its human counterpart and even 47 % with its homologue in maize. However, trout GRP94a protein shares highest
123
Fish Physiol Biochem (2014) 40:1917–1926
overall identity ([85 %) with its piscine orthologs. The alignment of six GRP94 protein sequences from bony fish (Suppl. Figure 1) stresses this high degree of conservation, although fish-specific features were uncovered, especially in two glutamic acid-rich regions. The N-terminally situated charged domain for example comprises only seven residues in Spotted green pufferfish, but 29 residues in Japanese flounder. A similar variation is obvious in the C-terminus proximal to the ER retention signal. These two regions show also sequence variation when the alignment is expanded to include higher vertebrates. Phylogenetic analysis of all piscine full-length GRP94 aa sequences reported in databases, and their homologue proteins from representatives of different animal classes and a plant species produced a Neighbor-Joining tree (Fig. 1) assigning GRP94 proteins from bony fish to a specific cluster with 99 % bootstrap support, as opposed to their homologues in higher vertebrates. GRP94 proteins from trout form a subcluster with GRP94 proteins from zebrafish and grass carp. As expected, GRP94 from Pacific hagfish E. stoutii, a jawless primitive vertebrate, is separated from its counterparts in teleosts and higher vertebrates with a bootstrap confidence level of 100 %. This phylogenetic analysis reveals in general the close evolutionary relatedness of GRP94 aa sequences among eukaryotes. HSP90B1a expression dominates over its paralog’s expression Quantitative RT-PCR analyses were carried out to investigate the expression profile of both HSP90B1 genes encoding GRP94 isoforms. During the development of rainbow trout (Fig. 2a), we recorded a high abundance of the HSP90B1a mRNA in embryos (3.8 9 107 HSP90B1a copies per lg RNA), while decreasing during the larval development (down to 2.6 9 106 copies/lg RNA). In contrast, HSP90B1b copy number was strikingly lower (with values between 5.4 9 103 and 1.9 9 104/lg RNA) reaching a peak value 42 days after hatching (P \ 0.001) (Fig. 2b). In adult rainbow trout, both HSP90B1 genes showed a similar discrepancy regarding the extent of their expression levels. In essence, the HSP90B1a mRNA concentration was 613- to 1,473-fold above the HSP90B1b mRNA level. Transcripts of both HSP90B1 genes were most abundant in liver, spleen,
Fish Physiol Biochem (2014) 40:1917–1926
1923
Fig. 2 Quantitative RT-PCR analysis of a HSP90B1a, b HSP90B1b, and c TLR transcript levels in trout embryos or larvae (n = 4; dotted bars) and in selected tissues of adult trout (n = 8; filled bars; highlighted in light gray). The bar graphs
display the mean copy numbers per lg RNA (±SEM). Differences in expression with P B 0.05 between the developmental stages (lowercase letters) or between tissues (uppercase letters) are indicated with different letters above the bars
and gills, whereas white muscle contained Cfourfold lower copy numbers (P \ 0.05). Since mammalian GRP94 has been demonstrated to assist TLR folding (Yang et al. 2007), we hypothesized that the abundant expression of the HSP90B1a gene during the development of trout larvae might correlate with an explicit TLR expression. Determining the copy numbers of all currently known trout TLR sequences in the investigated egg and larval samples (Fig. 2c), we found for most of these mRNA species very low levels near the detection limit. Relevant mRNA concentrations were recorded only for TLR1, -2, -9, and -20. These might be sufficient to provide a basic protection against potential pathogens, since they detect a broad range of ligands. The heterodimer
of TLR1 and TLR2 is known to sense bacterial lipopeptides, TLR9 recognizes viral or bacterial DNA (Rebl et al. 2010), and TLR20 likely detects protozoan parasites (Pietretti et al. 2011). The copy numbers of HSP90B1a exceed, however, at least 30 times those encoding TLRs, which is at odds with the hypothesis of a more or less balanced chaperone/client ratio of 1–1. It seems less plausible that TLR-encoding transcripts are less stable than HSP-encoding mRNAs to compensate those discrepant expression levels. It is rather imaginable that trout HSP90B1a product chaperones not only TLRs, but also a number a further clients. Moreover, it might also be indispensable for responses to metabolic stress situations. Organogenesis and differentiation processes require an adequate
