The FASEB Journal • Research Communication

Glutathione prevents preterm parturition and fetal death by targeting macrophage-induced reactive oxygen species production in the myometrium Tarik Hadi,*,† Marc Bardou,*,†,‡,§ Guillaume Mace,‡,{ Pierre Sicard,k,# Maeva Wendremaire,*,†,‡ Marina Barrichon,*,† Sarah Richaud,*,† Oleg Demidov,*,† Paul Sagot,‡,{ Carmen Garrido,*,†** and Fr´ed´eric Lirussi*,†,‡,§,1 *Institut National de la Sant´e et de la Recherche M´edicale, U866, Lipides Nutrition Cancer, Dijon, France; †Universit´e de Bourgogne, Dijon, France; ‡Centre Hospitalier Universitaire de Dijon, Dijon, France; §Institut National de la Sant´e et de la Recherche M´edicale Centre d’Investigations Cliniques 1432, Dijon, France; {Service de Gyn´ecologie & Obst´etrique, Dijon, France; kInstitut National de la Sant´e et de la Recherche M´edicale, Unit´e Mixte de Recherche 1048, Institute of Metabolic and Cardiovascular Diseases, Toulouse, France; #Universit´e Paul Sabatier, Centre Hospitalier Universitaire of Toulouse, Claudius Regaud Institute, Toulouse, France; and **Anti-cancer Center George-François Leclerc, Centre Georges François Leclerc, Dijon, France Preterm birth is an inflammatory process resulting from the massive infiltration of innate immune cells and the production of proinflammatory cytokines in the myometrium. However, proinflammatory cytokines, which induce labor in vivo, fail to induce labor-associated features in human myometrial cells (MCs). We thus aimed to investigate if reactive oxygen species (ROS) production could be the missing step between immune cell activation and MC response. Indeed, we found that ROS production is increased in the human preterm laboring myometrium (27% ROS producing cells, respectively, versus 2% in nonlaboring controls), with 90% ROS production in macrophages. Using LPS-stimulated myometrial samples and cell coculture experiments, we demonstrated that ROS production is required for labor onset. Furthermore, we showed that ROS are required first in the NADPH oxidase (NADPHox)-2/NF-kB-dependent macrophage response to inflammatory stimuli but, more importantly, to trigger macrophage-induced MCs transactivation. Remarkably, in a murine model of LPS-induced preterm labor (inducing delivery within 17 hours, with no pup survival), cotreatment with glutathione delayed labor onset up to 94 hours and prevented in utero fetal distress, allowing 46% pups to survive. These results suggest that targeting ROS production with the macrophage-permeable antioxidant glutathione could constitute a promising strategy to prevent preterm birth.— Hadi, T., Bardou, M., Mace, G., Sicard, P., Wendremaire, M., Barrichon, M., Richaud, S., Demidov, O., Sagot, P., Garrido, C., Lirussi, F. Glutathione

ABSTRACT

Abbreviations: CA, chorioamnionitis; CD, cluster of differentiation; Cox-2, cyclooxygenase-2; DAF, 4-amino-5-methylamino29,79-difluorofluorescein; DHE, dihydroethidium; GSH, reduced glutathione; HIF, hypoxia inducible factor; MC, myometrial cell; MMP, matrix metalloproteinase; NAC, N-acetylcysteine; NADPHox, NADPH oxidase; NP, normal pregnancy; OCT, optimal cutting temperature; ROS, reactive oxygen species; SMC, smooth muscle cell; SOD, superoxide dismutase

0892-6638/15/0029-2653 © FASEB

prevents preterm parturition and fetal death by targeting macrophage-induced reactive oxygen species production in the myometrium. FASEB J. 29, 2653–2666 (2015). www.fasebj.org Key Words: inflammation • preterm labor • antioxidant chorioamnionitis

•

PRETERM BIRTH IS A MAJOR CAUSE of perinatal morbidity and mortality (1, 2). Physiologic stimuli leading to the initiation of parturition are not fully elucidated, but inflammation has been identified as a key regulator of both term and preterm labor onset (3, 4). If many cases of spontaneous preterm labor are unexplained, a significant proportion is linked to genital tract infection or chorioamnionitis (CA). Moreover, labor is associated with a major infiltration of leukocytes (5) and a massive production of proinflammatory cytokines (6) within the myometrium. Thus, if patent signs of inflammation are found in the uteroplacental sphere during labor (7), the physiopathologic mechanisms of inflammation-induced labor onset remains to be elucidated. Uterine preparation for labor involves a switch from a quiescent profile to a contractile profile (8, 9), and it is widely accepted that these changes are associated with the modulation of the expression profile of myometrial smooth muscle cells (SMCs), with the down-regulation of proliferation-activating proteins and collagen expression (10), and the overexpression of inflammatory cytokines (IL-1b, IL-6, and TNF-a) (3, 6), apoptosis proteins (caspase-3, Bax) (11, 12), extracellular matrix remodeling proteins [matrix metalloproteinase (MMP) 2 and MMP9] 1

Correspondence: CRI U866 & INSERM CIC 1432, CHU de Dijon, Facult´e de M´edecine, 7, Bd Jeanne d’Arc, BP 87900, 21079 DIJON Cedex, France. E-mail: [email protected] doi: 10.1096/fj.14-266783 This article includes supplemental data. Please visit http:// www.fasebj.org to obtain this information.

2653

(13) and leukocyte recruitment mediators (monocyte chemotactic protein, VEGF) (5, 14). Cytokines are thought to play a major role in labor induction by inducing cyclooxygenase-2 (Cox-2) expression and subsequent prostaglandin synthesis, leading to myometrial contractions (6, 15). Because cytokines also regulate labor-associated mechanisms, such as apoptosis, extracellular matrix remodeling, and angiogenesis, they are thought to play a major role in labor induction (3). Indeed, injecting IL-1b into pregnant nonhuman primates induces parturition within 48 hours (16). However, in vitro studies failed to demonstrate a role for IL-1b on myometrial SMC activation, because among IL-1b-induced genes in MCs, the only labor-associated marker induced is Cox-2 (17). Inflammation has been repeatedly described to be closely associated with oxidative stress (18–20). Oxidative stress is a biochemical condition in which there is an imbalance between high levels of production of ROS, principally superoxide anion (O2•2) reactive nitrogen species triggered by nitric oxide (•NO), and the antioxidant defenses system, implicating vitamins, catalases, superoxide dismutase (SOD), and glutathione (21). The excessive production of highly reactive ROS, which is not counterbalanced sufficiently by antioxidant defenses, leads to a pro-oxidant status in the cell that affects many biologic processes. The deleterious effects of ROS mainly originate from the superoxide anion produced by NADPHox. Indeed, O2•2 dimutation leads to hydrogen peroxide (H2O2) formation that crosses biologic membranes. Further, the reaction of O2•2 with H2O2 in the presence of transition metals can lead to the formation of the highly cytotoxic hydroxyl radical (OH•), responsible for cell structure and components damages (22, 23). Finally, O2•2 reaction with an excess of •NO can lead to the production of peroxynitrite, a cytotoxic oxidant species, and subsequent nitrosative stress. Oxidative stress is involved in both the onset and amplification of many inflammatory diseases (20) as ROS production can be initiated by pathogens as well as cytokines (24) and as ROS in turn are able to induce cytokine expression (25, 26). Moreover, evidence has pointed to a role for ROS in cell signaling, including the regulation of cell survival and apoptosis (27), as well as matrix remodeling (28, 29). As oxidative stress is involved in the regulation of many of the processes required for labor onset, and because it is closely related to the inflammatory response, we aimed to characterize ROS production in myometrial inflammation and its role in the induction of labor. MATERIALS AND METHODS Myometrial biopsies Myometrial biopsies were obtained from women during pregnancy in 2 different clinical situations: 1) 4 women undergoing elective caesarean section with established CA; 2) 16 women undergoing elective caesarean section for other reasons (cephalopelvic disproportion) in the absence of CA [normal pregnancy (NP)]. All caesarean sections were performed prior to the onset of labor at a gestation period between 38 and 40 weeks of pregnancy. Clinical CA was defined as previously described (11) and was confirmed, in all cases included in the present study, by either a positive culture of the placenta or a histologic assessment of the

