This article was downloaded by: [FU Berlin] On: 12 May 2015, At: 03:10 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Bioscience, Biotechnology, and Biochemistry Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbbb20
Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation a
a
a
b
a
Hiroko Kobayashi , Naomi Motoyoshi , Tadashi Itagaki , Mamoru Suzuki & Norio Inokuchi a
Department of Microbiology, School of Pharmacy, Nihon University, Chiba, Japan
b
Institute for Protein Research, Osaka University, Suita, Japan Published online: 23 Oct 2014.
Click for updates To cite this article: Hiroko Kobayashi, Naomi Motoyoshi, Tadashi Itagaki, Mamoru Suzuki & Norio Inokuchi (2015) Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation, Bioscience, Biotechnology, and Biochemistry, 79:2, 211-217, DOI: 10.1080/09168451.2014.972327 To link to this article: http://dx.doi.org/10.1080/09168451.2014.972327
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Bioscience, Biotechnology, and Biochemistry, 2015 Vol. 79, No. 2, 211–217
Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation Hiroko Kobayashi1,*, Naomi Motoyoshi1, Tadashi Itagaki1, Mamoru Suzuki2 and Norio Inokuchi1 1
Department of Microbiology, School of Pharmacy, Nihon University, Chiba, Japan; 2Institute for Protein Research, Osaka University, Suita, Japan
Received July 22, 2014; accepted September 9, 2014
Downloaded by [FU Berlin] at 03:10 12 May 2015
http://dx.doi.org/10.1080/09168451.2014.972327
RNase He1 from Hericium erinaceus, a member of the RNase T1 family, has high identity with RNase Po1 from Pleurotus ostreatus with complete conservation of the catalytic sequence. However, the optimal pH for RNase He1 activity is lower than that of RNase Po1, and the enzyme shows little inhibition of human tumor cell proliferation. Hence, to investigate the potential antitumor activity of recombinant RNase He1 and to possibly enhance its optimum pH, we generated RNase He1 mutants by replacing 12 Asn/Gln residues with Asp/Glu residues; the amino acid sequence of RNase Po1 was taken as reference. These mutants were then expressed in Escherichia coli. Using site-directed mutagenesis, we successfully modified the optimal pH for enzyme activity and generated a recombinant RNase He1 that inhibited the proliferation of cells in the human leukemia cell line. These properties are extremely important in the production of anticancer biologics that are based on RNase activity. Key words:
RNase T1 family RNase; Hericium erinaceus; site-directed mutant; inhibition of cell proliferation
RNase He1 from Hericium erinaceus, a member of the RNase T1 family, hydrolyzes single-stranded RNA via a 2′,3′-cyclic phosphate intermediate at the 3′-terminus of oligonucleotides and is guanylic acid-specific. The RNase T1 family includes RNases that are found only in microbes; RNase T1from Aspergillus oryzae is the best-known member. RNase He1 comprises 100
amino acid residues, with a molecular weight of 10,690 Da.1) It exhibits high identity with RNase Po1 (59%) from Pleurotus ostreatus2) and RNase T1 (39%).3) The active site of RNase He1 is well conserved compared to that of RNase T1 and RNase Po1 (Fig. 1). RNase He1 and RNase Po1 from edible mushrooms contain six cysteine residues (two more than other RNases), which makes them more heat stable than others. The optimum pH for enzymatic activity of most RNases of the T1 family, including RNase Po1 and RNase T1, is 7.5; however, the optimum pH for RNase He1 is 4.5, similar to that of RNase Ms. from Aspergillus saitoi.4) RNase Po1 inhibits human tumor cell line proliferation5) similar to α-sarcin from Aspergillus giganteus.6) Although RNase He1 does not inhibit human tumor cell line proliferation, it exhibits high identity with RNase Po1. The pI of RNase He1 is pH 4.2, which is similar to that of RNase T1 (pH 2.9) and of almost all the RNases of the T1 family, while the pI values of RNase Po1 and α-sarcin are pH 9.0 and pH > 8, respectively. On observing the X-ray crystallographic structure of RNase Po1, we suggested that its high stability is due to the presence of disulfide bonds, and its positive charges on the surface are responsible for its antitumor activity.7) In this study, to possibly modify the optimum pH of RNase He1 and to investigate whether it could potentially exhibit antitumor activity, we substituted the aspartic acid/glutamic acid residues of RNase He1 with asparagine/glutamine residues, using RNase Po 1 as reference, and compared the enzymatic properties and inhibition of human leukemia cell line proliferation of the wild-type protein with those of its site-directed mutants.
*Corresponding author. Email: [email protected] Abbreviations: DEAE, diethylaminoethyl; FBS, fetal bovine serum; HPLC, high-performance liquid chromatography; IC50, half-maximal inhibitory concentration of a substance; IPTG, β-D-1-thiogalactopyranoside; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; pI, isoelectric point; RNase, ribonuclease; SP, sulfopropyl; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; PCR, polymerase chain reaction. © 2014 Japan Society for Bioscience, Biotechnology, and Agrochemistry
212
H. Kobayashi et al.
Downloaded by [FU Berlin] at 03:10 12 May 2015
Fig. 1. Comparison of the amino acid sequences of RNase He1, RNase Po1, RNase T1, and RNase Ms. Notes: He1, RNase He1 from H. erinaceus; Po1, RNase Po15) from P. ostreatus; Ms, RNase Ms2) from A. saitoi; and T1, RNase T113) from A. oryzae. Numbers above the alignment correspond to the RNase He1 numbering. Residues in common with RNase He1 are shaded. ★: Catalytic site. The amino acid residues that were mutated are indicated by arrows. The site-directed mutants of RNase He1 are enclosed by dotted lines: 12RHe1, RNase He1 containing 12 mutations (12-mutant-He1); 4RHe1, RNase He1 containing four mutations (4-mutant-He1). The amino acid residues mutated into Asn or Gln in the two mutants are enclosed in the boxes.
