ARTICLES Growth Regulation of Estrogen ReceptorNegative Breast Cancer Cells Transfected With Complementary DNAs for Estrogen Receptor

and of progesterone receptor in these transfectants. E2 inin wild-type sense transfectants at a Background: The growth of estrogen receptor (ER)-positive hibited DNA replication 10 concentration of 10~ M and mutant sense transfectants at a breast cancer cells is hormonally regulated, but the majority 8 concentration of 10" M, and ICI 164,384 blocked this effect. of breast cancers are ER negative and unresponsive to horConclusion: ER-negative breast cancer cells stably transmonal therapy. Purpose and Methods: To test whether horfected with either a mutant or wild-type ER gene regain hormonal control over replication can be re-established in monal responsiveness; however, E inhibits rather than 2 ER-negative cells, we transfected ER-negative MDA-MBstimulates cell growth. Implication: Reactivation of quiescent 231 (clone 10A) cells with sense and antisense constitutive ER may provide a novel therapeutic approach for controlER expression vectors containing the gene for either wildling ER-negative breast cancers. [J Natl Cancer Inst 84:580type or mutant ER linked to the gene for neomycin resis591,1992] tance aminoglycoside phosphotransferase (neo). A Northern blot analysis was done on total RNA from eight of the 10 transfectant clones produced to detect messenger RNA Breast cancer is one of the leading causes of death in women. coding for ER and neo, and a Western blot analysis was Regrettably, the incidence of breast cancer is increasing, and it done on protein extracted from the cells of one mutant and is currently estimated that one in nine women will develop the two wild-type ER sense transfectant clones to determine the molecular weight of the ER in transfectants. Levels of ER in transfectants were measured both by enzyme immunoassay and by ligand-binding methods. To ascertain whether the Received July 26, 1991; revised December 31, 1991; accepted December 31, ER in wild-type and mutant sense transfectants was functional, we tested the effects of 17p-estradiol (E2) and/or an 1991. Supported by Public Health Service grams CA-32713 and CA-14520 from the antiestrogen, ICI 164,384, on 1) ER-activated gene regula- National Cancer Institute, National Institutes of Health, Department of Health tion (by transient transfection of these cells a second time and Human Services. S-Y. Jiang is a member of the Human Cancer Biology Program in the Department of Human Oncology, University of Wiswith a reporter plasmid containing an estrogen response ele- Graduate consin, and is supported by scholarships from the National Science Council and ment linked to the chloramphenicol acetyl transferase the National Defense Medical Center, Republic of China, Taiwan. Department of Human Oncology, University of Wisconsin Comprehensive [CAT] gene), 2) induction of progesterone receptor, 3) DNA Center, Madison. replication, and 4) cell cycle kinetics. Results: Messenger Cancer We thank Professor Pierre Chambon for the estrogen receptor complementary RNA coding for ER and for neo was detectable in both sense DNA, Dr. G. MacGregor for the plasmid pCMVp", Dr. G. Schutz for the plasmid and antisense transfectant clones. Sense transfectants (both pERE15, Dr. A. Wakeling for the antiestrogen ICI 164,384, C.-H. Kao for help in plasmid construction, D. Wolf for conducting the polymerase chain reaction mutant and wild-type) expressed ER protein with a studies on the transfected estrogen receptor, Dr. R. T. Mulcahy for helpful dismolecular weight similar to that found in ER-positive con- cussions about the cell cycle studies, K. Shell and L. W. Morrissey for conducttrol cells. By the ligand-binding method high levels of ER ing the cell flow, M. Freitas for statistical analysis, and B. Rayho for manuscript preparation. were detected in both wild-type and mutant transfectants, This paper is dedicated to the memory of the late Charles S. Bescoby, who, 27 although by the enzyme immunoassay method lower levels years ago, spent many hours teaching one of us (V. C. Jordan) the central dogma were detected in mutant transfectants. ER from both wild- of protein synthesis. *Correspondence to: V. Craig Jordan, Ph.D., D.Sc, Department of Human type and mutant sense transfectants appeared functional, Oncology, University of Wisconsin Comprehensive Cancer Center, 600 Highsince E2 stimulated the expression of reporter-linked CAT land Ave.. Madison, WI 53792. 580

Journal of the National Cancer Institute

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

Shun-Yuan Jiang, V. Craig Jordan*

disease during her lifetime. However, a clue to the control of breast cancer has been known throughout this century: Some breast cancers require ovarian steroids to stimulate their growth

d-2).

Vol. 84, No. 8, April 15, 1992

Materials and Methods Construction of the ER Expression Plasmid A 2.25-kilobase (kb) DNA fragment, which consists of the neomycin resistance gene (neo), the simian virus 40 small t antigen splicing signal, and the polyadenylation signal, was generated from plasmid pSV2neo (American Type Culture Collection [ATCC], Rockville, Md.) by digestion with the restriction enzymes BamHl and Hindlll (22). The Xba 1 site was generated by cloning the 2.25-kb DNA fragment described above into the Sma I site of the plasmid pBluescript SK+ (Streptogene, La Jolla, Calif). The resulting DNA fragment was released by digestion with the restriction enzymes Xba I and A///7dIII and was then ligated to the 3.5-kb Xba \-Hind\\\ fragment from plasmid pCMVp (25), designated as pCMV-neo. Plasmid pCMV-neo synthesizes the product of the neo resistance gene aminoglycoside phosphotransferase under the control of the constitutive human cytomegalovirus immediate early gene promoter and enhancer. To generate the ER expression plasmid, the 1.8-kb EcoRI-digested wild-type or mutant ER cDNA fragment was isolated from plasmid pSG5-HEGO (24) or pSG5-HEO (14) and cloned into the EcoRI site of the vector pBluescript SK+. Mutant ER cDNA contained an altered form of the gene coding for the receptor. The mutant gene has a single point mutation, resulting in the replacement of the glycine residue at amino acid position number 400 in the ligand-binding domain of the protein with a valine residue. Following digestion with EcoRV and Spe I, the ER cDNA fragment was then ligated to the BamHl and Xba I site on the plasmid pCMV-neo through blunt-end and sticky-end ligation. These plasmids were designated as pCMV-ERoc-neo or pCMV-ERp-neo (Fig. 1). Each of these plasmids yielded a 4.1-kb polycistronic mRNA coding for 1) the ER protein in either the sense (the direction of normal, functional mRNA) or antisense (the direction of complementary mRNA that is nonfunctional, i.e., cannot be translated into protein) orientation and 2) aminoglycoside phosphotransferase.