2654

Vol. 29

June 2015

placenta by a single pathologist using validated criteria (30) (see Supplemental Fig. 1 for clinical characteristics). This study was approved by the Commit´e de Protection des Personnes Grand Est (no. CPP: 2010/02) and the Agence Française de S´ecurit´e Sanitaire des Produits de Sant´e (2009-A01176-51), and written informed consent was obtained from all donors. Biopsies were cut into small strips, placed in a 24-well plate containing DMEM, and incubated 48 hours at 37°C, 5% CO2 to allow cytokine levels to return to basal values. Myometrial strips were then incubated with LPS (10 mg/ml) for different times (3, 8, 24, 48 hours) or H2O2 (1023 to 1026 M, 48 hours). The stimulations were performed in the presence or absence of curcumin or apocynin (100 mM), added 1 hour before stimulation, to inhibit NF-kB or NOX, respectively. At the end of the stimulation period, the supernatant samples and tissues were quickly frozen in liquid nitrogen and stored at 280°C. Cell culture MC lines were established from human myometrial biopsies as previously described (31), and cultured in DMEM 10% FBS, 100 UI/ml PSA, 37°C 5% CO2. Frozen Thp-1 immortalized cell lines purchased from American Type Culture Collection (Manassas, VA, USA) were cultured according to the manufacturer’s instructions in RPMI 10% FBS, 100 UI/ml PSA, 37°C 5% CO2 and differentiated into macrophages by culturing cells 18 hours in RPMI 10%FBS, 1026 M phorbol ester 12-Otetradecanoylphorbol 13-acetate. For cocultures, MCs were cultured in 6-well plates for Western blotting analysis and 24-well plates for immunofluorescence (106 and 2.105 cells per well, respectively). After 24 hours, the medium was removed and differentiated macrophages were added, in OPTI-MEM (2.105 and 4.104 cells, respectively). In vivo model Timed-pregnant C57BL/6 mice were used for in vivo experiments using a validated preterm labor induction model (32, 33). Female mice were mated with males for 24 hours and gestational age was determined by vaginal plug observation. At day 15, mice were injected with LPS (25 mg/mouse i.p.) 6 reduced glutathione (GSH; 2.5 mmol/kg in PBS, adapted from Anderson et al.) (34), or equivalent volume (200 ml) of sterile PBS. Following injections, mice showed no signs of serious diseases. A first group of mice was killed 12 hours following injection (prior to delivery). Myometrial, placental, and fetal samples were then collected, and kept frozen at 280°C before Western blotting analysis, or directly included in optimal cutting temperature (OCT) for histologic examination. A second group of mice was followed continuously until the time of first pup delivery. Mice from the LPS + glutathione group received additional glutathione injections (2.5 mmol/kg, twice a day), and mice from the other groups received 200 ml of sterile PBS. A pup was described as living if surviving at least 24 hours after birth. Mice used in our experiments were approved by protocol N3613 ethical comity of University of Burgundy. NADPHox activity Myometrial explants crushed into 150 ml Krebs Henseleit solution (NaCl 2.36 M, NaHCO3 625 mM, KH2PO4 240 mM, MgSO4 241 mM, KCl 939 mM, CaCl2 2 mM, glucose 5.5 mM, pH7.4). Krebs Henseleit (795 ml), Hepes (10 ml), lucigenin (5 ml; 100 mM) 6 100 ml NADPH, H+ (30 mM) were then added to the homogenates. The luminescence induced by the reaction of superoxide anion with lucigenin was measured in a photomultiplier measuring between 390 and 620 nm.

The FASEB Journal x www.fasebj.org

HADI ET AL.

Western blotting Western blotting was performed as previously described for myometrial explants (11) and cells (31). The membranes were incubated for 90 minutes at room temperature with the primary antibodies, purchased from Santa Cruz Biotechnology,Santa Cruz, CA, USA (SC-11407, SC-50508, SC-5827, SC-30141, SC-20781, SC651, SC-52012, SC-376861, SC-152, SC-372, SC-33020, SC-10790 and SC-25778), Calbiochem, San Diego, CA, USA (CA-4001 and VIIC2), and Cell Signaling Technology, Danvers, MA, USA (#9661). Primary antibodies were detected using horseradish peroxidasecoupled secondary antibodies (SC-2357, SC-2020, and SC-2314; Santa Cruz Biotechnology) for 1 hour at room temperature.

4°C). Cells were fixed for 5 minutes in a PBS 4% paraformaldehyde solution and analyzed using an LSR2 flow cytometer (Becton Dickinson, BD, San Diego, CA, USA). Primary Size-Granularity dot plot allowed to discriminate cells from debris, and DHE-positive cells were obtained by comparing red fluorescence versus unstained samples. Statistical analysis Differences among groups were determined by ANOVA followed by Bonferroni’s multiple comparison test, using SigmaStat version 3 (GraphPad Software, La Jolla, CA, USA). All differences were considered significant when P , 0.05.

RT-PCR

RESULTS Myometrial biopsies were crushed in liquid nitrogen and lysed in 1 ml Trizol solution (Invitrogen, Carlsbad, CA, USA), mRNA were purified using the phenol/chloroform method. mRNA (100 ng) were subjected to reverse transcription using the cDNA synthesis kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Transcript levels in the cDNA were then determined by semiquantitative PCR using the Taq Polymerase Recombinant kit (Invitrogen), after 40 cycles at TM = 61°C using the specific primers: NOX1: forward: TTCTTGGCTAAATCCCATCCA, reverse: TTTCTGTCCAGTCCCCTGCT, NOX2 forward ATAAGCAGGAGTTTCAAGAT, reverse: TTTCCTCATGGAAGAGACAAG, NOX4: forward TGGCTGCCCATCTGGTGAATG, reverse: CAGCAGCCCTCCTGAAACATGC, NOX5: forward TCCAAGGTCACTCATCTCCTC, reverse: CAGGCCAATGGCCTTCATGT, and iNOS: forward GGGCCTCAAGGAAAAGAATC, reverse: TTCTGCTTGAGAGGTGCTGA. Transcripts were separated in 2% agarose gel, and pictures were obtained in a Geldoc transilluminator using Photomat software (Microvision Instrument, Evry, France). Immunohistochemistry Myometrial strips were embedded in OCT, cut into 5 mm thick sections, and fixed in cold PBS 2% paraformaldehyde solution (4°C, 5 minutes). Cells were seeded on sterile 13 mm diameter microscope coverslips. After stimulation, the cells were fixed in cold PBS 2% paraformaldehyde solution (4°C, 5 minutes). In cells, the samples were cultured for 30 minutes, 37°C, 5%CO2, in a PBS solution containing 10 mM dihydroethidium (DHE) or 4-amino5-methylamino-29,79-difluorofluorescein (DAF). In tissue, DHE and DAF were added on slides after fixation, and incubated 10 minutes at room temperature. Samples were blocked/permeabilized in PBS, 1% bovine serum albumin, and 0.1% saponin (10 minutes, room temperature), and incubated overnight at 4°C with the primary anticluster of differentiation (CD) 115 antibody (ab32633; Abcam, Cambridge, MA, USA), or anti-pNF-kB (SC-33020; 1/200 dilution in the blocking solution; Santa Cruz Biotechnology). Primary antibodies were detected using Alexa Fluor 488- or Alexa Fluor 647-coupled secondary antibodies (1/500 dilution in the blocking solution; Invitrogen), 30 minutes at room temperature. Nuclear labeling was performed by incubating samples in DAPI (1 ng/ml in PBS, 30 seconds at room temperature). The slides were observed with a Nikon E400, Eclipse epifluorescence microscope (Tokyo, Japan). Five pictures were taken in random fields for each labeling, and analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA). Flow cytometry Cells were cultured for 30 minutes, 37°C, 5% CO2, in DHE (10 mM in PBS), scraped out, and centrifuged (10 minutes, 1500 rpm,