Materials and methods Enzyme assay. RNase activity was measured as described in a previous paper using 0.25 mg/mL yeast RNA (Wako Pure Chemical Industries, Osaka, Japan) as a substrate at pH 4.5 or pH 7.5 and a temperature of 37 °C.8) Protein estimation. The protein concentration of the final enzyme preparation was determined spectrophotometrically, assuming an absorbance of 0.905 for a 0.1% solution at 280 nm. This value was estimated from the amino acid composition of RNase He1 (data not shown). Preparation of site-directed mutants of RNase He1 at aspartic acid/glutamic acid residues. Total RNA of H. erinaceus was extracted using TRIZOL reagent (Gibco BRL, Gaithersburg, MD, USA). He1-encoding cDNA (DDBJ accession number AB429363) was obtained from the total RNA using the primers 5′-Nco1 He1 and 3′-BamHe1 designed according to the cDNA sequence of RNase He1. The site-directed mutant of RNase He1 containing 12 mutations (12-mutant-He1) was generated by PCR using the primers FNco1Q1-G30: [gccatggcgCAGTCCGGCGGATGCTCCTGCGCTGGGAGGAGTTACTCTTCGAGCAACATTGCCAACGCGATCAACCAGGCTCAAGGGAGGGGTGGAGGC], FN19-R58: [AACGCGATCAACCAGGCTCAAGGGAGG GGTGGAGGCAACTACCCTCACCAATATCACAACTACGAGGGCTTCTCGTTCCCATCGTGCAGAGGCCAGTTCTTCGAGTACCCGCTCCAACGC], and R59S-F100 BamH1: [gggatccTCAGAAATTGCATTCTACAAAACCGTTCTGGGTCGATGCCCCAGTGTGAGTTAGACAAGCGCAGAAGTTGCCGTTCTG-GTCGTAGATGACACGGTCTGCGCCGGGACTGCCGCCCGTGTAGACACCGCT] (the mutated bases are underlined, the codon of mutated amino acid
residues are shown in bold). The primer F-Nco1Q1-G30 was used to generate three mutations (i.e. D19N, D22N, and E25Q), the primer F-N19-R58 was used to generate seven mutations (i.e. D19N, D22N, E25Q, D31N, D38N, E50Q, and E57Q), and the primer R-59S-100FBamH1 was used to generate five mutations (i.e. E76Q, D77N, D79N, E92Q, and D93N). The nucleotide sequence of the mutants was confirmed using a DNA sequencer (CEQ8000, Beckman, Brea, CA, USA) using the method proposed by Sanger and Coulson.9) The mutant of RNase He1 containing four mutations (4-mutant-He1: D31N, D38N, E92Q, and D93N) was generated by PCR using two primers. Forward primer f-D19R58 was designed to return the five amino acids (D19N, D22N, E25Q, E50Q, and E57Q) to the wild-type RNase He1 amino acids (N19D, N22D, Q25E, Q50Q, and Q57E) by modifying F-N19R58. Reverse primer r-59S100FBamH1 was designed to return the three amino acids (E76Q, D77N, and D79N) to the wild-type RNase He1 amino acids (Q76E, N77D, and N79D) by modifying R-59S100FBamH1. The nucleotide sequences corresponding to the each amino acid were altered. Construction of the expression vector. The expression vector for the RNase He1 mutants was constructed according to the method by Huang et al.10) The pelB signal sequence was obtained from pE22b. The pelB 3′-end sequence containing Nco1 site was combined with pET11d. Flanking NcoI and BamHI sites were added to the upstream and downstream ends, respectively, of the RNase He1 cDNA by PCR using the FNco1Q1-G30 and R59S-F100BamH1 primers, respectively. Expression and purification of the site-directed mutants. The two site-directed mutants of RNase He1 were expressed in Escherichia coli BL21 (DE3) pLysS in terrific broth containing 100 μg/mL ampicillin and 0.5 mM IPTG (Wako Pure Chemical Industries, Osaka, Japan) for 6 d at 25 °C. The culture medium was centrifuged at 12,000 × g for 30 min. The enzymes were precipitated with ammonium sulfate (90% saturation) and loaded onto a Sephadex G50 column (3 × 180 cm; GE Healthcare Uppsala, Sweden) equilibrated with 10 mM acetate buffer (pH 6.0). The RNase-active fractions of 12-mutant-He1 were pooled and loaded onto a SP-Toyopearl column (3 × 30 cm; TOSOH, Tokyo, Japan) equilibrated with 10 mM acetate buffer (pH 6.0) and eluted with the same buffer containing NaCl (0–0.5 M) with a linear gradient. The RNase-active fractions were pooled and loaded onto a DEAE-Toyopearl column (1.5 × 40 cm; TOSOH) equilibrated with 10 mM Tris–HCl buffer (pH 7.5) and were eluted with the same buffer containing NaCl (0–0.3 M) with a linear gradient. The RNase-active fractions were loaded onto an Ultrogel AcA54 column (3 × 180 cm; GE Healthcare) equilibrated with 10 mM acetate buffer (pH 6.0). The RNase-active fractions were loaded onto a heparin-Sepharose column (1.0 × 20 cm; GE Healthcare) equilibrated with 10 mM acetate buffer (pH 4.5) and were eluted with the same buffer containing NaCl
Downloaded by [FU Berlin] at 03:10 12 May 2015
Inhibition of tumor cell proliferation by recombinant-He1
(0–0.3 M) with a linear gradient. The RNase-active fractions were pooled and dialyzed overnight using a dialysis membrane (Spectra/Pro 7 with 3.5-kD cut-off; Spectrum Labs, Dominquez, CA) against deionized water. The dialyzed enzymes were loaded onto an HPLC (SHIMADZU, LC6A, Kyoto, Japan) system using a Shodex protein kw802.5 column (0.8 × 80 cm; SHOWA DENKO, Nagoya, Japan), equilibrated with 5 mM trimethylamine acetate buffer (pH 6.0), and eluted with the same buffer. The RNase-active fractions were pooled as purified enzymes. Using the Sephadex G50, 4-mutant-He1was eluted in the same way as 12-mutant-He1. Next, the active fractions were loaded onto a DEAE-Toyopearl column (1.5 × 40 cm; TOSOH) equilibrated with 10 mM acetate buffer (pH 5.5) and were eluted with a linear gradient using the same buffer containing NaCl (0–0.3 M). The RNase-active fractions were then loaded onto an Ultrogel AcA54 column (3 × 180 cm) equilibrated with 10 mM acetate buffer (pH 6.0). The chromatography was repeated once, and the eluates were then loaded onto a heparin-Sepharose column for further purification. Finally, the fractions were loaded onto an HPLC (SHIMADZU, LC6A, Kyoto, Japan) column, Shodex protein kw802.5. Chromatography was performed under the same condition as that used for 12-mutant-He1.
Base specificity. Base specificity of 12-mutant-He1 was measured by measuring the rates of release of 3′guanosine monophosphate (GMP) and 2′, 3′-cyclic guanosine monophosphate (cGMP) from the yeast RNA. The rates of release of nucleotides were determined by analyzing the hydrolysis products via reversed-phase HPLC using a TSK gel carbon 500 column (TOSOH, Tokyo, Japan), as described previously.11)
Effect of the site-directed mutants of RNase He1 on the proliferation of human leukemia cells. The antiproliferative activity of RNase He1, RNase Po1, and site-directed mutants of RNase Hel (4-mutant-He1, 12mutant-He1) was measured using human leukemia cells (HL-60 and Jurkat cell lines; Health Science Research Resources Bank, Osaka, Japan). According to the method of Titani et al.12) HL-60 cells were pre-cultured in RPMI 1640 (Invitrogen, Carlsbad CA, USA) containing 10% fetal calf serum (Bio West, Strasbourg, France); 200 μL of cell suspension (3 × 105 cells/mL) was supplemented with 10 μL of the RNase. After 72 h of incubation at 37 °C under 5% CO2, viable cells were counted using the MTT assay performed according to the manufacturer’s instructions (Dojindo Laboratories, Kumamoto, Japan). The inhibition of cell proliferation was calculated as the percent decrease in final cell number compared to that in the absence of RNases. The structural model of 12-mutant-He1. The structural model of 12-mutant-He1 was constructed by employing the web server SWISS-MODEL13) with the crystal structure of RNase Po1 (PDB ID; 3WHO) as template.7)
213
Results Expression and purification of the site-directed mutants of RNase He1 We substituted 12 aspartic acid/glutamic acid residues of RNase He1 with asparagine/glutamine residues, using RNase Po 1 as a reference (12-mutant-He1: D19N, D22N, E25Q, D31N, D38N, E50Q, E57Q, E76Q, D77N, D79N, E92Q, and D93N). Moreover, we mutated four amino acid residues of RNase He1 that appeared to be near the catalytic site of RNase He1 (4mutant-He1: D31N, D38N, E92Q, and D93N) (Fig. 1). We expressed the site-directed mutants of RNase He1 (12-mutant-He1) in E. coli; the resulting preparation (3.0 mg from 3 L of culture medium) of 12-mutantHe1 was purified to homogeneity, and was confirmed by Tricine-SDS-PAGE,14) with a net yield of 21.0%. 4-mutant-He1 (3.0 mg from 1 L of culture medium) was purified to homogeneity with a net yield of 22.0% (Table 1, Fig. 2). Base specificity In the hydrolysis test, we found that both wild-type RNase He1 and 12-mutant-He1 formed 3′-GMP and 2′, 3′-GMP, indicating that RNase He1 was guanilic acidspecific and that the mutations introduced did not affect this specificity (Fig. 3). Enzymatic properties of RNase He1 The optimum temperature for RNase He1 catalytic activity was measured using RNA as the substrate and temperatures in the range of 20–80 °C for 20 min under the assay conditions described (Fig. 4(a)). The optimal temperature range for catalysis by 12-mutantHe1 was 65–70 °C, which was the same as that of RNase Po1 and RNase He1, but higher than that of RNase T1 (50 °C). The optimal pH for 12-mutantHe1activity, measured using RNA as the substrate, was 7.5, which was higher than that of wild-type RNase He1 (pH 4.5) Thus, the optimal pH of 12-mutant-He1 was the same as that of RNase Po1 and RNase T1.5) Moreover, the optimal pH for the activity of 4-mutantHe1 was 7.0, which was almost the same as that of 12-mutant-He1 (Fig. 4(b)). Effects of mutant-He1 on the proliferation of human leukemia cells The effects of two mutant-He1s on the proliferation of human leukemia cell lines (i.e. HL-60 and Jurkat cells) were studied. RNase Po1 showed remarkable proliferation inhibitory activity toward HL-60 cells (IC50 = 0.1 μM), whereas RNase He1 had a little effect. Similarly, 4-mutant-He1 also did not show proliferation inhibitory activity. 12-mutant-He1 inhibited the proliferation of HL-60 cells (IC50 = 0.1 μM) and Jurkat cells (IC50 = 2.0 μM) at a level similar to that of RNase Po1 (IC50 = 1.0 μM) (Fig. 5). The structural model of 12-mutant-He1 We confirmed the location of site-directed mutants of RNase He1 by structural modeling using the crystal