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

The reason for the apparently arbitrary responsiveness of breast cancers to endocrine therapy (1.3) was not known until the estrogen receptor (ER) was described in the rat uterus (4-6), an estrogen target tissue. Estrogen nontarget tissues like muscle did not have the ER protein. This finding provided a scientific rationale for two applications: 1) predicting the hormonal responsiveness of breast cancers to endocrine therapy {7,8) and 2) developing antiestrogens to treat the disease (9). Tamoxifen, a nonsteroidal antiestrogen (10), is available to treat all stages of breast cancer (//) and is currently being evaluated as a preventive agent for breast cancer in healthy women (12). Although tamoxifen is the only single-agent therapy shown to provide a survival advantage in certain categories of breast cancers (75), the majority of breast cancers are refractory to hormonal therapy. The operational model is that hormone-dependent disease ultimately becomes hormone independent; the ER becomes vestigial and is then no longer produced. Clearly, one therapeutic strategy for breast cancer is to reactivate the quiescent ER. We explored whether this goal is realistic. Will the reactivated ER reassert control over replication in such breast cancer cells? The human ER gene has been cloned (14,15), and the functional receptor has been demonstrated by transfection of yeast (16), HeLa cells (15,17), and chicken embryo fibroblasts with the ER complementary DNA (cDNA) (17). Each of the studies has exclusively focused on the biological activity of the ER following transient transfection with cDNA coding for ER. The functional receptor was identified in the different cellular environments by the activation of a transfected reporter gene. Indeed, these studies (17) of the mechanics of ER action have illustrated the importance of the cellular environment and of the promoter for the reporter gene. Recently, stable expression of ER has been established in HeLa cells, osteosarcoma cells, and Chinese hamster ovary cells by transfection (18-21), and a negative effect of estrogen on replication has been observed in some of the transfectants (1820). However, all of these studies were performed using only the mutant ER4ooVai gene. No information has been available previously on transfection with the wild-type ER gene. To achieve a first step in the development of a novel therapeutic approach for breast cancer, i.e., increasing ER levels, we have transfected cDNAs for the human ER (Fig. 1, A) gene into the ER-negative and hormonally unresponsive breast cancer cell line MDA-MB-231 (clone 10A) (hereafter referred to as MDA-MB-231 CL10A). Our goal was to determine whether an ER control mechanism can be re-established in breast cancer cells in vitro before we attempt to develop methods either to reactivate or to reintroduce the ER in vivo. Our transfection strategy to produce polycistronic messenger RNA (mRNA) containing sequences for both the ER and for the neomycin resistance (neo) gene products has been successful. Ten stable transfectant clones from both the mutant and the wild-type ER gene (i.e., five for each) were obtained. However, because there are no reports of the successful transfection of a

breast cancer cell line, our initial aim was to establish whether the constitutively produced ER is functional and to determine the effects of 17(3-estradiol (E2) and of the pure antiestrogen1 ICI 164,384 on the replication of MDA-MB-231 cells.

Cell Lines and Tissue Culture ER-negative MDA-MB-231 cells were obtained from ATCC, and ER-positive MCF-7 cells were obtained from the Michigan Cancer Foundation (Detroit, Mich.). Both types of cells were maintained in phenol red-containing Eagle's minimal essential medium (MEM) supplemented with 5% calf serum, 6 ng/mL bovine insulin (Sigma Chemical Co., St. Louis, Mo.), 25 nW HEPES, 26 mM NaHCO3, 2 mM glutamine, 100 U/mL penicillin, and 100 |ig/mL streptomycin. All tissue culture reagents and media were obtained from GIBCO BRL, Life Technologies, Inc., Gaithersburg, Md., unless otherwise stated. Cells were

An estrogen antagonist possessing no estrogen-like activity.

ARTICLES

581

B 185

ER:

A/B

WT:

pCMV-ERp-neo

250 311

C

D

TCC ATG GAG CAC CCA Ser Met Glu His Pro

Lys

551 595 F

Leu Phe

(antisense)

Mutant: TCC ATG GAG CAC CCA Ser Met

Glu

Pro

GTG AAGk CTG TTT Val Lys Leu Phe

o t-

II mi J.J

m

cc

—_

—

ERa

"

•

g8

HE

[• v/yyyy/////

o -

I -o

* ,8*

CMV

MLo2H

o

Fig. 1. Map of the ER expression vectors (A) and structure of ER cDNA used for the transfection (B). ER cDNA was generated by reverse transcription using total RNA from MLa2H or S30 cells. The ligand-binding domain of the ER was then sequenced following polymerase chain reaction (PCR) amplification of the ER cDNA using specific oligonucleotide primers. The point mutation at codon 400 in ER transcripts from MLa2H cells is indicated by the arrow and compared with the sequence of the codon in ER transcripts from wild-type (WT) S30 cells. The nucleotide sequence corresponding to amino acid residue 400 was confirmed to be GTG (coding for valine) in mutant transfectant MLa2H and GGG (coding for glycine) in the wild-type transfectant.

tested monthly for Mycoplasma using the GEN-PROBE rapid detection system (GEN-PROBE, Inc., San Diego, Calif.), and all results were negative. MDA-MB-231 cells were cloned twice using 96-well plates by plating 0.5 cell per well. Clone 10A was selected for transfection studies to study a homogeneous population of ER-negative cells.

dextran-coated charcoal (i.e., estrogen-free medium). For the selection of wild-type ER transfectants, cells were cultured in estrogen-free medium after transfection. Colonies were isolated by using cloning cylinders and propagated in medium containing G418. The transfectants were screened for the expression of ER mRNA by Northern blot analysis and for the level of ER protein by using enzyme immunoassays.

Transfection Assay RNA Isolation and Northern Blotting ER-negative cells from the MDA-MB-231 CLI0A line were transfected with the constitutive ER expression vector previously described, and neomycin-resistant clones were identified and characterized. Liposome-mediated transfection (25) was carried out using Lipofectin reagent (GIBCO BRL, Life Technologies, Inc.). Cells were plated in 60-mm dishes in phenol red-containing MEM medium supplemented with 5% calf serum for 2 days. The mixture of Lipofectin reagent and 5-20 ug of the ER expression plasmids was added and then incubated for 24 hours in phenol red-free opti-MEM I-reduced serum medium. Cells were cultured in phenol red-containing MEM medium supplemented with serum for an additional 48 hours. Medium containing G418 (an antibiotic which will kill eukaryotic cells that do not express the neomycin resistance gene product) at a concentration of 500 (ig/mL was then used for the selection of transfectants. Two weeks later, cells were cultured in phenol red-free MEM supplemented with 5% calf serum treated with