TARGETING OXIDATIVE STRESS PREVENTS PRETERM BIRTH

Preterm labor is associated with oxidative stress We first assessed if in vivo inflammation-induced labor onset was associated with ROS production. Timed pregnant mice were injected i.p. with LPS (25 mg/mouse) at day + 15 post coitum. LPS induced labor onset within 16.9 6 3.9 h (vs. 133 6 3.7 hours for control mice, Fig. 1A). LPS-induced labor onset was associated with macroscopic signs of ischemic lesions in both uterine horns and placentae (Fig. 1B) and with a strong burst in superoxide anion production (Fig. 1C, D). To determine whether these in vivo observation could also be found in the human myometrium during labor, we compared myometrial biopsies from patients with CA to term nonlaboring NPs. CA was associated with an increase in the expression of the labor associated markers IL-1b, COX-2, MMP2, MMP9, and VEGF as well as caspase-3 cleavage in the myometrium (Fig. 1F). We also observed that CA was associated with a burst in ROS production (Fig. 1H), and no significant induction of NO production was observed (data not shown). These results indicate that myometrial inflammation, both ex vivo in and in vivo, is associated with the induction of ROS production. Inflammation-induced ROS production is driven by macrophages To further assess the pathways involved in ROS production, we stimulated NP human myometrial biopsies with LPS (an in vitro model of CA) (11, 13). LPS induced a biphasic increase in NADPHox activity at 3 and 48 hours (Fig. 2A), and again, no increase in NO production was seen at any time studied (data not shown). We measured the expression of the 2 main anti-oxidant enzymes SOD-1 and catalase (Fig. 2B), during the 2 NADPHox activation peaks, and observed that LPS induced an increase in SOD-1 expression at 3 hours of stimulation only (Fig. 2C). No changes in catalase expression were observed at any time point (Fig. 2D). These results suggest that ROS production is greater than anti-oxidant defenses after 48 hours LPS stimulation and lead to oxidative stress. Indeed, we observed that 48 hours LPS stimulation is associated with a burst in ROS production (Fig. 2I, K), as observed in CA samples. We next studied cell-specific NADPHox isoform expression: NOX1, NOX4 (expressed in SMCs), NOX2 2655

Figure 1. Preterm labor is associated with ROS production in the myometrium. A) In vivo preterm labor model. Time pregnant mice were injected i.p. with LPS (50 mg/mouse) or vehicle (PBS) at day + 15 post coitum. First pup delivery time is represented as mean values 6 SEM. LPS, n = 8; PBS, n = 7. ***P , 0.01. B) Myometrial and placental morphology. Mice were killed 12 hours after PBS (left panel) and LPS (right panel) injections, pictures are representative of 4 different experiments. Scale bar, 1 cm. C) ROS production. Mice were killed 12 hours after injection, and ROS production in histologic slides was determined by DAPI/DHE staining. Presented pictures are representative of 4 different experiments. D) Quantifications. The DHE-positive cells (red spots) (continued on next page)

2656

Vol. 29

June 2015

The FASEB Journal x www.fasebj.org

HADI ET AL.

(macrophages), and NOX5 (endothelium), all described as being expressed in the myometrium (22, 23). We first performed a screening of these isoforms’ expression by RT-PCR and observed that only NOX2 and NOX4 transcript expression were induced by LPS (Fig. 2E). We next confirmed that LPS induces an increase in NOX2, and NOX4 at protein levels (Fig. 2B, D). This result suggests a role for macrophages and myometrial SMCs in ROS production in the myometrium. We therefore labeled tissues with the macrophage-specific marker CD115, in both LPS-stimulated and CA myometrial biopsies (Fig. 2I) to identify the cell type responsible for ROS production. We observed that 20% cells in CA samples are infiltrated macrophages (vs. 10% in NP, Fig. 2J), confirming that CA is associated with a massive infiltration of macrophages in the myometrium. Furthermore, we observed that DHE labeling largely colocalizes with CD115 cells (Fig. 2I, L) indicating that ROS are mostly produced by macrophages. The same results were observed in vivo in mouse uteri after 12 hours exposure to LPS (Supplemental Fig. 2A). LPS-induced labor signaling requires NADPHox activity To further study the impact of LPS-associated ROS production on myometrial activation, we performed 48 h stimulations, a time where ROS levels are elevated and antioxidant defenses are low. As in CA samples, LPS induced an increase in IL-1b, COX-2, MMP2, MMP9, and VEGF expression and caspase-3 cleavage (Fig. 3B–G). However, all these inductions were fully abolished when the NADPHox inhibitor apocynin was added, indicating that NADPHox activation is required for LPS-induced myometrial preparation for parturition. NOSs inhibition had no effect on LPS-induced myometrial activation (data not shown). We next carried out stimulations with hydrogen peroxide (H2O2, Fig. 3H, K), the stable and reactive end-product of superoxide anion dismutation, and observed that H2O2 directly induced IL-1b, MMP-2, and VEGF expression and caspase-3 cleavage (Fig. 3K–O). However, H2O2, had no impact on MMP-9 and COX-2 expression (Fig. 3H–J), suggesting that ROS production by itself is not sufficient to mediate the full myometrial activation. ROS-induced labor signaling involves both NF-kBdependent and independent pathways LPS stimulation induced the activation of the proinflammatory transcription factor NF-kB, with an induction of its phosphorylation and nuclear translocation (Fig. 4A–C). The same induction of NF-kB nuclear translocation

was observed in vivo in mice after 12 h of LPS exposure (see Supplemental Fig. 2B). As NF-kB has been described to be redox sensitive (35), we aimed to investigate whether NADPHox-dependent activation of myometrial labor signaling occurred via NFkB activation. We therefore inhibited NF-kB with curcumin (Fig. 4B, C) and observed that curcumin only blocked LPS-induced IL-1b, MMP9, and Cox-2 overexpression (Fig. 4C–G), and no effect was observed on MMP2 and VEGF expression and caspase-3 cleavage (Fig. 4H–K). Altogether, the data from Figs. 3 and 4 suggest that NADPHox activation led to the full myometrial activation via 2 distinct NFkB-dependent and independent pathways. Different contribution to labor-associated features in MCs and macrophages To test whether these different activation pathways could be due to cell-specific responses, we stimulated primary MCs (Fig. 5A–E) or Th-p1-differentiated macrophages (Fig. 5F–J) with LPS or H2O2, for 48 hours. Whereas we hardly observed any response to LPS in MCs, H2O2 induced MMP2 and Cox-2 expression as well as caspase-3 cleavage in a dose-dependent manner (Fig. 5B–E). No modification of VEGF and MMP9 expression was observed either in LPS- or H2O2-stimulated MCs (Fig. 5A). In contrast, LPS induced an increase in MMP9, IL-1b, VEGF, and Cox-2 expression, (Fig. 5F–J), and only VEGF expression was induced by and H2O2 in macrophages. Neither LPS nor H2O2 modified MMP2 or cleaved caspase3 macrophage content (Fig. 5F). Flow cytometry analysis revealed that LPS induced an increase from 20 to 30% in DHE-positive macrophages (compared with control) and only from 0.2 to 0.6% in DHE-positive MCs (Supplemental Fig. 2C), showing, in line with what we observed in the myometrial tissue, that ROS are mostly produced by macrophages in response to LPS. Macrophages producing ROS are required for MC activation Because ROS production in the myometrium seems to be due to macrophages, and because MCs are activated by H2O2, rather than by LPS, we conducted coculture experiments with MCs and Th-p1-derived macrophages to further assess the role of macrophage in labor onset. In MCs stimulated alone with LPS (white bars), we observed no significant changes in labor-associated marker expression nor in ROS production (Supplemental Fig. 2D). In sharp contrast, the stimulation of MCs in the presence of macrophages (black bars) induced an increase in MMP2 and Cox-2 expression and in caspase-3 cleavage

are reported to total DAPI-positive cells (blue spots) and represented as mean values 6 SEM. n = 4. ***P , 0.05 vs. CTL. E) Western blotting on labor associated markers. Myometrial biopsies from 4 different patients with CA were compared with biopsies from 2 different patient not in labor with NPs and blotted for labor-associated markers. F) Quantification. IL-1b (37 kDa), Cox-2 (65 kDa), MMP2 (72 kDa), MMP9 (92 kDa), cleaved caspase-3 (17 kDa), and VEGF (22 kDa) bands were digitized and quantified with Quantity One. Relative quantities vs. mean control are represented as mean values 6 SEM. G) ROS production. ROS production in histologic slides of myometrial biopsies from 4 CA patients and 4 NP patients was determined by DAPI/DHE staining. Presented pictures are representative of 4 different experiments. H) Quantifications. Percentage of DHE-positive cells are represented as mean values 6 SEM. n = 4. ***P , 0.05 vs. CTL.