214 Table 1.
Downloaded by [FU Berlin] at 03:10 12 May 2015
Step
H. Kobayashi et al. Purification of 12RHe1 and 4RHe1. Total activity（units）
Total protein (mg)
Specific activity (units/mg)
Yield (%)
(A) Purification of 12RHe1 from culture medium (3 L) of E. coli transformed with pET11d-pelB-12RHe1 Crude extract 29,100 24,400 24,200 17,100 (NH4)2SO4 fraction (0–0.9s) Sephadex G-50 (pH 6.0) 22,500 2440 SP-Toyopearl (pH 5.0) 22,100 364 DEAE-Toyopearl (pH 5.0) 21,000 87 Ultrogel AcA54 (pH 6.0) 14,600 73 Heparin-Sepharose (pH 4.5) 14,500 14.1 Shodex kw-802.5 HPLC (pH 6.0) 6000 3.1
1.2 1.4 9.1 61.9 249 200 1040 1940
100 83 76 78 72 50 50 21
(B) Purification of 4RHe1 from culture medium (1 L) of E. coli transformed with pET11d-pelB-4RHe1 Crude extract 11,400 8100 (NH4)2SO4 fraction (0–0.9s) 6700 4900 Sephadex G-50 (pH 6.0) 6300 1700 DEAE-Toyopearl (pH 5.0) 5300 174 Ultro gel AcA54 (pH 6.0) 3800 105 DEAE-Toyopearl (pH 5.0) 3400 49 Ultrogel AcA54 (pH 6.0) 2900 9.5 Heparin-Sepharose (pH 4.5) 2700 4.7 Shodex kw-802.5 HPLC (pH 6.0) 2500 3.9
1.4 1.4 3.7 30 36 69 305 574 615
100 58 55 46 33 29 26 23 22
located in or near the active site. D31N was positioned toward the side chain of H34, and E92Q, D93N were close to the side chain of H86. D38N was located in the loop containing the guanine recognition site.
Discussion
Fig. 2. Tricine-SDS-PAGE of two mutant-He1s. Notes: The details of the procedure are described in the text. a: Silver staining of molecular marker proteins. b: Silver staining of mutant-He1. (a), 12mutant-He1, (b), 4-mutant-He1.
structure of RNase Po1 as a template (Fig. 6). Eight of 12 mutated amino acid residues were located on the enzyme surface, and the other four mutated amino acid residues i.e. D31N, D38N, E92Q, and D93N were
RNase He1 from the mushroom H. erinaceus exhibited high identity with RNase Po1, but unlike RNase Po1, it did not exhibit proliferation inhibitory activity toward human tumor cells. By comparing the primary structures of RNases He1 and RNase Po1, four amino acid residues in the active site of RNase T115) and six cysteine residues were conserved, whereas many other amino acids were replaced by acidic amino acid residues (i.e. Asp/Glu) in RNase He1. Therefore, we prepared a mutant of RNase He1 in which seven aspartic acid and five glutamic acid residues were replaced with asparagine and glutamine residues, namely 12-mutantHe1. We expressed the mutant in E. coli and purified it to homogeneity, as confirmed by Tricine-SDS-PAGE. The 12-mutant-He1 exhibited the same guanine specificity and heat stability as the wild-type RNase He1. However, the optimum pH for the activity of RNase
Fig. 3. Release of nucleotides upon digestion of RNA with RNase He1 and 12-mutant-He1. The hydrolysis and separation conditions are described in the text. Symbols: －●－, 2′,3′ cGMP; - - -●- - -, 3′GMP; －▲－, 2′,3′ cAMP + 3′ AMP; －■－, 2′,3′ cCMP + 3′CMP; and －○－, 2′,3′ cUMP + 3′UMP.
Inhibition of tumor cell proliferation by recombinant-He1
(a)
215
(b)
Downloaded by [FU Berlin] at 03:10 12 May 2015
Fig. 4. Effect of the temperature and pH on the enzymatic activities of RNase He1, 12-mutant-He1, and 4-mutant-He1. Notes: (a) Effect of the temperature on the enzymatic activities of RNase He1, 12-mutant-He1, and RNase T1. Enzyme activity was determined as described in the text using RNA as the substrate at various temperatures. The buffers (0.01 M) contained 1 mg/mL bovine serum albumin and 0.2 M NaCl. Activity was expressed as a percentage of the maximum activity. Symbols: ●, 12-mutant-He1; ○, RNase He1; and ▲, RNase T1. (b) Effect of pH on the enzymatic activity of RNase He1 and two mutants of RNase He1 (i.e. 4mutant-He1 and 12mutant-He1). Enzyme activity was determined as described in the text using RNA as the substrate. The buffers (0.01 M) used were acetate-NaOH buffer for pH 5.5–6.0 and Tris–HCl buffer for pH 6.5–8.5. Activity was expressed as a percentage of the maximum activity. Symbols: ●,4-mutantn-He1; ▲, 12-mutant-He1; and ○, RNase He1.
Fig. 5. Effects of 12mutant-He1, 4mutant-He1, and RNase He1 on the proliferation of HL-60 and Jurkat cells as determined with the MTT Assay. Notes: Each point is the mean of three replicates and is reported as the percentage of the control, which lacked RNase. Cells were treated with a given concentration of RNases for 72 h. Cell proliferation without RNase was normalized to 100%. Symbols: ▲, RNase Po1; ●, 12mutant-He1; ○, RNase He1; ■, and 4mutant-He1.