582

Total RNA from the cells of eight transfectant clones (MLa2A, MLa2C, MLa2H, ML(33B, S10, S24, S30, and AS23), one ER-positive breast cancer cell line (MCF-7), and one ER-negative breast cancer cell line was prepared. To carry out this procedure, we first lysed cells in a solution containing 4 M guanidine isothiocyanate (Boehringer, Minneapolis, Minn.) and then pelleted the RNA through a 5.7 M cesium chloride cushion (26). RNA was then fractionated by electrophoresis in a 1.1% agarose-7% formaldehyde gel in 5 mM sodium acetate, 1 mM EDTA, and 20 mM 3-[7V-morpholino]propanesulfonic acid (Sigma Chemical Co.) (pH 7.0). After partial alkaline hydrolysis and neutralization, RNA was then transferred to a Hybond-/V membrane (Amersham Corp., Arlington Heights, III.). Blots were then air dried and UV fixed. The membrane was prehybridized at 47 °C in buffer containing 24 mM Na3PO4 (pH 6.5), 5x standard saline citrate (SSC), 5x Denhardt's solution. Journal of the National Cancer Institute

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

o CMV -

402

400

aa 395

S30

His

same method as was used in the Northern blot analysis above, was reverse transcribed using the Moloney murine leukemia virus reverse transcriptase enzyme with an oligo d(T) 16-mer serving as the primer. Next, oligonucleotides, ACGCCAGGGTGGCAGAGAAA and TGTGGGAGCCAGGGAGCTCT complemetary to regions located 5' to the region of the ER cDNA coding for the DNA-binding domain and 3' to the protein termination codon, were used as primers for PCR amplification. ER cDNAs were amplified using Taq polymerase, contained in the Gene Amp RNA PCR Kit (Perkin-Elmer Cetus, Norwalk, Conn.). The cDNAs for ER were amplified for 40 cycles, each cycle consisting of incubation at 94 °C for 45 seconds followed by incubation at 60 °C for 1 minute. The amplified cDNA, digested with Sac I and Bel I, was cloned into the BamH\- and Sac I-digested vector, pBluescript SK+. DNA sequencing by the dideoxynucleotide termination method on double-stranded DNA was carried out using the Sequenase Version 2.0 Kit (United States Biochemical Co., Cleveland, Ohio) with [35S]-deoxyadenosine triphosphate (DuPont/NEN Products). An oligonucleotide (GAACCGAGATGATGT) complementary to the ER cDNA between nucleotides 1523 to 1537 within the ligand-binding domain (14) was used as a primer. All the oligonucleotides were synthesized by Oligos Etc, Inc. (Guilford, Conn.). Western Blot Analysis To determine whether the ER protein expressed in cells of transfectant clones had the same molecular weight as that expressed in cells from ER-positive breast cancer lines, we performed a Western blot analysis. Cells from one mutant sense transfectant clone (MLcc2H), two wild-type sense transfectant clones (S24 and S30), one mutant antisense transfectant clone (MLB3B), one wild-type antisense transfectant clone (AS23), one ER-negative breast cancer cell line (MDA-MB-231 CL10A), and two ER-positive breast cancer cell lines (MCF-7 Vol. 84, No. 8, April 15, 1992

Determination of Levels of ER and Progesterone Receptor The levels of ER protein were measured both by ligand-binding and by the enzyme immunoassay methods, and the levels of progesterone receptor (PR) protein were determined by the enzyme immunoassay only. For the ligand-binding method, cells were plated in 24-well plates at a density of 100 000 cells per well in estrogen-free medium for 2 days and then incubated with [3H]E2 (0.039-5 nM) in Hanks' balanced salt solution for 1 hour at 37 °C. A 100-fold excess of cold E2 was used to measure nonspecific binding. Unbound ligand was washed, and the cells were lysed by sonication. The affinity of the ER for [3H]E2 was calculated by eight-point Scatchard analysis. For the enzyme immunoassay, cells were grown to near confluence and harvested by scraping. Cytosols were prepared in buffer containing 1 mM monothioglycerol, 10 mM Tris, 1.5 mM EDTA, 10% glycerol, and 5 mM Na2MoO4 with or without 0.5 mM of the protease inhibitor leupeptin and collected following centrifugation (4 °C) at lOOOOOg for 45 minutes. The levels of ER and PR in the cytosols were measured by using the ER enzyme immunoassay and the PR enzyme immunoassay kits obtained from Abbott Laboratories. Transient Transfection and Chloramphenicol Acetyl Transferase Assays Reporter plasmid pERE15, which consists of an estrogen response element (ERE) derived from the vitellogenin gene and of the thymidine kinase promoter derived from herpes simplex virus linked to the gene for chloramphenicol acetyl transferase (CAT) (vitERE-TK-CAT) (28), was used to determine ER-activated gene regulation. Cells from the ER sense transfectants MLa2H and S30 and the antisense ER transfectants AS23 and MLP3B plated in 10-cm dishes in estrogen-free medium were transiently transfected at 70%-80% confluence with an E2 inducible reporter plasmid (vitERE-TK-CAT) or with a constituARTICLES 583

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

50 ng/mL denatured salmon sperm DNA, 50% formamide, and and MCF-7 clone WS8 [MCF-7CL-WS8]) were grown to ap10% dextran sulfate for at least 2 hours. Membranes were then proximately 90%-95% confluence and scraped. Protein from hybridized for 16-24 hours in the same buffer containing 1- one mutant (ML(i3B) and one wild-type (AS23) antisense trans2x(10 6 ) disintegrations per minute (dpm)/mL of radiolabeled fectant were tested to confirm the absence of ER protein. After probe. The ER probe was an fcoRI-digested 2.1-kb cDNA en- centrifugation (300g, 4 °C, 5 minutes), cells were resuspended coding the complete human ER isolated from pOR8 (14). The and homogenized in buffer containing 10 mA/ Tris (pH 7.5), 1 neo probe was derived from the Hindlll-Sal I fragment of bac- mM EDTA, 0.4 M NaCl, 2 mM dithiothreitol, 0.3 mM phenylterial transposable element Tn5 (27). cDNA probes were 32P- methyl sulfonyl fluoride, 0.3 mM leupeptin, and 0.5% (vol/vol) double nucleotide labeled on both strands of the cDNA by aprotinin. Cytosols were collected after centrifugation at 100 OOOg random primer extension, using nucleotides [32P]deoxycytidine for 1 hour. Total proteins were separated by 10% SDS polytriphosphate and [32P]-deoxyadenosine triphosphate (3000 acrylamide gel electrophoresis using a ratio of acrylamide to bis Ci/mmol) (DuPont/NEN Products, Boston, Mass.) and, there- of 30:0.8 and transferred to nitrocellulose membranes. After fore, were able to detect both sense and antisense mRNA being stained with Ponceau S dye, membranes were blocked transcripts. Membranes were washed three times for 1 hour each overnight in a solution containing 100 mM Tris (pH 7.5), 0.5 M with 2x SSC containing 0.2% sodium dodecyl sulfate (SDS) at NaCl, 0.02% Tween 20, and 5% bovine serum albumin containroom temperature and 10 minutes at 65 °C with 0.lx SSC con- ing 0.02% NaN3. The ER protein was then identified by using taining 0.2% SDS. Autoradiography was performed using one of two monoclonal antibodies, H222 and D547 (Abbott Kodak XAR-5 film, and films were exposed for a period be- Laboratories, North Chicago, 111.), both of which are specific for tween 4 hours and 2 days at -70 °C. the ER protein, and the Vectastain ABC Kit (Vector Laboratories, Burlingame, Calif.). Diaminobenzidine (0.1%) in PCR Amplification and DNA Sequencing a buffer containing 10 mM Tris (pH 7.2), 0.04% NiCl2, and Total RNA, isolated from the cells of the mutant sense trans- 0.02% H2C>2 was used in the coloration step to indicate the fectant MLa2H and the wild-type sense transfectant S30 by the presence of the ER protein.