TARGETING OXIDATIVE STRESS PREVENTS PRETERM BIRTH

2657

Figure 2. Inflammation-induced ROS production in the myometrium is driven by macrophages. Myometrial biopsies were treated with LPS (10 mg/ml) for 3, 8, 24, or 48 hours. *P , 0.05. A) NADPHox activity. Relative NADPHox activities vs. CTL in tissue explant were measured by luminometric analysis and are represented as mean values 6 SEM. n = 5. B) Antioxidant defenses expression. Presented blots are representative of 4 independent experiments. C, D) Quantification. SOD-1 (21 kDa) and catalase (62 kDa) bands relative quantities vs. control are represented as mean values 6 SEM. n = 4. *P , 0.05 vs. CTL 3 hours. E) RT-PCR NADPHox isoforms. After mRNA extraction and reverse transcription, NOX1/2/4/5 levels were determined by semiquantitative PCR. Presented gels are representative of 4 independent experiments. F) Western blots of NADPHox isoforms. Presented blots are representative of 4 independent experiments. G, H) Quantifications.NOX2 (55 kDa) and NOX4 (72 kDa) bands relative quantities vs. control are represented as mean values 6 SEM. n = 4. *P , 0.05 vs. CTL. I) DAPI/DHE/CD115 labeling. Histologic (continued on next page)

2658

Vol. 29

June 2015

The FASEB Journal x www.fasebj.org

HADI ET AL.

(Fig. 5L–N) as well as an increase in ROS production, which colocalized with the CD115-positive cells (Supplemental Fig. 2D), consistent with what we observed in myometrial tissue. These data suggest that macrophages are required to transactivate MCs in response to LPS. To assess whether macrophage-induced MCs transactivation was mediated by ROS production, we performed LPS stimulation in the presence of catalase (1000 UI/ml) (Fig. 5O), and we observed that catalase costimulation abrogated LPS/macrophage-induced MMP2 and Cox-2 expression and caspase-3 cleavage in the coculture model (Fig. 5P–R). Altogether, the data of Fig. 5 indicate that in the myometrium, only macrophages are activated by LPS, leading to the induction of MMP9, IL-1b, and Cox-2 expression. Then, macrophages, by producing ROS, induce an autocrine response (VEGF production), and transactivate MCs (MMP2 and Cox-2 expression, caspase-3 cleavage, Supplemental Fig. 3). Glutathione prevents LPS-induced preterm labor and fetal distress We next assessed whether anti-oxidant molecules had an impact on both LPS- and ROS-induced labor signaling pathways, and we performed costimulations with 2 antioxidant molecules, GSH (100 mM, Fig. 6A) and g-tocopherol (vitamin E, 100 mM, Supplemental Fig. 4A). Vitamin E only inhibited LPS/H2O2-induced VEGF and MMP2 expression and caspase-3 cleavage (Supplemental Fig. 4B). In contrast, GSH inhibited all LPS/H2O2-induced myometrial features (Fig. 6B), suggesting a potential protective effect of GSH, rather than vitamin E, against preterm labor. Thus, timed pregnant mice were injected i.p. with LPS + GSH (25 mg/mouse and 2.5 mmol/kg respectively) at day +15, then with GSH every 12 hours until delivery. We observed that GSH delayed LPS-induced labor onset for more than 70 hours (see Fig. 6C for Kaplan-Meier diagram), allowing strong difference in pup development (Fig. 6E) and a drastic increase in pup survival (from 0 to 45% of the litter for LPS and LPS + glutathione, respectively; Fig. 6D). Moreover, GSH also prevented LPS-induced increase in hypoxia inducible factor (HIF)-1a and IL-1b expression in fetuses, 2 markers of fetal hypoxia (36, 37) and inflammation (6), respectively (Fig. 6G, H), along with preventing LPS-induced ROS production in mouse uteri (Fig. 6I, J), suggesting that GSH prevents LPS-induced preterm, but also protects the fetuses from suffering damages. DISCUSSION The physiologic production of ROS during pregnancy is a necessary step for implantation and good placental development, and thus the implication of oxidative stress in the physiopathology of pre-eclampsia and intrauterine growth retardation, 2 pathologies associated with placental development defects, has been extensively studied (21, 23, 38). Little is known about the implication of oxidative stress

in other pregnancy-related disorders (21, 28). However, it has been shown that administration with the antioxidant Nacetyl cysteine (NAC) protects against in vivo LPS-induced preterm birth (33), suggesting that oxidative stress could play a role in preterm labor physiopathology. In this study, we report that LPS-induced inflammation in the myometrium leads to oxidative stress, with NADPHox activation, and subsequent ROS production, and no significant increase in reactive nitrogen species production by NOS was observed. The production of superoxide anion (O2•2) and nitric oxide (•NO) can trigger opposite responses (18, 39). •NO signaling by itself is more commonly associated with anti-inflammatory effects (38) and acts as a second messenger molecule in cell signaling (e.g., induction of relaxation (40). In contrast, O2•2 is associated with exacerbation of the inflammatory response, as its production is induced in response to pathogens (41) and cytokines (22), and under stress conditions (irradiation, UV exposure, cigarette smoke) (29, 42), which can in turn activate cytokine expression (18, 40, 42). ROS can also induce NOS uncoupling leading to a decrease in •NO production, or directly react with •NO to form the proinflammatory and highly reactive peroxynitrite (ONOO2) (38). However, as no significant modification in •NO production was observed in our models (human pathologic samples, in vivo preterm labor model, myometrial biopsies, and primary cultures), such mechanisms (uncoupling and peroxynitrite formation) do not seem to occur in the myometrium. Accumulating evidences indicate that ROS play a role in multiple processes, including cell growth and survival (38), inflammation (19), apoptosis (27), and extracellular matrix remodeling (29). In this study, we observed that NOX inhibition by apocynin fully abrogated all LPS-induced myometrial features associated with labor, thus demonstrating the role of oxidative stress in parturition. Furthermore, data from human pathologic sample showing the same oxidative stress burst in the human myometrium of women with diagnosed CA strengthens the clinical relevance of what we observed in our ex vivo model. Indeed, it has been shown that more than 85 and 65% of preterm deliveries at less than 28 and 37 weeks, respectively (43, 44), were associated with the presence of histologic signs of CA. We have shown in this work that the effects of ROS on the myometrium were due to both the potentiation of LPSinduced activation of NF-kB, a redox-sensitive transcription factor, and to a direct NF-kB-independent signaling. When NF-kB was inhibited, we observed an abrogation of LPS-induced MMP9 and IL-1b expression and a decrease in Cox-2 expression. Because a high level of NF-kB activation is observed in the myometrium of women in labor (45) and because it is a major regulator of proinflammatory cytokine expression (6), this transcription factor has been proposed as a regulator of labor onset (35). Mechanistic analysis in fetal membranes and in the uterus revealed that NF-kB inhibition leads to the inhibition of MMP9 and Cox-2 expression (35, 46, 47). Thus, the partial blockade observed in our study is in line with these previous data. However, we deduced that LPS-induced myometrial

slides from 4 CA patients and 4 NP patients biopsies treated with LPS (10 mg/ml) for 48 hours were compared with 4 NP patients, noting ROS production DHE staining and macrophages by specific CD115 labeling (AF488, green fluorescence). n = 4. J–L) Quantifications. Ratios between DHE/DAPI- (J), CD115/DAPI- (K), and CD115/DHE- (L) positive cells are represented as mean percentages 6 SEM. n = 4. *P , 0.05 vs. CTL. ***P , 0.01 vs. CTL.