He1 changed from 4.5 to 7.5 after the mutations. Moreover, 12-mutant-He1 inhibited the proliferation of HL60 and Jurkat cell lines, similar to RNase Po1. The tertiary structure of RNase Po17) comprises an α-helix and a four-β-stranded antiparallel β-sheet crossing the α-helix. The catalytically active amino acid residues of RNase Po1 (i.e. H36, D54, R72, and H87) are located in the β-strands 3–6, which form the catalytic pocket, and are adjacent to the β-strand 6 (Fig. 6). We predicted the location of the amino acid residues introduced with the mutations in RNase He1 via the structural modeling of 12-mutant-He1 with RNase Po1 as a template. D31N, E92Q, D93N, and D38N residues are near or in the active site. The other mutated amino acid residues were on the molecular surface and, therefore, too far to interact with the catalytically active amino acid residues. We also generated a mutant of RNase He1 containing four mutations (4-mutant-He1). The
optimum pH values for the activity of the mutants with a single mutation (i.e. D31N-mutant, D38N-mutant, E92Q-mutant, and D93N-mutant), two mutations (i.e. D31N-D38N-mutant, D31N-D93N-mutant, and D38ND93N-mutant), and three mutations (i.e. D31N-D38ND93N-mutant and D38N-E92Q-D93N-mutant) were in the range of pH 4.5–5.5, but that of the mutant with four mutations (i.e. D31N-D38N-E92Q-D93N-mutant) was 7.0. This finding indicated that all these four amino acid mutations are necessary to shift the optimum pH to 7.0. In addition, 12-mutant-He1 inhibited human tumor cell line proliferation, whereas 4-mutantHe1 did not. We have previously suggested that the inhibition of cell proliferation by RNase Po1 was caused by positive charges on its molecular surface in addition to its structural stability and optimum pH.7) This is because cancer cells have a distinctly higher negative charge compared to normal cells;16) hence, it
216
H. Kobayashi et al.
proliferation. Importantly, inhibition of human tumor cell line proliferation coupled with high enzymatic stability, optimum pH for RNase activity matching that of tumor cells, and the presence of positive charges on the surface far from the active site, which are potentially important for the lipid bilayer translocation, are positive aspects that can be utilized in the development of anticancer drugs. Further investigations on the relationship between the structure and the antitumor activity of RNase Po1 and RNase He1 from mushrooms may lead to the development of new anticancer biologics that are based on RNase activity.
Downloaded by [FU Berlin] at 03:10 12 May 2015
Funding Fig. 6. The structural model of 12mutant-He1. Notes: The location of the site-directed mutants of RNase He1 by structural modeling with the crystal structure of RNase Po1 as a template (PDB ID: 3WHO). The figure was drawn with PyMOL (http:// pymol.sourceforge.net). α-Helices and β-strands are marked α1 and β1–7, respectively. Active site residues of RNase He1 are colored in red. The locations of the mutated amino acid residues in RNase He1 are colored in green. The amino acid numbers of RNase Po1 are shown followed by those of RNase He1 in parentheses.
was hypothesized that higher cationic charge increased binding efficiency to the cancer cell surface via electrostatic interactions. It has been previously reported that onconase, a member of the RNase A family that exhibits antitumor activity in human tumor cell lines,17) is highly cationic and is specifically toxic to cancer cells.18) Similarly, we speculate that RNase Po1 may be specifically toxic to cancer cells; therefore, in our future studies we plan to determine the differences in the toxic effect of RNase Po1 on normal cells and cancer cells. The molecular surface of wild-type RNase He1 was expected to be negatively charged. By replacing 12 acidic amino acid residues with Asn/Glu, the pI value of RNase He1 shifted from 4.2 to 7.8; since eight of these mutated amino acid residues were located on the molecular surface, the molecular surface of 12-mutantHe1 was positively charged. In contrast, similar to the finding for the wild-type enzyme, the pI value of 4mutant-He1 was pH 4.5, because the eight acidic amino acid residues on the surface of the enzyme were the same as those of the wild-type RNase He1. Thus, its molecular surface remained negatively charged. We speculated that the major reason as to why 4mutant-He1 did not inhibit proliferation in spite of its optimum pH (pH 7.0) was the presence of negative charges on its molecular surface. This suggests that a positively charged surface might be more essential to inhibit cell proliferation than high RNase activity. In the future, we will determine the X-ray structure of RNase He1 to clarify the structure–antitumor activity relationship. In conclusion, we successfully changed the optimum pH for the activity of RNase He1 by modifying the electrical charges around the catalytically active amino acid residues. Moreover, Asp/Glu site-directed mutants of RNase He1inhibited human tumor cell line
This work was supported by the Platform for Drug Discovery, Informatics, and Structural Life Science from the Ministry of Education, Culture, Sports, Science and Technology, Japan. This work was performed under the Cooperative Research Program of Institute for Protein Research, Osaka University.
References [1] Yoshida H. The ribonuclease T1 family. In: Nicolson, AW, editor. Methods in enzymology. Vol. 341. New York (NY): Academic Press; 2001. p. 28–41. [2] Nomura H, Inokuchi N, Kobayashi H, Koyama T, Iwama M, Ohgi K, Irie M. Purification and primary structure of a new guanylic acid specific ribonuclease from Pleurotus ostreatus. J. Biochem. 1994;116:26–33. [3] Takahashi K. The amino acid sequence of ribonuclease T-1. J. Biol. Chem. 1971;240:4117–4119. [4] Watanabe H, Ohgi K, Irie M. Primary structure of a minor ribonuclease from Aspergillus saitoi. J. Biochem. 1982;91:1495– 1509. [5] Kobayashi H, Motoyoshi N, Itagaki T, Tabata K, Suzuki T, Inokuchi N. The inhibition of human tumor cell proliferation by RNase Pol, a member of the RNase T1 family, from Pleurotus ostreatus. Biosci. Biotechnol. Biochem. 2013;77:1486–1491. [6] Sacco G, Drickamer K. Wool IG. The primary structure of the cytotoxin alpha-sarcin. J. Biol. Chem. 1983;258:5811–5818. [7] Kobayashi H, Katsutani T, Hara Y, Motoyoshi N, Itagaki T, Akita F, Higashiura A, Yamada Y, Inokuchi N, Suzuki M. X-ray crystallographic structure of RNase Po1 that exhibits anti-tumor activity. Biol. Pharm. Bull. 2014;37:968–978. [8] Irie M. Isolation and properties of a ribonuclease from Aspergillus saitoi. J. Biochem. 1967;62:509–518. [9] Sanger F, Coulson A. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol. 1975;94:441–448. [10] Huang HC, Wang SC, Leu YJ, Lu SC, Liao YD. The Rana catesbeiana rcr gene encoding a cytotoxic ribonuclease. Tissue distribution, cloning, purification, cytotoxicity, and active residues for RNase activity. J. Biol. Chem. 1998;273:6395–6401. [11] Ohgi K, Horiuchi H, Watanabe H, Iwama M, Takagi M, Irie M. Role of Asp51 and Glu105 in the enzymatic activity of a ribonuclease from Rhizopus niveus. J. Biochem. 1993;113:219–224. [12] Titani K, Takio K, Kuwada M, Nitta K, Sakakibara K, Kawauchi H, Takayanagi G, Hakomori S. Amino acid sequence of sialic acid binding lectin from frog (Rana catesbeiana) eggs. Biochemistry. 1987;26:2189–2194. [13] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics. 2006;22:195–201. [14] Schaagger H. von Jagow G. Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 1987;166: 368–379.
Inhibition of tumor cell proliferation by recombinant-He1
Downloaded by [FU Berlin] at 03:10 12 May 2015
[15] Arni R, Heinemann U, Tokuoka R, Saenger W. Three-dimensional structure of the ribonuclease T1/2′-GMP complex at 1.9-A resolution. J. Biol. Chem. 1998;263:15358–15368. [16] Abercrombie M, Ambrose EJ. The surface properties of cancer cells. Cancer Res. 1962;22:525–548.