DNA Assay Cells from the one wild-type sense transfectant (S30), one mutant sense transfectant (MLa2H), and one ER-positive control cell line (MCF-7) were plated in 24-well plates in estrogenfree medium for 2 days. Medium containing the specified compounds or control medium (containing the ethanol solvent only) was then added for the number of days indicated later in the text in Figs. 5 and 6; the medium was changed every other day. Cells were harvested and lysed by sonication. The amount of DNA in each well was measured by incubating samples with Hoechst 33258 dye (Sigma Chemical Co.), and the fluorescent emission of the complex was measured on an SLM-Aminco (Urbana, III.) Fluoro Colorimeter III. Each DNA value represents the mean of triplicate sample wells. The increase in the amount of DNA was directly proportional to the increase in the number of cells per well.

584

bromodeoxyuridine (BrdUrd) (Sigma Chemical Co.). Some of the samples were subjected for 6 or 8 hours to a "cold chase" with 5 mM of unlabeled thymidine (Sigma Chemical Co.). All cells were harvested by trypsinization and fixed in 70% ethanol. Nuclei were prepared by incubating cell suspensions in a solution containing 0.04% pepsin and 0.1 N HCI for 20 minutes at room temperature and then treated with 2 N HCI at 37 °C for 30 minutes (31). Following neutralization with 0.1 M sodium borate, nuclei were stained with anti-BrdUrd monoclonal antibody (1:3.5) (Becton Dickinson, Mountain View, Calif.) in phosphate-buffered saline containing 0.2% Tween 20 and 0.1% bovine serum albumin at room temperature in the dark for 4 hours. Fluorescein-labeled goat anti-mouse antibody (1:50) (Sigma Chemical Co.) in phosphate-buffered saline containing 0.2% Tween 20 and normal goat serum (0.1% vol/vol) was added for 30 minutes at room temperature. Nuclei were then treated with 1 |ig/mL RNase A (Sigma Chemical Co.) and stained with 10 Hg/mL propidium iodide (Sigma Chemical Co.) overnight at 4 °C and analyzed in FACStarplus (fluorescent-activated cell sorter; Becton Dickinson). The nuclei were excited at 488 nm with simultaneous list mode acquisition of both the green fluorescence from fluorescein (515-560 nm) and the red fluorescence from propidium iodide (>620 nm) as measures of incorporated BrdUrd and total DNA content, respectively. For the preparation of nuclei stained with propidium iodide only, cells were cultured in medium containing E2 or ethanol for 5 days and harvested as described above but without BrdUrd and thymidine treatment. Nuclei were prepared as described above, with the exception of anti-BrdUrd and fluoresceinlabeled goat anti-mouse antibody incubation.

Results Characterization of ER-Stable Transfectants Ten transfectant clones were generated by transfection of the ER-negative MDA-MB-231 cells with the sense and antisense vector constructs (Table 1). Five of these clones contained the mutant form of the ER gene, and five contained the wild-type

Table 1. Classification of ER transfectants

Clone MDA-MB-231 CLI0A* MLa2A MLa2C MLa2F MLa2H ML03B

Sense (S) or antisense (AS) orientation of ER cDNA t S S

s s AS S

Wild-type (W) or mutant (M) ER cDiNA J. 1

M M M M M W W W W W

Cell Cycle Analysis

S10 S24 S30 S53 AS23

Cells plated in 15-cm dishes were cultured for 6 days in estrogen-free medium containing E2 or ethanol, and then cells in logarithmic growth were labeled for 20 minutes with 5 \iM of

*MDA-MB-23I CL10A is the ER-negative parental line which was transfected to generate all of the clones used in this study. tNot applicable.

s s s AS

Journal of the National Cancer Institute

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

tive reporter plasmid (pSV2CAT) using the calcium phosphate coprecipitation technique (29). In this assay, expression of CAT functioned as a surrogate for expression of the genes normally activated by the ER-steroid hormone complex. The ability of E2 or the antiestrogen ICI 164,384 to stimulate expression of the CAT reporter gene was detected by the CAT assay. Ten micrograms of the reporter plasmid and five micrograms of a reference plasmid pCMVP were added to each dish. Six hours after transfection, the estrogen-free medium was removed, and cells were treated with 10% glycerol for 3 minutes. Medium containing E2 (Sigma Chemical Co.), ICI 164,384 (ICI Pharmaceuticals, Mereside, Alderley Park, Cheshire, England), or ethanol only (0.1%) was then added for 48 hours. Cells were harvested and lysed by three freeze-thaw cycles in 250 mM Tris-HCI (pH 7.8). Twenty microliters of the extract was assayed for B-galactosidase activity. CAT assays were performed using cell extracts (standardized according to the amount of detectable (3-galactosidase activity) in a total volume of 130 }iL at 37 °C in the presence of 0.05 )iCi of [ l4C]chloramphenicol (50 |iCi/mmol; Amersham Corp.) and 20 jiL of 0.4 mM acetyl coenzyme A (Sigma Chemical Co.). CAT activity was defined as the percent conversion of the nonacetylated [l4Cjchloramphenicol substrate to the 1-acetylated and 3-acetylated [l4C]chloramphenicol products (JO). CAT activity was calculated as follows: {(dpm of 1-acetylated [I4C]CAT + dpm of 3-acetylated [ l4C]CAT)/(sum of dpm for all acetylated and nonacetylated forms of [14C]CAT)| x 100. The magnitude of induction of CAT activity following treatment with E2 or with ICI 164,384 was calculated as follows: % conversion of chloramphenicol to acetylated form in cytosol of treated cells/% conversion of chloramphenicol to acetylated form in cytosol of untreated cells. The acetylated and nonacetylated forms of chloramphenicol were separated by thin-layer chromatography (ratio of chloroform to methanol, 19:1), autoradiographed, and then excised and quantitated by liquid scintillation counting.