TARGETING OXIDATIVE STRESS PREVENTS PRETERM BIRTH

2659

Figure 3. NADPH activation is required for myometrial activation. A) NOX inhibition with apocynin. Myometrial explants were stimulated with LPS (10 mg/ml) for 48 hours in absence or presence of 100 mM apocynin. Presented blots are representative of 4 different experiments. H, K) H2O2 stimulations. Myometrial explants were stimulated with LPS (10 mg/ml) or H2O2 (1, 10, 100, and 1000 mM) for 48 hours. Presented blots of H2O2-insensitive features (H) and H2O2-sensitive (K) features are representative of 4 different experiments. B–O) Quantifications. IL-1b (17 kDa ), Cox-2 (17 kDa), MMP2 (72 kDa), MMP9 (92 kDa), cleaved caspase-3 (17 kDa), and VEGF (22 kDa) bands were digitized and quantified with Quantity One. Relative quantities vs. control are represented as mean values 6 SEM. n = 4. *P , 0.05 vs. CTL.

2660

Vol. 29

June 2015

The FASEB Journal x www.fasebj.org

HADI ET AL.

Figure 4. LPS induces myometrial activation by NF-kB-dependent and independent pathways. A) NF-kB immunohistofluorescence. Myometrial explants were stimulated with LPS (10 mg/ml) for 48 hours. Histologic slides were labeled with an anti-P-NFkB antibody Alexa Fluor 488 (green) and with DAPI for nuclear localization. Pictures are representative of 4 different experiments. B, D, H) NF-kB inhibition with curcumin. Myometrial explants were stimulated with LPS (10 mg/ml) for 48 hours in absence or presence of curcumin 100 mM. B) NF-kB phosphorylation, (D) NF-kB-dependent markers, and (H) NF-kBindependent markers. Presented blots are representative of 4 independent experiments. C–K) Quantifications. p-NF-kB (65kDa), IL-1b (17 kDa), MMP9 (92 kDa), Cox-2 (65 kDa), MMP2 (72 kDa), VEGF (22 kDa), and cleaved caspase-3 (17 kDa) bands were digitized and quantified with Quantity One. Relative quantities vs. control are represented as mean values 6 SEM. n = 4. *P , 0.05.

activation could not be restricted to NF-kB, as inhibition of NF-kB had no impact on VEGF and MMP2 expression and caspase-3 cleavage. The ability of H2O2 to induce the activation NF-kB remains controversial as opposite effects have been observed depending on the tissue and dose studied (25, 26). Here, we observed that H2O2 per se was a weak inducer of NF-kB, but induced all of the above-mentioned NF-kB-independent features. Moreover, recent in vivo studies showed that NF-kB activation is not required for TARGETING OXIDATIVE STRESS PREVENTS PRETERM BIRTH

preterm labor onset, and AP-1, which is a redox-sensitive transcription factor, is a requirement (48). A major finding of this study was that LPS-induced oxidative stress in the myometrium was only driven by macrophages. Indeed, although stimulation with LPS induced the overexpression of NOX2 in macrophages and of NOX4 in MCs, ROS production was restricted to macrophages. NOXs are transmembrane proteins that induce the production of O2•2 in the outer layer of the membrane 2661

Figure 5. Macrophages transactivate MCs via ROS production. A, F) LPS and H2O2 stimulations. A) MCs and (F) TH-p1-derived macrophages were stimulated with LPS (1 mg/ml) or H2O2 (0.1, 1, 10, and 100 mM) for 48 hours. Presented blots are representative of 4 independent experiments. K) Coculture experiments. MCs were stimulated with LPS (1 mg/ml) for 48 hours, in presence or absence of TH-p1-derived macrophages. Presented blots are representative of 4 independent experiments. MФ, macrophages. O) H2O2 neutralization by catalase. Cocultured cells were stimulated with LPS (1 mg/ml) for 48 hours, in presence or absence of catalase 1000 UI/ml. Presented blots are representative of 4 independent experiments. B–R) Quantifications. MMP2 (72 kDa), MMP9 (92 kDa), cleaved caspase-3 (17 kDa), IL-1b (17 kDa), VEGF (22 kDa), and Cox-2 (65 kDa) bands were digitized and quantified with Quantity One. Relative quantities vs. control are represented as mean values 6 SEM. n = 4. *P , 0.05 vs. CTL.

2662

Vol. 29

June 2015

The FASEB Journal x www.fasebj.org

HADI ET AL.

Figure 6. Glutathione prevents preterm labor and fetal distress. A) Western blots. Myometrial biopsies were stimulated with LPS (1 mg/ml) or H2O2 (10 mM) for 48 hours, in absence or presence of 100 mM glutathione. Presented blots are representative of 4 independent experiments. B) Quantifications. MMP2 (72 kDa), MMP9 (92 kDa), cleaved caspase-3 (17 kDa), VEGF (22 kDa), and Cox-2 (65 kDa) bands relative quantities vs. control are represented as mean values 6 SEM. n = 4. *P , 0.05. C) First pup delivery time. Time pregnant mice were injected i.p. with LPS (50 mg/mouse), with LPS and glutathione (GSH, 2 mmol/kg), or (continued on next page)

TARGETING OXIDATIVE STRESS PREVENTS PRETERM BIRTH

2663

(22, 23). NOX4 is expressed in SMCs in the plasma membrane and is activated upon the stimulation of ligands like IL-1b or TNF-a (22, 49). Although NOX4 was overexpressed in our model of primary MCs, NOX4 did not seem a major contributor to the oxidative stress observed in the myometrium. In macrophages, NOX2 is located in both the plasma membrane and in intracellular granules (22), thus allowing intra- and extracellular O2•2 release. ROS produced by macrophages are therefore likely to act in both an autocrine and paracrine manner. We observed that the presence of macrophages in the myometrium was required for labor onset. Indeed, we demonstrated that MCs responded to LPS only when cocultured with macrophages. During pregnancy, it has been shown that leukocyte activation status has to be lowered to allow maternal tolerance toward the fetus (50, 51). In contrast, the priming of circulating monocytes (5), as well as the massive infiltration of macrophages into the myometrium (3), is observed before labor onset, as we observed in myometrial biopsies from women with CA. The results of our study emphasize the primordial role of macrophage infiltration into the uterus in the initiation of labor. Another interesting point in this study is the sequential interplay between macrophages and MCs, which is necessary to induce full myometrial activation. Indeed, macrophages, in response to the inflammatory stimulus, induced the expression of IL-1b, Cox-2, VEGF, and MMP9, as well as ROS production. In turn, ROS mediate the expression of MMP2, the cleavage of caspase-3, and partially of Cox-2 expression in MCs. The interaction between macrophages and SMCs has also been studied in the physiopathology of atherosclerosis (52–55), an inflammatory disease (56). Indeed, macrophages have a deleterious effect in the arterial wall by inducing SMC apoptosis, as well as digestion of the extracellular matrix, leading to the rupture of atherosclerotic plaques (56). Oxidative stress is considered a major trigger of this phenomenon (19, 57), and ROS produced by macrophages, but not inflammatory cytokines, have been proposed as inducers of SMC apoptosis (27). We thus propose that the intermediary messenger between macrophages and MCs is H2O2 rather than cytokines. Because animals injected with IL-1b deliver within 48 h (6), many in vitro studies had focused on MC stimulation with IL-1b. However, the results have been disappointing, and gene chip analysis revealed that IL-1b induced the overexpression of 91 genes in MCs (mainly associated with the regulation of inflammatory processes and remodeling), but among genes directly associated with labor, only Cox-2 was induced (17). Moreover, even though recent studies showed that long-term in vitro LPS stimulation can promote MC contractility (58), a decrease in oxytocin receptor (a major contributor of MC contractility)