217
[17] Ardelt W, Mikulski SM, Shogen K. Homology to pancreatic activity, ribonucleases. J. Biol. Chem. 1991;266:245–251. [18] Ardelt W, Shogen K, Darzynkiewicz Z. Onconase and amphinase, the antitumor ribonucleases from Rana pipiens oocytes. Curr. Pharm. Biotechnol. 2008;9:215–225.
Bioscience, Biotechnology, and Biochemistry Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbbb20
Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation a
a
a
b
a
Hiroko Kobayashi , Naomi Motoyoshi , Tadashi Itagaki , Mamoru Suzuki & Norio Inokuchi a
Department of Microbiology, School of Pharmacy, Nihon University, Chiba, Japan
b
Institute for Protein Research, Osaka University, Suita, Japan Published online: 23 Oct 2014.
Click for updates To cite this article: Hiroko Kobayashi, Naomi Motoyoshi, Tadashi Itagaki, Mamoru Suzuki & Norio Inokuchi (2015) Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation, Bioscience, Biotechnology, and Biochemistry, 79:2, 211-217, DOI: 10.1080/09168451.2014.972327 To link to this article: http://dx.doi.org/10.1080/09168451.2014.972327
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Bioscience, Biotechnology, and Biochemistry, 2015 Vol. 79, No. 2, 211–217
Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation Hiroko Kobayashi1,*, Naomi Motoyoshi1, Tadashi Itagaki1, Mamoru Suzuki2 and Norio Inokuchi1 1
Department of Microbiology, School of Pharmacy, Nihon University, Chiba, Japan; 2Institute for Protein Research, Osaka University, Suita, Japan
Received July 22, 2014; accepted September 9, 2014
Downloaded by [FU Berlin] at 03:10 12 May 2015
http://dx.doi.org/10.1080/09168451.2014.972327
RNase He1 from Hericium erinaceus, a member of the RNase T1 family, has high identity with RNase Po1 from Pleurotus ostreatus with complete conservation of the catalytic sequence. However, the optimal pH for RNase He1 activity is lower than that of RNase Po1, and the enzyme shows little inhibition of human tumor cell proliferation. Hence, to investigate the potential antitumor activity of recombinant RNase He1 and to possibly enhance its optimum pH, we generated RNase He1 mutants by replacing 12 Asn/Gln residues with Asp/Glu residues; the amino acid sequence of RNase Po1 was taken as reference. These mutants were then expressed in Escherichia coli. Using site-directed mutagenesis, we successfully modified the optimal pH for enzyme activity and generated a recombinant RNase He1 that inhibited the proliferation of cells in the human leukemia cell line. These properties are extremely important in the production of anticancer biologics that are based on RNase activity. Key words:
RNase T1 family RNase; Hericium erinaceus; site-directed mutant; inhibition of cell proliferation
RNase He1 from Hericium erinaceus, a member of the RNase T1 family, hydrolyzes single-stranded RNA via a 2′,3′-cyclic phosphate intermediate at the 3′-terminus of oligonucleotides and is guanylic acid-specific. The RNase T1 family includes RNases that are found only in microbes; RNase T1from Aspergillus oryzae is the best-known member. RNase He1 comprises 100
amino acid residues, with a molecular weight of 10,690 Da.1) It exhibits high identity with RNase Po1 (59%) from Pleurotus ostreatus2) and RNase T1 (39%).3) The active site of RNase He1 is well conserved compared to that of RNase T1 and RNase Po1 (Fig. 1). RNase He1 and RNase Po1 from edible mushrooms contain six cysteine residues (two more than other RNases), which makes them more heat stable than others. The optimum pH for enzymatic activity of most RNases of the T1 family, including RNase Po1 and RNase T1, is 7.5; however, the optimum pH for RNase He1 is 4.5, similar to that of RNase Ms. from Aspergillus saitoi.4) RNase Po1 inhibits human tumor cell line proliferation5) similar to α-sarcin from Aspergillus giganteus.6) Although RNase He1 does not inhibit human tumor cell line proliferation, it exhibits high identity with RNase Po1. The pI of RNase He1 is pH 4.2, which is similar to that of RNase T1 (pH 2.9) and of almost all the RNases of the T1 family, while the pI values of RNase Po1 and α-sarcin are pH 9.0 and pH > 8, respectively. On observing the X-ray crystallographic structure of RNase Po1, we suggested that its high stability is due to the presence of disulfide bonds, and its positive charges on the surface are responsible for its antitumor activity.7) In this study, to possibly modify the optimum pH of RNase He1 and to investigate whether it could potentially exhibit antitumor activity, we substituted the aspartic acid/glutamic acid residues of RNase He1 with asparagine/glutamine residues, using RNase Po 1 as reference, and compared the enzymatic properties and inhibition of human leukemia cell line proliferation of the wild-type protein with those of its site-directed mutants.
*Corresponding author. Email: [email protected] Abbreviations: DEAE, diethylaminoethyl; FBS, fetal bovine serum; HPLC, high-performance liquid chromatography; IC50, half-maximal inhibitory concentration of a substance; IPTG, β-D-1-thiogalactopyranoside; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; pI, isoelectric point; RNase, ribonuclease; SP, sulfopropyl; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; PCR, polymerase chain reaction. © 2014 Japan Society for Bioscience, Biotechnology, and Agrochemistry
212
H. Kobayashi et al.
Downloaded by [FU Berlin] at 03:10 12 May 2015
Fig. 1. Comparison of the amino acid sequences of RNase He1, RNase Po1, RNase T1, and RNase Ms. Notes: He1, RNase He1 from H. erinaceus; Po1, RNase Po15) from P. ostreatus; Ms, RNase Ms2) from A. saitoi; and T1, RNase T113) from A. oryzae. Numbers above the alignment correspond to the RNase He1 numbering. Residues in common with RNase He1 are shaded. ★: Catalytic site. The amino acid residues that were mutated are indicated by arrows. The site-directed mutants of RNase He1 are enclosed by dotted lines: 12RHe1, RNase He1 containing 12 mutations (12-mutant-He1); 4RHe1, RNase He1 containing four mutations (4-mutant-He1). The amino acid residues mutated into Asn or Gln in the two mutants are enclosed in the boxes.