ER gene. In each of these groups (mutant and wild-type clones), four were sense transfectants and one was an antisense transfectant. Northern Blot Assay

1 2

3

4

5

6

Kb

7

8

9

10

11

12

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

We detected mRNA coding for ER alone, neo alone, or both ER and neo in cells of all clones transfected with either the sense or the antisense ER constructs (Fig. 2). Four transfectant clones (the wild-type sense clones S10 and S30, the mutant ER sense clone MLoe2C, and the mutant ER antisense clone MLf33B) expressed mRNA for ER and neo on the same transcript, banding at 4.1 kb, as detected by Northern blotting (Fig. 2, lanes 5, 9, and 11). The expected 4.1-kb band (seen in lanes 5, 9, and 11) containing sequences coding for both ER and neo was missing in lanes 3,4, 10, and 12 when probed with neo. Instead, multiple species of mRNA that contained nucleotide sequences hybridizing either with the ER probe or with the neo probe alone or with both probes simultaneously were detected. These transcripts may result from random and/or multiple integrations of plasmid DNA or transcription initiation that occurred within the neo gene. The absence of neo sequences in the higher molecular weight bands of lane 3 may be due to multiple aberrant integrations of the plasmid into chromosomal DNA, one of which coincidentally generated a 4.1-kb ER mRNA. Clearly, MLcc2H cells ex-

pressed both the ER and neo gene products, as demonstrated by the presence of ER protein (see Table 2 for enzyme immunoassay results and the text below for the results of the ligand-binding assay) and by the resistance of these cells to G418. However, the ER and neo gene products in MLa2H cells are probably not derived from the same transcript. The 6.5-kb ER mRNA expressed in MLa2H cells (Fig. 2. lane 3) had a molecular weight similar to that of the authentic ER mRNA from MCF-7 cells. However, the presence of ER was not due to cross-contamination of the transfectant clone MLoc2H with MCF-7 cells. The lack of contamination was confirmed by DNA fingerprint analysis carried out by Cellmark Diagnostics (Germantown, Mass.).2 The possibility of activation of the endogenous ER gene in MLa2H cells after transfection has not been ruled out, but it is unlikely. The ER gene used to transfect MLoc2H cells was derived from cDNA containing a substitution of valine for glycine at the codon corresponding to amino acid residue number 400, and the corresponding transcript was the only transcript detected by PCR analysis. Fig. 1, B, confirms that transfectant S30 did, in fact, contain the wild-type ER sequence with GGG (coding for glycine) at the codon corresponding to residue position 400, instead of GTG (coding for valine). Western Blot Analysis The molecular weight of the ER proteins expressed in both mutant and wild-type sense transfectants was similar to that of the ER protein present in ER-positive breast cancer cell lines (Fig. 3). Monoclonal antibodies H222 (Fig. 3) and D547 (data not shown) each detected a 65-kd protein both in the mutant ER sense transfectant clone MLa2H and in the wild-type sense transfectant clones S30 and S24. The position of the band for this protein was comparable to that of the band detected with protein from ER-positive MCF-7 cells or from the derivative clone MCF-7-CL-WS8.3 No ER band at 65 kd was detected in the ER-negative parent cell line MDA-MB-231 CL10A or in the antisense transfectant clones MLf33B and AS23. Western blot ER results using protein from the mutant ER sense transfectant clone MLa2F were similar to those using protein from MLa2H or MCF-7 cells. Levels of ER and PR

Fig. 2. Expression of the ER and neo mRNA in breast cancer cell lines and ER transfectants. Total RNA (35 |ig)—prepared from MCF-7 (lanes I and 7); MDA-MB-231 CL10A (lanes 2 and 8); mutant ER sense transfectants MLa2H (lane 3), MLa2A (lane 4), and MLa2C (lane 5): mutant ER antisense transfectant MLP3B (lane 6); or wild-type ER sense transfectants S10 (lane 9), S24 (lane 10), and S30 (lane 11); or wild-type ER antisense transfectant AS23 (lane 12)— was hybridized with radiolabeled ER probes (top panel). The ER probes were then removed, and the same membranes were hybridized with labeled neo probes (bottom panel). mRNA encoding ER and neo (either on the same or on separate transcripts) was detected in all transfectant clones, both sense and antisense. MCF-7 cells expressed mRNA coding for ER but not mRNA coding for neo. Neither mRNA coding for ER nor mRNA coding for neo could be detected in MDA-MB-231 CL10A cells.

Vol. 84, No. 8, April 15, 1992

An ER enzyme immunoassay was used to determine the level of ER in the clones of sense transfectants. Wild-type ER sense transfectants S10, S24, S30, and S53 expressed 557, 662, 441, and 385 fmol/mg of cytosol protein, respectively. These levels were similar to the level of ER observed in MCF-7 cells deprived of estrogen for 7 days (Table 2). However, low values for ER were observed in the mutant ER sense transfectants.

The restriction fragment length polymorphism analysis of chromosomal DNA from transfectant MLa2H, detected by using multiple locus probes for the human chromosome, was the same as that of DNA from MDA-MB-231 CL10A cells but was different from that of chromosomal DNA from MCF-7 cells. 3 An ER-positive clone with the same hormonal responsiveness as the parental MCF-7 line was used as a positive control, since it is known to express a 65-kd ER protein.