was observed in IL-1b-stimulated MCs (59). In contrast, we demonstrated here that H2O2 directly induced caspase-3 cleavage as well as the expression of MMP2 and, partially, of Cox-2 in MCs. However, we observed that H2O2 induced a weak response in macrophages. This result suggests that both inflammation and oxidative stress closely regulate labor onset. As ROS production is required for LPS-induced inflammatory signaling in macrophages, it appears that ROS production plays a pivotal role, first by potentiating inflammation in macrophages and second by activating myometrial SMCs. Moreover, pathologies involving increased systemic oxidative stress are always associated with low-grade chronic inflammation (19, 29, 38, 57, 60), and many of these pathologies, like diabetes, hypertension, and obesity, as well as smoking status or stress, are associated with an increased risk of preterm labor (3, 4, 21). Consequently, the dual signal triggered in these pathologies could be involved in the physiopathology of both infectious- and germ-free-induced preterm labor. Finally, the most important result of our study is that we have shown that glutathione was able to inhibit all LPSinduced labor-associated features in the human myometrium, as well as to prevent inflammation-induced preterm labor in mice. To date, only a few clinical trials have assessed the effect of antioxidant molecules on pregnancy-related disorders, and only vitamin E and C have been tested but with disappointing results (61–63).We also tested the effect of vitamin E in our model and found that this vitamin, which does not cross biologic membranes (29), only blocked features related to MCs, while no protective effect was observed on macrophage activation, which may explain the poor clinical effects reported. In contrast, glutathione is an endogenous tripeptide found in virtually all aerobic cells, and it can also be transported into the cytoplasm by specific carrier proteins. GSH acts by directly scavenging free radicals, but it can also neutralize H2O2 (29), the signal that activates MCs. In our study, we observed that glutathione abrogated all ROS-mediated inductions (whether intra- or extracellular) in an in vitro model of CA, which is associated with the most acute induction of inflammation observed in spontaneous preterm labor (64, 65). More importantly, glutathione prevented LPS-induced preterm labor in vivo and allowed the survival of nearly half of the pups. The murine in vivo inflammation-induced preterm labor model has been widely used to test potential candidates for preterm labor treatments, but often with disappointing results (for review, see Elovitz and Mrinalini) (32). For instance, in vivo studies performed either with IL-1b-deficient mice (66) or IL-1b receptor antagoniststreated mice (67) failed to show any impact on inflammation-induced preterm labor. Moreover, although

vehicle (PBS) at day + 15 post coitum. First pup delivery time is presented each group, LPS (red curve), LPS + GSH (green curve), and PBS (blue curve). LPS, n = 8; LPS + GSH, n = 8; PBS, n = 7. D) Survival rates. Percentages of pups surviving more than 24 hours are represented as mean values 6 SEM. LPS, n = 8; LPS + GSH; n = 8; PBS, n = 7. *P , 0.05 vs. LPS, ***P , 0.01 vs. LPS. E) Pup development stage. Pictures, taken immediately after birth, are representative of pup morphology for each group. Scale bar, 1 cm. F) Fetal distress markers. Mice were killed 12 hours after PBS, LPS, and LPS + GSH injections, and fetuses were collected and killed, before total protein extraction. Pictures are representative of 4 different experiments. G, H) Quantifications. HIF-1a (116 kDa) and IL-1b (37 kDa) bands were digitized and quantified with Quantity One. Relative quantities vs. control are represented as mean values 6 SEM. n = 4. *P , 0.05. I) ROS production in the myometrium. Mice were killed 12 hours after injection. ROS production in histologic slides was determined by DAPI/DHE staining. Presented pictures are representative of 4 different experiments. J) DHE-positive cells. Percentages of DHE-positive cells are represented as mean values 6 SEM. n = 4.***P , 0.01.

2664

Vol. 29

June 2015

The FASEB Journal x www.fasebj.org

HADI ET AL.

Cox-2 and NF-kB inhibitors were shown to efficiently delay labor onset in vivo, they failed to preserve fetal viability (35, 68). Thus, it appears that if Cox-2 and NF-kB pathways are required for labor induction, inflammation-associated fetal damages seem to occur independently of either pathway. Interestingly, the only reported molecule able to partially prevent in utero LPS-induced fetal death is NAC, which is in fact the glutathione precursor (33). Indeed, Buhimshi et al. showed that oral NAC administration resulted in only 33% fetal loss after 16 hours exposure to LPS vs. 100% in LPS-treated mice (33). Furthermore, Beloosesky et al. also showed that NAC administration i.p. suppressed LPSinduced amniotic fluid and placental cytokine response in rats (69). Using glutathione in our study, we observed a greater delay in labor onset than in any previously reported study, which allows pup survival, and which could be explained by an efficient protection against fetal distress. Thus, we have observed that glutathione is able to prevent inflammation-induced fetal distress, along with delaying labor onset, suggesting that this molecule could constitute a promising candidate for the prevention of preterm birth. Interestingly, this minimal-cost antioxidant drug, which is efficiently used in case of acetaminophen intoxication, has few side effects and can be used during pregnancy. In conclusion, our study highlights that oxidative stress plays a pivotal role in inflammation-induced myometrial activation and could therefore be involved in the physiologic processes leading to labor induction. We also provide evidence of a crosstalk between macrophages and myometrial SMCs that is mediated by ROS production (see Supplemental Fig. 4). Finally, this work provides a proof of concept and additional evidences in support of antioxidant supplementation during pregnancy to prevent preterm labor. This work was funded in part by the French Regional Council of Burgundy (Conseil R´egional de Bourgogne, Grant AOI STRESSOX).

REFERENCES 1. Beck, S., Wojdyla, D., Say, L., Betran, A. P., Merialdi, M., Requejo, J. H., Rubens, C., Menon, R., and Van Look, P. F. (2010) The worldwide incidence of preterm birth: a systematic review of maternal mortality and morbidity. Bull. World Health Organ. 88, 31–38 2. Goldenberg, R. L., Culhane, J. F., Iams, J. D., and Romero, R. (2008) Epidemiology and causes of preterm birth. Lancet 371, 75–84 3. Christiaens, I., Zaragoza, D. B., Guilbert, L., Robertson, S. A., Mitchell, B. F., and Olson, D. M. (2008) Inflammatory processes in preterm and term parturition. J. Reprod. Immunol. 79, 50–57 4. Muglia, L. J., and Katz, M. (2010) The enigma of spontaneous preterm birth. N. Engl. J. Med. 362, 529–535 5. Yuan, M., Jordan, F., McInnes, I. B., Harnett, M. M., and Norman, J. E. (2009) Leukocytes are primed in peripheral blood for activation during term and preterm labour. Mol. Hum. Reprod. 15, 713–724 6. Keelan, J. A., Blumenstein, M., Helliwell, R. J., Sato, T. A., Marvin, K. W., and Mitchell, M. D. (2003) Cytokines, prostaglandins and parturition—a review. Placenta 24(Suppl A), S33–46 7. Ogg´e, G., Romero, R., Lee, D. C., Gotsch, F., Than, N. G., Lee, J., Chaiworapongsa, T., Dong, Z., Mittal, P., Hassan, S. S., and Kim, C. J. (2011) Chronic chorioamnionitis displays distinct alterations of the amniotic fluid proteome. J. Pathol. 223, 553–565 8. Shynlova, O., Kwong, R., and Lye, S. J. (2010) Mechanical stretch regulates hypertrophic phenotype of the myometrium during pregnancy. Reproduction 139, 247–253 9. Taggart, M. J., Europe-Finner, G. N., and Mitchell, B. F. (2008) Possible dual roles for prostacyclin in human pregnancy and labor. J. Clin. Invest. 118, 3829–3832