Materials and methods Enzyme assay. RNase activity was measured as described in a previous paper using 0.25 mg/mL yeast RNA (Wako Pure Chemical Industries, Osaka, Japan) as a substrate at pH 4.5 or pH 7.5 and a temperature of 37 °C.8) Protein estimation. The protein concentration of the final enzyme preparation was determined spectrophotometrically, assuming an absorbance of 0.905 for a 0.1% solution at 280 nm. This value was estimated from the amino acid composition of RNase He1 (data not shown). Preparation of site-directed mutants of RNase He1 at aspartic acid/glutamic acid residues. Total RNA of H. erinaceus was extracted using TRIZOL reagent (Gibco BRL, Gaithersburg, MD, USA). He1-encoding cDNA (DDBJ accession number AB429363) was obtained from the total RNA using the primers 5′-Nco1 He1 and 3′-BamHe1 designed according to the cDNA sequence of RNase He1. The site-directed mutant of RNase He1 containing 12 mutations (12-mutant-He1) was generated by PCR using the primers FNco1Q1-G30: [gccatggcgCAGTCCGGCGGATGCTCCTGCGCTGGGAGGAGTTACTCTTCGAGCAACATTGCCAACGCGATCAACCAGGCTCAAGGGAGGGGTGGAGGC], FN19-R58: [AACGCGATCAACCAGGCTCAAGGGAGG GGTGGAGGCAACTACCCTCACCAATATCACAACTACGAGGGCTTCTCGTTCCCATCGTGCAGAGGCCAGTTCTTCGAGTACCCGCTCCAACGC], and R59S-F100 BamH1: [gggatccTCAGAAATTGCATTCTACAAAACCGTTCTGGGTCGATGCCCCAGTGTGAGTTAGACAAGCGCAGAAGTTGCCGTTCTG-GTCGTAGATGACACGGTCTGCGCCGGGACTGCCGCCCGTGTAGACACCGCT] (the mutated bases are underlined, the codon of mutated amino acid
residues are shown in bold). The primer F-Nco1Q1-G30 was used to generate three mutations (i.e. D19N, D22N, and E25Q), the primer F-N19-R58 was used to generate seven mutations (i.e. D19N, D22N, E25Q, D31N, D38N, E50Q, and E57Q), and the primer R-59S-100FBamH1 was used to generate five mutations (i.e. E76Q, D77N, D79N, E92Q, and D93N). The nucleotide sequence of the mutants was confirmed using a DNA sequencer (CEQ8000, Beckman, Brea, CA, USA) using the method proposed by Sanger and Coulson.9) The mutant of RNase He1 containing four mutations (4-mutant-He1: D31N, D38N, E92Q, and D93N) was generated by PCR using two primers. Forward primer f-D19R58 was designed to return the five amino acids (D19N, D22N, E25Q, E50Q, and E57Q) to the wild-type RNase He1 amino acids (N19D, N22D, Q25E, Q50Q, and Q57E) by modifying F-N19R58. Reverse primer r-59S100FBamH1 was designed to return the three amino acids (E76Q, D77N, and D79N) to the wild-type RNase He1 amino acids (Q76E, N77D, and N79D) by modifying R-59S100FBamH1. The nucleotide sequences corresponding to the each amino acid were altered. Construction of the expression vector. The expression vector for the RNase He1 mutants was constructed according to the method by Huang et al.10) The pelB signal sequence was obtained from pE22b. The pelB 3′-end sequence containing Nco1 site was combined with pET11d. Flanking NcoI and BamHI sites were added to the upstream and downstream ends, respectively, of the RNase He1 cDNA by PCR using the FNco1Q1-G30 and R59S-F100BamH1 primers, respectively. Expression and purification of the site-directed mutants. The two site-directed mutants of RNase He1 were expressed in Escherichia coli BL21 (DE3) pLysS in terrific broth containing 100 μg/mL ampicillin and 0.5 mM IPTG (Wako Pure Chemical Industries, Osaka, Japan) for 6 d at 25 °C. The culture medium was centrifuged at 12,000 × g for 30 min. The enzymes were precipitated with ammonium sulfate (90% saturation) and loaded onto a Sephadex G50 column (3 × 180 cm; GE Healthcare Uppsala, Sweden) equilibrated with 10 mM acetate buffer (pH 6.0). The RNase-active fractions of 12-mutant-He1 were pooled and loaded onto a SP-Toyopearl column (3 × 30 cm; TOSOH, Tokyo, Japan) equilibrated with 10 mM acetate buffer (pH 6.0) and eluted with the same buffer containing NaCl (0–0.5 M) with a linear gradient. The RNase-active fractions were pooled and loaded onto a DEAE-Toyopearl column (1.5 × 40 cm; TOSOH) equilibrated with 10 mM Tris–HCl buffer (pH 7.5) and were eluted with the same buffer containing NaCl (0–0.3 M) with a linear gradient. The RNase-active fractions were loaded onto an Ultrogel AcA54 column (3 × 180 cm; GE Healthcare) equilibrated with 10 mM acetate buffer (pH 6.0). The RNase-active fractions were loaded onto a heparin-Sepharose column (1.0 × 20 cm; GE Healthcare) equilibrated with 10 mM acetate buffer (pH 4.5) and were eluted with the same buffer containing NaCl
Downloaded by [FU Berlin] at 03:10 12 May 2015
Inhibition of tumor cell proliferation by recombinant-He1
(0–0.3 M) with a linear gradient. The RNase-active fractions were pooled and dialyzed overnight using a dialysis membrane (Spectra/Pro 7 with 3.5-kD cut-off; Spectrum Labs, Dominquez, CA) against deionized water. The dialyzed enzymes were loaded onto an HPLC (SHIMADZU, LC6A, Kyoto, Japan) system using a Shodex protein kw802.5 column (0.8 × 80 cm; SHOWA DENKO, Nagoya, Japan), equilibrated with 5 mM trimethylamine acetate buffer (pH 6.0), and eluted with the same buffer. The RNase-active fractions were pooled as purified enzymes. Using the Sephadex G50, 4-mutant-He1was eluted in the same way as 12-mutant-He1. Next, the active fractions were loaded onto a DEAE-Toyopearl column (1.5 × 40 cm; TOSOH) equilibrated with 10 mM acetate buffer (pH 5.5) and were eluted with a linear gradient using the same buffer containing NaCl (0–0.3 M). The RNase-active fractions were then loaded onto an Ultrogel AcA54 column (3 × 180 cm) equilibrated with 10 mM acetate buffer (pH 6.0). The chromatography was repeated once, and the eluates were then loaded onto a heparin-Sepharose column for further purification. Finally, the fractions were loaded onto an HPLC (SHIMADZU, LC6A, Kyoto, Japan) column, Shodex protein kw802.5. Chromatography was performed under the same condition as that used for 12-mutant-He1.