ARTICLES

585

MCF-7 CLWS8

AS23

KD

S30

S24

ML(53B

MDA-MB-231 CL10A

MLa2H

MCF-7

Table 2. Effects of E2 on ER and PR expression determined by enzyme immunoassay*

KD

Cells

Treatment

MCF-7t

Control E2, 10-'°M E2, IO"8W

532.6 + 91.1 58.0 ±4.4 60.0 ±5.8

MLa2HJ

Control Ei, IO~8M

24.3 ± 2.9 28.2 ±2.5

1.0 ±0.8 30.8 ± 10.3

MLP3BJ

Control E2, lO^M

0 0

0.2 ± 0.2 0.5 ± 0.5

S30§

Control E2 l

29

These clones, MLa2A, MLa2C, MLa2F, and MLa2H, expressed 20, 13, 11, and 41 fmol/mg of cytosol protein, respectively. No significant amount of ER was detected in either the mutant (ML(33B) or the wild-type (AS23) antisense transfectant clones (Table 2). For the mutant sense clones, the consistently low values for ER determined in the ER enzyme immunoassay contrasted with the results obtained using the ligand-binding (i.e., [3H)E2 wholecell uptake) assay. Wild-type ER sense transfectant S30 and mutant ER sense transfectant MLoc2H expressed 437 and 458 fmol/mg of protein, respectively, in the ligand-binding assay. However, the ER in the cells of the mutant clone MLoc2H had approximately a ninefold lower binding affinity for [3H|E2 (dissociation constant [Kd] = 1.8 nM) than the ER in the cells of the wild-type ER transfectant S30 (Kd = 0.2 nM), as determined by Scatchard analysis at 37 °C (data not shown). Since the monoclonal antibodies used in the Western blot assay (Fig. 3) can readily detect either the denatured wild-type ER or the denatured mutant ER, it appears that the conformation of the undenatured mutant receptor may mask an epitope that binds to either monoclonal antibody, thereby causing an underestimation of the ER level in the ER enzyme immunoassay. This aspect of the study is being investigated further and will be the subject of a subsequent report. Functional ER Expression Determined by Transient Transfection With a Reporter Gene for ER Linked to Gene Encoding CAT The ER expressed in the stable transfectant clones derived from MDA-MB-231 CL10A cells appeared to be functional, i.e., to possess gene-regulatory activity. E2 activated the expression of the CAT gene linked to a vitellogenin ERE in a con-

SS6

4.8 ± 1.0 171.1 ±3.4 216.8 ±3.3

*Detailed experimental procedures were described in the "Materials and Methods" section. Experiments were carried out in duplicate wells, and results were pooled for two independent experiments. tCells were deprived of estrogen for 2 days prior to the addition of E2 for 5 days. iCells were cultured in medium containing E2 for 13 days. SCells were cultured in medium containing E2 for 5 days.

centration-related manner in both MLa2H and S30 cells, and activation was inhibited by the pure antiestrogen ICI 164,384 (Fig. 4). CAT activity was visualized by the conversion of [l4C]chloramphenicol (arrow I, Fig. 4, A, B, and C) into I- or 3monoacetylated [l4C|chloramphenicol (arrows II and III, Fig. 4, A, B, and C). In S30 cells, E2 induced CAT expression at a concentration of 10"" M or greater to a maximum level of 12-fold higher than the control (Fig. 4, A). In MLa2H cells, however, E2 could not induce CAT expression at a concentration of 10"'' M, had weak (twofold) stimulatory activity at a concentration of 10"'° M, and stimulated CAT activity to a maximum of 21-fold over control at a concentration of 10"9 M or greater (Fig. 4, B). Therefore, the mutant ER in MLa2H cells was approximately 50-100 times less sensitive to E2 (in terms of stimulation of CAT expression) than was the wild-type ER in S30 cells. Also, higher basal levels of CAT expression were observed in S30 cells than in MLa2H cells when cells were cultured in control medium. Similar results were also observed in HeLa cells transiently transfected with the wild-type or mutant ER expression vectors (24). Since the level of induction of CAT activity in the cytosol from S30 cells treated with ICI 164,384 (10~7 M) was the same as that in cells treated with control medium (Fig. 4, A), higher basal levels of CAT activity in S30 cells were not due to residual estrogen in the medium. No stimulation of CAT expression by E2 was observed in the antisense transfectants AS23 and MLfJ3B transfected with the same reporter plasmid or in sense transfectants transfected with a constitutive reporter plasmid, pSV2CAT. Similar results, with the exception of weaker estrogenic induction, were observed using pS2CAT which contains an imperfect ERE and a promoter derived from the estrogen-inducible gene pS2 (32) (data not shown). Journal of the National Cancer Institute

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

Fig. 3. Western blot analysis of total protein isolated from ER sense transfectants MLa2H, S24, and S30; ER antisense transfectants ML|33B and AS23; ERnegative breast cancer cells MDA-MB-231 CLIOA; and ER-positive breast cancer cells MCF-7 and MCF-7 CL-WS8. Cytosols containing 100 fig of protein were analyzed using monoclonal antibody H222 after resolution by 10% SDSpolyacrylamide gel electrophoresis. Molecular weight markers are included on right, and the specific ER band is indicated by the arrow. ER with the same molecular mass (65 kd) as ER from the ER-positive control cells (MCF-7 and MCF-7 CL-WS8) was expressed in the three sense transfectants. No ER protein was detected in the antisense transfectants or in the ER-negative control cells. The same result was observed using monoclonal antibody D547, but these data are not shown.

Levels of receptors, fmol/mg protein, means + SE ER PR

vitERE-TK-CAT

AS23

S30

ICI 164,384

_ n

—

o

CM

—

o

O

o

o

en

00

O

o

o

o

o

o

o

ID

O

O

—

1

1

2

9

7

B

9

9

10

12

1

2

1

#

1

1

MLa2H

1

MLP3B

vitERE-TK-CAT

SV2CAT

n

cp

ICI 164,384

•

o

vitERE-TK-CAT

to

to

u>

o

b

o

o CO

E2

Fold induction over control

b

1

1

1

1

2

17

17

18

21

16

1

3

1 1

1

1

1

*~

-

1

»

1

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

• Fold induction over control

Fig. 4. CAT assay for functional ER in two wild-type and two mutant transfectants. The wild-type ER sense (S30) and antisense (AS23) transfectants and the mutant ER sense (MLa2H) and antisense (ML(33B) transfectants were transiently transfected with a reporter plasmid containing an ERE linked to the gene for CAT (vitERE-TK-CAT) or a constitutive reporter plasmid pSV2CAT. Cells were subsequently cultured (at the concentrations noted) in estrogen-free medium containing E, and/or the antiestrogen ICI 164, 384 (at the concentrations noted) or in control medium for 48 hours and harvested. The (3-galactosidase expression plasmid pCMVj} was added to the transfection dishes along with the reporter plasmid to determine the efficiency of transfection. Cytosol extracts containing equal amounts of p-galactosidase activity (0.9 units for wild-type ER transfectants [A| or 1.5 units for mutant ER transfectants |B]) were used; i.e., the amount of extract was standardized according to the efficiency of transfection. The substrate, nonacetylated [l4Clchloramphenicol. is indicated by arrow I, while the products of the enzyme reaction, 1- and 3- acetylated [l4C]chloramphenicol, are indicated by arrows II and III, respectively. The acetylated and nonacetylated forms of |MC]chloramphenicol were excised and quantitated by Pscintillation counting. Fig. 4, C, indicates the substrate and the two products of the CAT assay.