TARGETING OXIDATIVE STRESS PREVENTS PRETERM BIRTH

10. Heller, D. S., Goldsmith, L. T., Aboujaoude, R., Kaplan, C., Baergen, R., and Cole, D. (2012) Collagen expression in the pregnant human cervix is decreased with labor. J. Low. Genit. Tract Dis. 16, 4–9 11. Lirussi, F., Rakotoniaina, Z., Madani, S., Goirand, F., Breuiller-Fouch´e, M., Leroy, M. J., Sagot, P., Morrison, J. J., Dumas, M., and Bardou, M. (2008) ADRB3 adrenergic receptor is a key regulator of human myometrial apoptosis and inflammation during chorioamnionitis. Biol. Reprod. 78, 497–505 12. Shynlova, O., Oldenhof, A., Dorogin, A., Xu, Q., Mu, J., Nashman, N., and Lye, S. J. (2006) Myometrial apoptosis: activation of the caspase cascade in the pregnant rat myometrium at midgestation. Biol. Reprod. 74, 839–849 13. Lirussi, F., O’Brien, M., Wendremaire, M., Goirand, F., Sagot, P., Dumas, M., Morrison, J. J., and Bardou, M. (2010) SAR150640, a selective beta3-adrenoceptor agonist, prevents human myometrial remodelling and activation of matrix metalloproteinase in an in vitro model of chorioamnionitis. Br. J. Pharmacol. 159, 1354–1366 14. Daneshmand, S. S., Chmait, R. H., Moore, T. R., and Bogic, L. (2002) Preterm premature rupture of membranes: vascular endothelial growth factor and its association with histologic chorioamnionitis. Am. J. Obstet. Gynecol. 187, 1131–1136 15. Fetalvero, K. M., Zhang, P., Shyu, M., Young, B. T., Hwa, J., Young, R. C., and Martin, K. A. (2008) Prostacyclin primes pregnant human myometrium for an enhanced contractile response in parturition. J. Clin. Invest. 118, 3966–3979 16. Sadowsky, D. W., Adams, K. M., Gravett, M. G., Witkin, S. S., and Novy, M. J. (2006) Preterm labor is induced by intraamniotic infusions of interleukin-1beta and tumor necrosis factor-alpha but not by interleukin-6 or interleukin-8 in a nonhuman primate model. Am. J. Obstet. Gynecol. 195, 1578–1589 17. Chevillard, G., Derjuga, A., Devost, D., Zingg, H. H., and Blank, V. (2007) Identification of interleukin-1beta regulated genes in uterine smooth muscle cells. Reproduction 134, 811–822 18. Finkel, T. (2001) Reactive oxygen species and signal transduction. IUBMB Life 52, 3–6 19. Jay, D., Hitomi, H., and Griendling, K. K. (2006) Oxidative stress and diabetic cardiovascular complications. Free Radic. Biol. Med. 40, 183–192 20. Gandhirajan, R. K., Meng, S., Chandramoorthy, H. C., Mallilankaraman, K., Mancarella, S., Gao, H., Razmpour, R., Yang, X. F., Houser, S. R., Chen, J., Koch, W. J., Wang, H., Soboloff, J., Gill, D. L., and Madesh, M. (2013) Blockade of NOX2 and STIM1 signaling limits lipopolysaccharide-induced vascular inflammation. J. Clin. Invest. 123, 887–902 21. Al-Gubory, K. H., Fowler, P. A., and Garrel, C. (2010) The roles of cellular reactive oxygen species, oxidative stress and antioxidants in pregnancy outcomes. Int. J. Biochem. Cell Biol. 42, 1634–1650 22. Bedard, K., and Krause, K. H. (2007) The NOX family of ROSgenerating NADPH oxidases: physiology and pathophysiology. Physiol. Rev. 87, 245–313 23. Bevilacqua, E., Gomes, S. Z., Lorenzon, A. R., Hoshida, M. S., and Amarante-Paffaro, A. M. (2012) NADPH oxidase as an important source of reactive oxygen species at the mouse maternal-fetal interface: putative biological roles. Reprod. Biomed. Online 25, 31–43 24. Kolls, J. K. (2006) Oxidative stress in sepsis: a redox redux. J. Clin. Invest. 116, 860–863 25. Gloire, G., and Piette, J. (2009) Redox regulation of nuclear posttranslational modifications during NF-kappaB activation. Antioxid. Redox Signal. 11, 2209–2222 26. Oliveira-Marques, V., Marinho, H. S., Cyrne, L., and Antunes, F. (2009) Role of hydrogen peroxide in NF-kappaB activation: from inducer to modulator. Antioxid. Redox Signal. 11, 2223–2243 27. Fruhwirth, G. O., and Hermetter, A. (2008) Mediation of apoptosis by oxidized phospholipids. Subcell. Biochem. 49, 351–367 28. Chai, M., Barker, G., Menon, R., and Lappas, M. (2012) Increased oxidative stress in human fetal membranes overlying the cervix from term non-labouring and post labour deliveries. Placenta 33, 604–610 29. Lehner, C., Gehwolf, R., Tempfer, H., Krizbai, I., Hennig, B., Bauer, H. C., and Bauer, H. (2011) Oxidative stress and bloodbrain barrier dysfunction under particular consideration of matrix metalloproteinases. Antioxid. Redox Signal. 15, 1305–1323 30. Redline, R. W., Faye-Petersen, O., Heller, D., Qureshi, F., Savell, V., and Vogler, C.; Society for Pediatric Pathology, Perinatal Section, Amniotic Fluid Infection Nosology Committee. (2003) Amniotic infection syndrome: nosology and reproducibility of placental reaction patterns. Pediatr. Dev. Pathol. 6, 435–448

2665

31. Hadi, T., Barrichon, M., Mourtialon, P., Wendremaire, M., Garrido, C., Sagot, P., Bardou, M., and Lirussi, F. (2013) Biphasic Erk1/2 activation sequentially involving Gs and Gi signaling is required in beta3-adrenergic receptor-induced primary smooth muscle cell proliferation. Biochim. Biophys. Acta 1833, 1041–1051 32. Elovitz, M. A., and Mrinalini, C. (2004) Animal models of preterm birth. Trends Endocrinol. Metab. 15, 479–487 33. Buhimschi, I. A., Buhimschi, C. S., and Weiner, C. P. (2003) Protective effect of N-acetylcysteine against fetal death and preterm labor induced by maternal inflammation. Am. J. Obstet. Gynecol. 188, 203–208 34. Anderson, M. E., Naganuma, A., and Meister, A. (1990) Protection against cisplatin toxicity by administration of glutathione ester. FASEB J. 4, 3251–3255 35. Lindstr¨om, T. M., and Bennett, P. R. (2005) The role of nuclear factor kappa B in human labour. Reproduction 130, 569–581 36. Trollmann, R., Strasser, K., Keller, S., Antoniou, X., Grenacher, B., Ogunshola, O. O., D¨otsch, J., Rascher, W., and Gassmann, M. (2008) Placental HIFs as markers of cerebral hypoxic distress in fetal mice. Am. J. Physiol. Regul. Integr. Comp. Physiol. 295, R1973–R1981 37. Asikainen, T. M., Chang, L. Y., Coalson, J. J., Schneider, B. K., Waleh, N. S., Ikegami, M., Shannon, J. M., Winter, V. T., Grubb, P., Clyman, R. I., Yoder, B. A., Crapo, J. D., and White, C. W. (2006) Improved lung growth and function through hypoxia-inducible factor in primate chronic lung disease of prematurity. FASEB J. 20, 1698–1700 38. Clerici, G., Slavescu, C., Fiengo, S., Kanninen, T. T., Romanelli, M., Biondi, R., and Di Renzo, G. C. (2012) Oxidative stress in pathological pregnancies. J. Obstet. Gynaecol. 32, 124–127 39. Finkel, T. (2011) Signal transduction by reactive oxygen species. J. Cell Biol. 194, 7–15 40. Finkel, T. (1999) Signal transduction by reactive oxygen species in non-phagocytic cells. J. Leukoc. Biol. 65, 337–340 41. Scirocco, A., Matarrese, P., Petitta, C., Cicenia, A., Ascione, B., Mannironi, C., Ammoscato, F., Cardi, M., Fanello, G., Guarino, M. P., Malorni, W., and Severi, C. (2010) Exposure of Toll-like receptors 4 to bacterial lipopolysaccharide (LPS) impairs human colonic smooth muscle cell function. J. Cell. Physiol. 223, 442–450 42. Lin, C. C., Lee, I. T., Yang, Y. L., Lee, C. W., Kou, Y. R., and Yang, C. M. (2010) Induction of COX-2/PGE(2)/IL-6 is crucial for cigarette smoke extract-induced airway inflammation: Role of TLR4-dependent NADPH oxidase activation. Free Radic. Biol. Med. 48, 240–254 43. Yoon, B. H., Romero, R., Moon, J. B., Shim, S. S., Kim, M., Kim, G., and Jun, J. K. (2001) Clinical significance of intra-amniotic inflammation in patients with preterm labor and intact membranes. Am. J. Obstet. Gynecol. 185, 1130–1136 44. Ust¨un, C., Koçak, I., Baris¸, S., Uzel, A., and Saltik, F. (2001) Subclinical chorioamnionitis as an etiologic factor in preterm deliveries. Int. J. Gynaecol. Obstet. 72, 109–115 45. Chapman, N. R., Europe-Finner, G. N., and Robson, S. C. (2004) Expression and deoxyribonucleic acid-binding activity of the nuclear factor kappaB family in the human myometrium during pregnancy and labor. J. Clin. Endocrinol. Metab. 89, 5683–5693 46. Condon, J. C., Jeyasuria, P., Faust, J. M., and Mendelson, C. R. (2004) Surfactant protein secreted by the maturing mouse fetal lung acts as a hormone that signals the initiation of parturition. Proc. Natl. Acad. Sci. USA 101, 4978–4983 47. Moore, R. M., Novak, J. B., Kumar, D., Mansour, J. M., Mercer, B. M., and Moore, J. J. (2009) Alpha-lipoic acid inhibits tumor necrosis factor-induced remodeling and weakening of human fetal membranes. Biol. Reprod. 80, 781–787 48. MacIntyre, D. A., Lee, Y. S., Migale, R., Herbert, B. R., Waddington, S. N., Peebles, D., Hagberg, H., Johnson, M. R., and Bennett, P. R. (2014) Activator protein 1 is a key terminal mediator of inflammationinduced preterm labor in mice. FASEB J. 28, 2358–2368 49. Hilenski, L. L., Clempus, R. E., Quinn, M. T., Lambeth, J. D., and Griendling, K. K. (2004) Distinct subcellular localizations of Nox1 and Nox4 in vascular smooth muscle cells. Arterioscler. Thromb. Vasc. Biol. 24, 677–683 50. Kindzelskii, A. L., Ueki, T., Michibata, H., Chaiworapongsa, T., Romero, R., and Petty, H. R. (2004) 6-phosphogluconate dehydrogenase and glucose-6-phosphate dehydrogenase form a supramolecular complex in human neutrophils that undergoes retrograde trafficking during pregnancy. J. Immunol. 172, 6373–6381 51. Luft, B. J., and Remington, J. S. (1984) The adverse effect of pregnancy on macrophage activation. Cell. Immunol. 85, 94–99 52. Boyle, J. J., Bowyer, D. E., Weissberg, P. L., and Bennett, M. R. (2001) Human blood-derived macrophages induce apoptosis in