Base specificity. Base specificity of 12-mutant-He1 was measured by measuring the rates of release of 3′guanosine monophosphate (GMP) and 2′, 3′-cyclic guanosine monophosphate (cGMP) from the yeast RNA. The rates of release of nucleotides were determined by analyzing the hydrolysis products via reversed-phase HPLC using a TSK gel carbon 500 column (TOSOH, Tokyo, Japan), as described previously.11)
Effect of the site-directed mutants of RNase He1 on the proliferation of human leukemia cells. The antiproliferative activity of RNase He1, RNase Po1, and site-directed mutants of RNase Hel (4-mutant-He1, 12mutant-He1) was measured using human leukemia cells (HL-60 and Jurkat cell lines; Health Science Research Resources Bank, Osaka, Japan). According to the method of Titani et al.12) HL-60 cells were pre-cultured in RPMI 1640 (Invitrogen, Carlsbad CA, USA) containing 10% fetal calf serum (Bio West, Strasbourg, France); 200 μL of cell suspension (3 × 105 cells/mL) was supplemented with 10 μL of the RNase. After 72 h of incubation at 37 °C under 5% CO2, viable cells were counted using the MTT assay performed according to the manufacturer’s instructions (Dojindo Laboratories, Kumamoto, Japan). The inhibition of cell proliferation was calculated as the percent decrease in final cell number compared to that in the absence of RNases. The structural model of 12-mutant-He1. The structural model of 12-mutant-He1 was constructed by employing the web server SWISS-MODEL13) with the crystal structure of RNase Po1 (PDB ID; 3WHO) as template.7)
213
Results Expression and purification of the site-directed mutants of RNase He1 We substituted 12 aspartic acid/glutamic acid residues of RNase He1 with asparagine/glutamine residues, using RNase Po 1 as a reference (12-mutant-He1: D19N, D22N, E25Q, D31N, D38N, E50Q, E57Q, E76Q, D77N, D79N, E92Q, and D93N). Moreover, we mutated four amino acid residues of RNase He1 that appeared to be near the catalytic site of RNase He1 (4mutant-He1: D31N, D38N, E92Q, and D93N) (Fig. 1). We expressed the site-directed mutants of RNase He1 (12-mutant-He1) in E. coli; the resulting preparation (3.0 mg from 3 L of culture medium) of 12-mutantHe1 was purified to homogeneity, and was confirmed by Tricine-SDS-PAGE,14) with a net yield of 21.0%. 4-mutant-He1 (3.0 mg from 1 L of culture medium) was purified to homogeneity with a net yield of 22.0% (Table 1, Fig. 2). Base specificity In the hydrolysis test, we found that both wild-type RNase He1 and 12-mutant-He1 formed 3′-GMP and 2′, 3′-GMP, indicating that RNase He1 was guanilic acidspecific and that the mutations introduced did not affect this specificity (Fig. 3). Enzymatic properties of RNase He1 The optimum temperature for RNase He1 catalytic activity was measured using RNA as the substrate and temperatures in the range of 20–80 °C for 20 min under the assay conditions described (Fig. 4(a)). The optimal temperature range for catalysis by 12-mutantHe1 was 65–70 °C, which was the same as that of RNase Po1 and RNase He1, but higher than that of RNase T1 (50 °C). The optimal pH for 12-mutantHe1activity, measured using RNA as the substrate, was 7.5, which was higher than that of wild-type RNase He1 (pH 4.5) Thus, the optimal pH of 12-mutant-He1 was the same as that of RNase Po1 and RNase T1.5) Moreover, the optimal pH for the activity of 4-mutantHe1 was 7.0, which was almost the same as that of 12-mutant-He1 (Fig. 4(b)). Effects of mutant-He1 on the proliferation of human leukemia cells The effects of two mutant-He1s on the proliferation of human leukemia cell lines (i.e. HL-60 and Jurkat cells) were studied. RNase Po1 showed remarkable proliferation inhibitory activity toward HL-60 cells (IC50 = 0.1 μM), whereas RNase He1 had a little effect. Similarly, 4-mutant-He1 also did not show proliferation inhibitory activity. 12-mutant-He1 inhibited the proliferation of HL-60 cells (IC50 = 0.1 μM) and Jurkat cells (IC50 = 2.0 μM) at a level similar to that of RNase Po1 (IC50 = 1.0 μM) (Fig. 5). The structural model of 12-mutant-He1 We confirmed the location of site-directed mutants of RNase He1 by structural modeling using the crystal
214 Table 1.
Downloaded by [FU Berlin] at 03:10 12 May 2015
Step
H. Kobayashi et al. Purification of 12RHe1 and 4RHe1. Total activity（units）
Total protein (mg)
Specific activity (units/mg)
Yield (%)
(A) Purification of 12RHe1 from culture medium (3 L) of E. coli transformed with pET11d-pelB-12RHe1 Crude extract 29,100 24,400 24,200 17,100 (NH4)2SO4 fraction (0–0.9s) Sephadex G-50 (pH 6.0) 22,500 2440 SP-Toyopearl (pH 5.0) 22,100 364 DEAE-Toyopearl (pH 5.0) 21,000 87 Ultrogel AcA54 (pH 6.0) 14,600 73 Heparin-Sepharose (pH 4.5) 14,500 14.1 Shodex kw-802.5 HPLC (pH 6.0) 6000 3.1
1.2 1.4 9.1 61.9 249 200 1040 1940
100 83 76 78 72 50 50 21
(B) Purification of 4RHe1 from culture medium (1 L) of E. coli transformed with pET11d-pelB-4RHe1 Crude extract 11,400 8100 (NH4)2SO4 fraction (0–0.9s) 6700 4900 Sephadex G-50 (pH 6.0) 6300 1700 DEAE-Toyopearl (pH 5.0) 5300 174 Ultro gel AcA54 (pH 6.0) 3800 105 DEAE-Toyopearl (pH 5.0) 3400 49 Ultrogel AcA54 (pH 6.0) 2900 9.5 Heparin-Sepharose (pH 4.5) 2700 4.7 Shodex kw-802.5 HPLC (pH 6.0) 2500 3.9
1.4 1.4 3.7 30 36 69 305 574 615
100 58 55 46 33 29 26 23 22
located in or near the active site. D31N was positioned toward the side chain of H34, and E92Q, D93N were close to the side chain of H86. D38N was located in the loop containing the guanine recognition site.
Discussion
Fig. 2. Tricine-SDS-PAGE of two mutant-He1s. Notes: The details of the procedure are described in the text. a: Silver staining of molecular marker proteins. b: Silver staining of mutant-He1. (a), 12mutant-He1, (b), 4-mutant-He1.
structure of RNase Po1 as a template (Fig. 6). Eight of 12 mutated amino acid residues were located on the enzyme surface, and the other four mutated amino acid residues i.e. D31N, D38N, E92Q, and D93N were
RNase He1 from the mushroom H. erinaceus exhibited high identity with RNase Po1, but unlike RNase Po1, it did not exhibit proliferation inhibitory activity toward human tumor cells. By comparing the primary structures of RNases He1 and RNase Po1, four amino acid residues in the active site of RNase T115) and six cysteine residues were conserved, whereas many other amino acids were replaced by acidic amino acid residues (i.e. Asp/Glu) in RNase He1. Therefore, we prepared a mutant of RNase He1 in which seven aspartic acid and five glutamic acid residues were replaced with asparagine and glutamine residues, namely 12-mutantHe1. We expressed the mutant in E. coli and purified it to homogeneity, as confirmed by Tricine-SDS-PAGE. The 12-mutant-He1 exhibited the same guanine specificity and heat stability as the wild-type RNase He1. However, the optimum pH for the activity of RNase
Fig. 3. Release of nucleotides upon digestion of RNA with RNase He1 and 12-mutant-He1. The hydrolysis and separation conditions are described in the text. Symbols: －●－, 2′,3′ cGMP; - - -●- - -, 3′GMP; －▲－, 2′,3′ cAMP + 3′ AMP; －■－, 2′,3′ cCMP + 3′CMP; and －○－, 2′,3′ cUMP + 3′UMP.
Inhibition of tumor cell proliferation by recombinant-He1
(a)
215
(b)
Downloaded by [FU Berlin] at 03:10 12 May 2015
Fig. 4. Effect of the temperature and pH on the enzymatic activities of RNase He1, 12-mutant-He1, and 4-mutant-He1. Notes: (a) Effect of the temperature on the enzymatic activities of RNase He1, 12-mutant-He1, and RNase T1. Enzyme activity was determined as described in the text using RNA as the substrate at various temperatures. The buffers (0.01 M) contained 1 mg/mL bovine serum albumin and 0.2 M NaCl. Activity was expressed as a percentage of the maximum activity. Symbols: ●, 12-mutant-He1; ○, RNase He1; and ▲, RNase T1. (b) Effect of pH on the enzymatic activity of RNase He1 and two mutants of RNase He1 (i.e. 4mutant-He1 and 12mutant-He1). Enzyme activity was determined as described in the text using RNA as the substrate. The buffers (0.01 M) used were acetate-NaOH buffer for pH 5.5–6.0 and Tris–HCl buffer for pH 6.5–8.5. Activity was expressed as a percentage of the maximum activity. Symbols: ●,4-mutantn-He1; ▲, 12-mutant-He1; and ○, RNase He1.
Fig. 5. Effects of 12mutant-He1, 4mutant-He1, and RNase He1 on the proliferation of HL-60 and Jurkat cells as determined with the MTT Assay. Notes: Each point is the mean of three replicates and is reported as the percentage of the control, which lacked RNase. Cells were treated with a given concentration of RNases for 72 h. Cell proliferation without RNase was normalized to 100%. Symbols: ▲, RNase Po1; ●, 12mutant-He1; ○, RNase He1; ■, and 4mutant-He1.