123
1924
Fish Physiol Biochem (2014) 40:1917–1926
Fig. 3 The mRNA abundance of HSP90B1a (filled columns) and HSP90B1b (hatched columns) genes in selected tissues of adult trout (n = 4) at 23 °C (black columns) is compared with
the respective copy number at 8 °C (gray columns). EEF1A1 was used as internal reference. Data are expressed as foldchanges ±SEM
energy supply and might be reflected by the induction of typical stress genes such as HSP90B1 along with HSPA5 (coding for GRP78) as reported for mammalian embryos (Kim et al. 1990). On the other hand, in keeping with the theory of subfunctionalization by Force et al. (1999), the low level of HSP90B1b expression conceivably provides a specialized HSP factor exclusively for supporting the folding of TLRs. We examined also the effect of mild temperature stress at 8 or 23 °C on HSP90B1 expression. HSP90B1 expression was found only slightly regulated in some of the investigated tissues (Fig. 3). HSP90B1a copy number decreased 1.5-fold in liver (P = 0.01), while increasing slightly in brain (0.7-fold; P = 0.04). The concentration of HSP90B1b-derived mRNA was 2.4fold decreased in head kidney (P = 0.03). This is in line with previous publications reporting that mammalian HSP90B1 induction is scarcely detectable after high temperatures (Marzec et al. 2012) in contrast to its relatives HSP90AA1 or HSP90AA, which are also induced in trout (Rebl et al. 2013). Our expression data allow initial estimates about the biological significance of both HSP90B1 genes in rainbow trout, though a larger sample number would
yield more reliable results with an increased level of statistical significance. A general conclusion drawn from the expression data is that both HSP90B1a and b genes underlie a regulation under different physiological conditions indicating distinct functional spectra for both HSPs. The abundant presence of HSP90B1a transcripts suggests a crucial importance of GRP94a for cell homeostasis.
123
Acknowledgments We would like to thank the LFA-MV Institute for Fisheries (Born and Hohen Wangelin, Germany) and the fish farm BIMES (Frauenmark, Germany) for breeding and providing the fish sample material. We are grateful to B. Scho¨pel, I. Hennings, and M. Fuchs for dedicated technical assistance. This work benefited equally from funding by the DFG-Grant SE 326/16-1 from the German Research Foundation and by Grant No. AU11040 from the European Social Fund (ESF) and Ministry of Education, Science and Culture of Mecklenburg-Western Pomerania.
References Allendorf F, Thorgaard G (1984) Tetraploidy and the evolution of salmonid fishes. In: Turner B (ed) Evolutionary genetics of fishes. Springer, US, pp 1–53
Fish Physiol Biochem (2014) 40:1917–1926 Bailey GS, Poulter RTM, Stockwell PA (1978) Gene duplication in tetraploid fish: model for gene silencing at unlinked duplicated loci. Proc Natl Acad Sci USA 75:5575–5579 Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795 Biswas C, Ostrovsky O, Makarewich CA, Wanderling S, Gidalevitz T, Argon Y (2007) The peptide-binding activity of GRP94 is regulated by calcium. Biochem J 405:233–241 Bowers RM, Lapatra SE, Dhar AK (2008) Detection and quantitation of infectious pancreatic necrosis virus by realtime reverse transcriptase-polymerase chain reaction using lethal and non-lethal tissue sampling. J Virol Methods 147:226–234 Bustin SA (2000) Absolute quantification of mRNA using realtime reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25:169–193 Chen B, Piel WH, Gui L, Bruford E, Monteiro A (2005) The HSP90 family of genes in the human genome: insights into their divergence and evolution. Genomics 86:627–637 Combet C, Blanchet C, Geourjon C, Deleage G (2000) NPS@: network protein sequence analysis. Trends Biochem Sci 25:147–150 Drummond IA, Lee AS, Resendez E Jr, Steinhardt RA (1987) Depletion of intracellular calcium stores by calcium ionophore A23187 induces the genes for glucose-regulated proteins in hamster fibroblasts. J Biol Chem 262:12801–12805 Eletto D, Dersh D, Argon Y (2010) GRP94 in ER quality control and stress responses. Semin Cell Dev Biol 21:479–485 Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J (1999) Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151:1531–1545 Gupta RS (1995) Phylogenetic analysis of the 90 kD heat shock family of protein sequences and an examination of the relationship among animals, plants, and fungi species. Mol Biol Evol 12:1063–1073 Heinecke RD, Chettri JK, Buchmann K (2014) Adaptive