2666

Vol. 29

June 2015

53. 54.

55.

56. 57. 58. 59.

60.

61.

62.

63.

64.

65.

66. 67.

68.

69.

human plaque-derived vascular smooth muscle cells by Fas-ligand/ Fas interactions. Arterioscler. Thromb. Vasc. Biol. 21, 1402–1407 Fan, Y. Y., Chapkin, R. S., and Ramos, K. S. (1995) A macrophagesmooth muscle cell co-culture model: applications in the study of atherogenesis. In Vitro Cell. Dev. Biol. Anim. 31, 492–493 Lee, E., Grodzinsky, A. J., Libby, P., Clinton, S. K., Lark, M. W., and Lee, R. T. (1995) Human vascular smooth muscle cellmonocyte interactions and metalloproteinase secretion in culture. Arterioscler. Thromb. Vasc. Biol. 15, 2284–2289 Mensink, A., Mul, F. P., van der Wijk, T., Brouwer, A., and Koeman, J. H. (1998) Macrophages influence gap junctional intercellular communication between smooth muscle cells in a co-culture model. Environ. Toxicol. Pharmacol. 5, 197–203 Wong, B. W., Meredith, A., Lin, D., and McManus, B. M. (2012) The biological role of inflammation in atherosclerosis. Can. J. Cardiol. 28, 631–641 Tinkel, J., Hassanain, H., and Khouri, S. J. (2012) Cardiovascular antioxidant therapy: a review of supplements, pharmacotherapies, and mechanisms. Cardiol. Rev. 20, 77–83 Hutchinson, J. L., Rajagopal, S. P., Yuan, M., and Norman, J. E. (2014) Lipopolysaccharide promotes contraction of uterine myocytes via activation of Rho/ROCK signaling pathways. FASEB J. 28, 94–105 Helmer, H., Tretzm¨uller, U., Brunbauer, M., Kaider, A., Husslein, P., and Kn¨ofler, M. (2002) Production of oxytocin receptor and cytokines in primary uterine smooth muscle cells cultivated under inflammatory conditions. J. Soc. Gynecol. Investig. 9, 15–21 Elnakish, M. T., Hassanain, H. H., Janssen, P. M., Angelos, M. G., and Khan, M. (2013) Emerging role of oxidative stress in metabolic syndrome and cardiovascular diseases: important role of Rac/NADPH oxidase. J. Pathol. 231, 290–300 B´artfai, L., B´artfai, Z., Nedeczky, I., Puho, E. H., B´anhidy, F., and Czeizel, A. E. (2012) Rate of preterm birth in pregnant women with vitamin E treatment: a population-based study. J. Matern. Fetal Neonatal Med. 25, 575–580 Hauth, J. C., Clifton, R. G., Roberts, J. M., Spong, C. Y., Myatt, L., Leveno, K. J., Pearson, G. D., Varner, M. W., Thorp, J. M., Jr., Mercer, B. M., Peaceman, A. M., Ramin, S. M., Sciscione, A., Harper, M., Tolosa, J. E., Saade, G., Sorokin, Y., and Anderson, G. B.; Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) Maternal-Fetal Medicine Units Network (MFMU). (2010) Vitamin C and E supplementation to prevent spontaneous preterm birth: a randomized controlled trial. Obstet. Gynecol. 116, 653–658 Sundrani, D. P., Chavan Gautam, P. M., Mehendale, S. S., and Joshi, S. R. (2011) Altered metabolism of maternal micronutrients and omega 3 fatty acids epigenetically regulate matrix metalloproteinases in preterm pregnancy: a novel hypothesis. Med. Hypotheses 77, 878–883 Esplin, M. S., Romero, R., Chaiworapongsa, T., Kim, Y. M., Edwin, S., Gomez, R., Mazor, M., and Adashi, E. Y. (2005) Monocyte chemotactic protein-1 is increased in the amniotic fluid of women who deliver preterm in the presence or absence of intra-amniotic infection. J. Matern. Fetal Neonatal Med. 17, 365–373 Han, Y. M., Romero, R., Kim, Y. M., Kim, J. S., Richani, K., Friel, L. A., Kusanovic, J. P., Jeanty, C., Vitale, S., Nien, J. K., Espinoza, J., and Kim, C. J. (2007) Surfactant protein-A mRNA expression by human fetal membranes is increased in histological chorioamnionitis but not in spontaneous labour at term. J. Pathol. 211, 489–496 Kimura, T., Ogita, K., Kusui, C., Ohashi, K., Azuma, C., and Murata, Y. (1999) What knockout mice can tell us about parturition. Rev. Reprod. 4, 73–80 Fidel, P. L., Jr., Romero, R., Cutright, J., Wolf, N., Gomez, R., Araneda, H., Ramirez, M., and Yoon, B. H. (1997) Treatment with the interleukin-I receptor antagonist and soluble tumor necrosis factor receptor Fc fusion protein does not prevent endotoxininduced preterm parturition in mice. J. Soc. Gynecol. Investig. 4, 22–26 Gross, G., Imamura, T., Vogt, S. K., Wozniak, D. F., Nelson, D. M., Sadovsky, Y., and Muglia, L. J. (2000) Inhibition of cyclooxygenase-2 prevents inflammation-mediated preterm labor in the mouse. Am. J. Physiol. Regul. Integr. Comp. Physiol. 278, R1415–R1423 Beloosesky, R., Gayle, D. A., Amidi, F., Nunez, S. E., Babu, J., Desai, M., and Ross, M. G. (2006) N-acetyl-cysteine suppresses amniotic fluid and placenta inflammatory cytokine responses to lipopolysaccharide in rats. Am. J. Obstet. Gynecol. 194, 268–273

The FASEB Journal x www.fasebj.org

Received for publication November 20, 2014. Accepted for publication February 19, 2015.

HADI ET AL.