HCNHCOCHCI2 Acetyl coenzyme A

HOCH I HCNHCOCHCI, CHjOH

Chloramphenicol acetyl translerase

CH2O(CH,CO) 3-Acetylated chloramphenicol NO 2

Chloramphemcol CHCHCHjCO) HCNHCOCHCIj CH,OH 1 Acetylated chloramphenicol

Vol. 84, No. 8, April 15, 1992

ARTICLES

587

Effects of E2 on ER and PR Synthesis in Transfectants

Effects of E2 on Cell Growth and Cell Cycle Distribution E2 (10"'° M) stimulated the growth of MCF-7 breast cancer cells in culture (Fig. 5, A). In contrast, cell growth (DNA replication) in two ER sense transfectants, one wild-type (S30) and one mutant (MLa2H), was inhibited by E2 (Fig. 5, B and C). E2 prolonged the cell doubling time about 2.5-fold in transfectants. A parallel experiment demonstrated that E2 had similar effectiveness in inhibiting the growth of S30 and MLoc2H cells (Fig. 5, D). However, the mutant ER transfectant MLa2H was about 100-fold less sensitive to E2. E2 at a concentration of 10"'" M had no effect on the growth of MLa2H cells. However, the growth of S30 cells was maximally inhibited by the same treatment. Cell growth (DNA replication) in the mutant ER transfectant MLa2F and in the wild-type ER transfectants S10, S24, and S53 was also inhibited by E2 (data not shown). The antisense transfectants (both wild-type and mutant) and the parent clone MDA-MB-231 CL10A were unaffected by E2 (data not shown.) The effect of E2 on cell growth was further analyzed by its influence on phase distribution in the cell cycle. E2 increased the portion of MCF-7 cells in the S phase (Table 3). In contrast, E2 decreased the percentage of cells in the S phase and increased the percentage of cells in the G|/Go phase in both the wild-type S30 and the mutant sense MLa2H transfectants. The influence of E2 on cell kinetic parameters in sense transfectants was further analyzed by pulse-labeling with BrdUrd, followed by a cold chase with unlabeled thymidine for 6 or 8 hours. The effects of E2 on cell cycle progression were analyzed by the influence of E2 on the parameters described in Table 4. E2 prolonged potential cell doubling time by 27%-48%, decreased the labeling index by 29%-33%, and increased cell loss by about twofold to fivefold. However, E2 had no effect on the time required for DNA synthesis in both S30 and MLa2H cells. The cell phase distribution and the kinetic parameters of the cell cycle from an588

Antiestrogen Action on Cell Growth The antiestrogen ICI 164,384 inhibited E2-stimulated growth of MCF-7 breast cancer cells in a concentration-related manner (36). Similarly, ICI 164,384 blocked the inhibitory effect of E2 on the growth rate of transfectants in a concentration-related manner (Fig. 6). ICI 164,384 (10~7 M) completely blocked the inhibitory effect of E2 (10"'° M) in the wild-type ER transfectant S30. Since higher concentrations of E2 (3 x \0~9 M or 10~8 M) were used for the competition experiment in the mutant ER transfectant MLa2H, ICI 164,384 (10~6 M) only partially reversed the E2 effect on cell growth. The antiestrogen alone did not affect the growth rate of either sense transfectant up to a concentration of 10 \xM (data not shown).

Discussion We have stably transfected ER-negative breast cancer cells with cDNAs for the ER. Our studies demonstrate not only that functional ER is expressed but also that cell growth can be regulated by E2 and the antiestrogen ICI 164,384. However, our goal was not to demonstrate whether or not functional ER can be produced artificially in a eukaryotic system; this has previously been achieved (15-17). Rather, we wished to establish whether or not ER could reassert control over replication in a hormonally unresponsive breast cancer cell line. Paradoxically, E2 increases cell doubling time, whereas a pure antiestrogen alone has no effect, although it blocks the action of E2. This effect of E2 on ERnegative transfectants is the reverse of the traditional effect of E2 on ER-positive cells. Although this is the first report of the successful transfection of breast cancer cells, a similar phenomenon has been observed in other cells transfected with ER—e.g., Chinese hamster ovary (18), HeLa (19.21), and osteosarcoma (20) cells. Kushner and coworkers (18) demonstrated that the overexpression of ER resulted in cell death during estrogen treatment. Clones of cells that survived estrogen treatment did not express ER. In contrast, we and others (19-21) chose an alternate strategy to produce ER expression at physiological levels. We likewise observed that estrogen inhibited the cell growth of ER transfectants. However, we did not observe massive cell death following E2 treatment. A cytostatic effect of estrogen on cell growth was proposed in HeLa cells transfected with ER (19). From cell cycle studies, we found that E2 had no effect on the time required for DNA synthesis in cells committed to enter the cell cycle. Higher proportions of cells distributed in the Go/G| phase and longer potential cell doubling times in sense transfectants treated with E2 suggest that E2 inhibits cell growth in part by interfering with entry into the cell cycle. However. E2 increases potential cell doubling time only by 27%-48%, which is insufficient to explain the total increase in population doubling time. An increase in cell loss may also be in pan responsible for E2inhibited growth. In addition, we have recently observed that ER in two sense transfectants (MLa2H and S30) is functionally active in regulating the expression of growth factors and/or their respective receptors. The possible link between changes in the Journal of the National Cancer Institute

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

When bound to E2, the ER in the stable transfectants was active in inducing PR expression (Table 2). However, the extent of PR induction in both S30 and MLa2H cells was threefold to sevenfold lower than that in MCF-7 cells. In MLcc2H cells, E2 at a concentration of 10~8 M after 13 days of exposure stimulated PR expression only to 31 fmol/mg protein. In S30 cells, E2 at concentrations of 10"'° M and 1CT8 M increased PR expression after 5 days of treatment to 70 and 90 fmol/mg protein, respectively. Only marginal induction of PR (10-14 fmol/mg protein) was observed in both transfectants following culture in E2-containing medium for 2 days (data not shown). Estrogen decreases the expression of ER in MCF-7 cells (33). The levels of ER in S30 cells treated with E2 at concentrations of 10"'° M and 10~8 M were decreased to a much lower extent than ER levels in MCF-7 cells treated with similar concentrations of E2. Since ER expression in transfectants was controlled by a constitutive promoter, decreased ER levels in S30 cells treated with E2 may be due to incomplete extraction of ER protein by salt or to post-transcriptional regulation, as observed in MCF-7 cells (33) and HeLa cells stably expressing constitutive ER (19). No ER or PR expression was observed in antisense transfectants.

tisense transfectant cells or MDA-MB-231 CL10A cells were unaffected by E2.

A

B 20

40

-o- control 1

E2io- °M 30

•

"3 ONA

M

10

C>

4

2

6

I

8 days

UJ

12

1 o>

8

z Q

.

I

.

10

I

.

12

IT ^g

4

0 1'\

()

2

4

6

c ID

2

E2 10-6M

•

-

15

14

ft

rr

+

1 DNA

10

•

/

,

12

14

12

1 1

10

T J .