and innate immune molecules in developing rainbow trout, Oncorhynchus mykiss eggs and larvae: expression of genes and occurrence of effector molecules. Fish Shellfish Immunol 38:25–33 Jault C, Pichon L, Chluba J (2004) Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol Immunol 40:759–771 Kim KS, Kim YK, Lee AS (1990) Expression of the glucoseregulated proteins (Grp94 and Grp78) in differentiated and undifferentiated mouse embryonic-cells and the use of the Grp78 promoter as an expression system in embryoniccells. Differentiation 42:153–159 Kumar S, Tamura K, Nei M (2004) MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5:150–163 Letunic I, Doerks T, Bork P (2009) SMART 6: recent updates and new developments. Nucleic Acids Res 37:D229–D232 Liu B, Li Z (2008) Endoplasmic reticulum HSP90b1 (gp96, grp94) optimizes B-cell function via chaperoning integrin and TLR but not immunoglobulin. Blood 112:1223–1230 Liu B, Yang Y, Qiu Z, Staron M, Hong F, Li Y, Wu S, Li Y, Hao B, Bona R, Han D, Li Z (2010) Folding of Toll-like
1925 receptors by the HSP90 paralogue gp96 requires a substrate-specific cochaperone. Nat Commun 1:79 Marzec M, Eletto D, Argon Y (2012) GRP94: an HSP90-like protein specialized for protein folding and quality control in the endoplasmic reticulum. Biochim Biophys Acta 1823:774–787 Meunier L, Usherwood YK, Chung KT, Hendershot LM (2002) A subset of chaperones and folding enzymes form multiprotein complexes in endoplasmic reticulum to bind nascent proteins. Mol Biol Cell 13:4456–4469 Obermann WM, Sondermann H, Russo AA, Pavletich NP, Hartl FU (1998) In vivo function of Hsp90 is dependent on ATP binding and ATP hydrolysis. J Cell Biol 143:901–910 Ostrovsky O, Makarewich CA, Snapp EL, Argon Y (2009) An essential role for ATP binding and hydrolysis in the chaperone activity of GRP94 in cells. Proc Natl Acad Sci USA 06:11600–11605 Phelan PE, Mellon MT, Kim CH (2005) Functional characterization of full-length TLR3, IRAK-4, and TRAF6 in zebrafish (Danio rerio). Mol Immunol 42:1057–1071 Pietretti D, Scheer MH, Wiegertjes GF (2011) Molecular and functional characterization TLR20: possible role in recognition of protozoan parasites. Book of Abstracts of the 15th international conference on disease of fish and shellfish: 252 Randow F, Seed B (2001) Endoplasmic reticulum chaperone gp96 is required for innate immunity but not cell viability. Nat Cell Biol 3:891–896 Rebl A, Goldammer T, Seyfert HM (2010) Toll-like receptor signaling in bony fish. Vet Immunol Immunopathol 134:139–150 Rebl A, Ko¨bis JM, Fischer U, Takizawa F, Verleih M, Wimmers K, Goldammer T (2011) MARCH5 gene is duplicated in rainbow trout, but only fish-specific gene copy is up-regulated after VHSV infection. Fish Shellfish Immunol 6:1041–1050 Rebl A, Verleih M, Ko¨bis J, Ku¨hn C, Wimmers K, Ko¨llner B, Goldammer T (2013) Transcriptome profiling of gill tissue in regionally bred and globally farmed rainbow trout strains reveals different strategies for coping with thermal stress. Mar Biotechnol 15:445–460 Robert J, Cohen N (1998) Evolution of immune surveillance and tumor immunity: studies in Xenopus. Immunol Rev 166:231–243 Roberts RJ, Agius C, Saliba C, Bossier P, Sung YY (2010) Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J Fish Dis 33:789–801 Shiu RPC, Pouyssegur J, Pastan I (1977) Glucose depletion accounts for induction of 2 transformation-sensitive membrane proteins in rous-sarcoma virus-transformed chick-embryo fibroblasts—(glucose starvation membrane proteins). Proc Natl Acad Sci USA 74:3840–3844 Soldano KL, Jivan A, Nicchitta CV, Gewirth DT (2003) Structure of the N-terminal domain of GRP94: basis for ligand specificity and regulation. J Biol Chem 278: 48330–48338 Tang D, Kang R, Coyne CB, Zeh HJ, Lotze MT (2012) PAMPs and DAMPs: signal 0 s that spur autophagy and immunity. Immunol Rev 249:158–175
123
1926 van der Sar AM, Stockhammer OW, van der Laan C, Spaink HP, Bitter W, Meijer AH (2006) MyD88 innate immune function in a zebrafish embryo infection model. Infect Immun 74:2436–2441 Wilkins MR, Gasteiger E, Bairoch A, Sanchez JC, Williams KL, Appel RD, Hochstrasser DF (1999) Protein identification
123
Fish Physiol Biochem (2014) 40:1917–1926 and analysis tools in the ExPASy server. Methods Mol Biol 112:531–552 Yang Y, Liu B, Dai J, Srivastava PK, Zammit DJ, Lefrancois L, Li Z (2007) Heat shock protein gp96 is a master chaperone for toll-like receptors and is important in the innate function of macrophages. Immunity 26:215–226