.

-Q- S30 control -4-S30 E2 ~£r MLo2H control .-A- MLa2H E2

Q

8

5

y /

a0

ill +/- SEM)

UJ

10

D

-0- control -k- E 1(H»M

20

8

days

Fig. 5. Effect of E, on the growth of MCF-7 cells and of ER sense transfectant cells. Transfectant clones were maintained in estrogen-free medium. A: Effects of E, on the growth of MCF7 cells. Cells were plated at a density of 200 000 cells per well for 2 days. B: Effects of two different concentrations of E, on the growth of the wild-type ER transfectant S30. C: Effects of two different concentrations of E, on the growth of mutant ER transfectant MLa2H. For panels B and C, cells were plated at a density of 30 000 cells per well and cultured for the number of days indicated on the horizontal axis. D: Effects of varying concentrations of E, on the growth of S30 and MLa2H cells. Cells from both clones were plated at the same density of 50 000 cells per well and cultured either in medium containing the indicated concentration of E, or in control medium for 6 days.

•

0

2

i

•

4

i

6

•

i

8

i

•

10

i

12

days

expression of growth factors and the suppression of cell growth by E2 in ER transfectants is under investigation. As predicted from previous biochemical studies (24,37) the wild-type receptor increases the potency of action of E2. This effect occurred in both gene regulation (seen in the CAT assay) and cell replication (seen in the DNA assay). The decreased sensitivity to E2 in the mutant ER may be attributed to decreases in both the affinity of ER for E2, as observed in our study and by Tora et al. (24), and a change in the characteristics of ER binding to the ERE (57). We were not surprised to measure low levels of PR during the incubation of transfectants with E2. Although E2 is believed to regulate PR induction through ER, we have recently observed Vol. 84, No. 8, April 15, 1992

"

-12

-10

-8

-6

-4

log cone. (M)

that subclones of MCF-7 which are ER positive produce low levels of PR in response to E2 (Jiang SY, Jordan VC: unpublished data). Similarly, ER- and PR-negative clones of T47D cells that are maintained in an estrogen-free environment can resynthesize ER after several weeks of culture in whole ^ - c o n taining) serum but remain PR-negative until several weeks later (Pink JJ, Jordan VC: unpublished data). Furthermore, PR is not induced by estrogen in HeLa cells and osteosarcoma cells stably expressing ER (19,20). Clearly, a process of unmasking or reeducation is necessary to activate the ERE for the PR. The goal of our research program is not only to consolidate an approach to control hormonally responsive breast tumors with antihormones (//) but also to develop a new strategy to control ARTICLES 589

Downloaded from http://jnci.oxfordjournals.org/ at University of Aberdeen on April 24, 2014

^ T * V ~ T V

0

-/^VS

16

I

(A

20

- 0 - control

&

Table 4. Effects of E2 on cell cycle kinetics in ER transfectants*

Table 3. Effects of E2 on cell cycle phase distribution of MCF-7 cells, MDA-MB-231 CL10A cells, and ER transfectants* % of cells in cell cycle phase G2/M S G1/G0

Cell

Treatment

Td. days

MLo2H

Control E2. lO^/W E2. 10"*W

1.3 + 0.3 2.8±0.4 3.5 ±0.2

MLf33B

Control E2. lO"8*? E2. 10"6/W

Mean 1 SE Ts, h Tpot, days

%LI

0

Treatment

MCF-7

Control E2. IO"8M E2. 10"* M

76.4 44.0 60.3

8.8 43.4 23.7

14.8 12.6 16.0

MDA-MB-231 CL10A

Control E2. 10 M

44.3 43.8

38.0 36.9

17.7 19.3

MLoc2H

Control E2. I0"8/W E">, 10 M

39.9 54.3 52.6

36.9 20.9 24.8

22.9 23.8 19.0

S30

MLP3B

Control E2, 10"8/W ET, 10 M

37.6 36.9 34.6

39.4 37.3 39.9

20.3 22.5 22.2

AS23

S30

Control E2. 10" M E2, 10"8/W

41.0 59.0 54.7

37.8 22.4 24.9

23.3 18.5 18.2

AS23

Control E2, 10"8/W

32.8 31.6

33.8 30.0

34.8 39.3

*Cells were cultured in E2-containing or control medium for 6 days and then labeled with BrdUrd for 20 min. Cells were harvested following a cold chase with unlabeled thymidine for 6 hr (MLa2H and ML(33B) or 8 hr (S30 and AS23). Nuclei were prepared, stained, and analyzed for total DNA and incorporated BrdUrd as described in the "Materials and Methods" section. The fraction of continuously proliferating BrdUrd-labeled versus nonproliferating BrdUrd-labeled cells and the mean of propidium iodide fluorescence intensity from cells in Gi or G2 phase and from proliferating BrdUrd-labeled cells were gated and analyzed using the LYSYS program. The calculation of potential cell doubling time (Tpol). percentage labeling index (%LI), cell loss factor (0), and period of DNA synthesis (Ts) was as described by Begg et al. (34). Population doubling time (Td) was calculated by the method of least squares. The approximate SE was calculated by linearization (35).

*Cells were cultured in E2-containing or control medium for 5 or 6 days and then labeled with BrdUrd (MLa2H, MLp3B. S30. and AS23) or without BrdUrd (MCF-7 and MDA-MB-231 CL10A). Cells were harvested and fixed. Nuclei were prepared, stained, and analyzed for incorporated BrdUrd and total DNA. The fractions of nuclei in the G0/G1, S, and G2 phases were analyzed by the COTFIT program (Becton Dickinson) in nuclei stained with propidium iodide only and analyzed by the LYSYS program (Becton Dickinson) in BrdUrd and propidium iodine double-stained nuclei.

S30 16

16

+ E2 - ^ - E 2 10-10 M + ICI 164,384

-#-E2 -D-E 2

A,

12

1

1

VV //

10

8

ri

14

-i

/V V control

/

n

I

+/- SEM

u g/well +/- SEM) Q

H

1 1 1

.15 .54 .46

42.8 25.3 30.3

0.12 0.45 0.58

8.1 10.3 9.0

.24 .47 .48

20.3 22.0 18.9

0.23 0.14 0.18

13.6 14.1 12.9

.04 .54 .42

42.9 28.6 28.6

0.26 0.50 0.62

13.7 13.7

.09 .07

42.2 43.1

0.39 0.41

MLo2H

- £ - IC1164,384

14

1.610.1 1.7 + 0.1 1.8 + 0.1 Control 1.41 0.1 E2. 10"'° M 3.110.3 3.710.2 E2. 10"8/W Control 1.8 + 0.1 E2. I0~8/W 1.810.1

14.6 12.3 13.8

1