He1 changed from 4.5 to 7.5 after the mutations. Moreover, 12-mutant-He1 inhibited the proliferation of HL60 and Jurkat cell lines, similar to RNase Po1. The tertiary structure of RNase Po17) comprises an α-helix and a four-β-stranded antiparallel β-sheet crossing the α-helix. The catalytically active amino acid residues of RNase Po1 (i.e. H36, D54, R72, and H87) are located in the β-strands 3–6, which form the catalytic pocket, and are adjacent to the β-strand 6 (Fig. 6). We predicted the location of the amino acid residues introduced with the mutations in RNase He1 via the structural modeling of 12-mutant-He1 with RNase Po1 as a template. D31N, E92Q, D93N, and D38N residues are near or in the active site. The other mutated amino acid residues were on the molecular surface and, therefore, too far to interact with the catalytically active amino acid residues. We also generated a mutant of RNase He1 containing four mutations (4-mutant-He1). The
optimum pH values for the activity of the mutants with a single mutation (i.e. D31N-mutant, D38N-mutant, E92Q-mutant, and D93N-mutant), two mutations (i.e. D31N-D38N-mutant, D31N-D93N-mutant, and D38ND93N-mutant), and three mutations (i.e. D31N-D38ND93N-mutant and D38N-E92Q-D93N-mutant) were in the range of pH 4.5–5.5, but that of the mutant with four mutations (i.e. D31N-D38N-E92Q-D93N-mutant) was 7.0. This finding indicated that all these four amino acid mutations are necessary to shift the optimum pH to 7.0. In addition, 12-mutant-He1 inhibited human tumor cell line proliferation, whereas 4-mutantHe1 did not. We have previously suggested that the inhibition of cell proliferation by RNase Po1 was caused by positive charges on its molecular surface in addition to its structural stability and optimum pH.7) This is because cancer cells have a distinctly higher negative charge compared to normal cells;16) hence, it
216
H. Kobayashi et al.
proliferation. Importantly, inhibition of human tumor cell line proliferation coupled with high enzymatic stability, optimum pH for RNase activity matching that of tumor cells, and the presence of positive charges on the surface far from the active site, which are potentially important for the lipid bilayer translocation, are positive aspects that can be utilized in the development of anticancer drugs. Further investigations on the relationship between the structure and the antitumor activity of RNase Po1 and RNase He1 from mushrooms may lead to the development of new anticancer biologics that are based on RNase activity.
Downloaded by [FU Berlin] at 03:10 12 May 2015
Funding Fig. 6. The structural model of 12mutant-He1. Notes: The location of the site-directed mutants of RNase He1 by structural modeling with the crystal structure of RNase Po1 as a template (PDB ID: 3WHO). The figure was drawn with PyMOL (http:// pymol.sourceforge.net). α-Helices and β-strands are marked α1 and β1–7, respectively. Active site residues of RNase He1 are colored in red. The locations of the mutated amino acid residues in RNase He1 are colored in green. The amino acid numbers of RNase Po1 are shown followed by those of RNase He1 in parentheses.
was hypothesized that higher cationic charge increased binding efficiency to the cancer cell surface via electrostatic interactions. It has been previously reported that onconase, a member of the RNase A family that exhibits antitumor activity in human tumor cell lines,17) is highly cationic and is specifically toxic to cancer cells.18) Similarly, we speculate that RNase Po1 may be specifically toxic to cancer cells; therefore, in our future studies we plan to determine the differences in the toxic effect of RNase Po1 on normal cells and cancer cells. The molecular surface of wild-type RNase He1 was expected to be negatively charged. By replacing 12 acidic amino acid residues with Asn/Glu, the pI value of RNase He1 shifted from 4.2 to 7.8; since eight of these mutated amino acid residues were located on the molecular surface, the molecular surface of 12-mutantHe1 was positively charged. In contrast, similar to the finding for the wild-type enzyme, the pI value of 4mutant-He1 was pH 4.5, because the eight acidic amino acid residues on the surface of the enzyme were the same as those of the wild-type RNase He1. Thus, its molecular surface remained negatively charged. We speculated that the major reason as to why 4mutant-He1 did not inhibit proliferation in spite of its optimum pH (pH 7.0) was the presence of negative charges on its molecular surface. This suggests that a positively charged surface might be more essential to inhibit cell proliferation than high RNase activity. In the future, we will determine the X-ray structure of RNase He1 to clarify the structure–antitumor activity relationship. In conclusion, we successfully changed the optimum pH for the activity of RNase He1 by modifying the electrical charges around the catalytically active amino acid residues. Moreover, Asp/Glu site-directed mutants of RNase He1inhibited human tumor cell line
This work was supported by the Platform for Drug Discovery, Informatics, and Structural Life Science from the Ministry of Education, Culture, Sports, Science and Technology, Japan. This work was performed under the Cooperative Research Program of Institute for Protein Research, Osaka University.
References [1] Yoshida H. The ribonuclease T1 family. In: Nicolson, AW, editor. Methods in enzymology. Vol. 341. New York (NY): Academic Press; 2001. p. 28–41. [2] Nomura H, Inokuchi N, Kobayashi H, Koyama T, Iwama M, Ohgi K, Irie M. Purification and primary structure of a new guanylic acid specific ribonuclease from Pleurotus ostreatus. J. Biochem. 1994;116:26–33. [3] Takahashi K. The amino acid sequence of ribonuclease T-1. J. Biol. Chem. 1971;240:4117–4119. [4] Watanabe H, Ohgi K, Irie M. Primary structure of a minor ribonuclease from Aspergillus saitoi. J. Biochem. 1982;91:1495– 1509. [5] Kobayashi H, Motoyoshi N, Itagaki T, Tabata K, Suzuki T, Inokuchi N. The inhibition of human tumor cell proliferation by RNase Pol, a member of the RNase T1 family, from Pleurotus ostreatus. Biosci. Biotechnol. Biochem. 2013;77:1486–1491. [6] Sacco G, Drickamer K. Wool IG. The primary structure of the cytotoxin alpha-sarcin. J. Biol. Chem. 1983;258:5811–5818. [7] Kobayashi H, Katsutani T, Hara Y, Motoyoshi N, Itagaki T, Akita F, Higashiura A, Yamada Y, Inokuchi N, Suzuki M. X-ray crystallographic structure of RNase Po1 that exhibits anti-tumor activity. Biol. Pharm. Bull. 2014;37:968–978. [8] Irie M. Isolation and properties of a ribonuclease from Aspergillus saitoi. J. Biochem. 1967;62:509–518. [9] Sanger F, Coulson A. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol. 1975;94:441–448. [10] Huang HC, Wang SC, Leu YJ, Lu SC, Liao YD. The Rana catesbeiana rcr gene encoding a cytotoxic ribonuclease. Tissue distribution, cloning, purification, cytotoxicity, and active residues for RNase activity. J. Biol. Chem. 1998;273:6395–6401. [11] Ohgi K, Horiuchi H, Watanabe H, Iwama M, Takagi M, Irie M. Role of Asp51 and Glu105 in the enzymatic activity of a ribonuclease from Rhizopus niveus. J. Biochem. 1993;113:219–224. [12] Titani K, Takio K, Kuwada M, Nitta K, Sakakibara K, Kawauchi H, Takayanagi G, Hakomori S. Amino acid sequence of sialic acid binding lectin from frog (Rana catesbeiana) eggs. Biochemistry. 1987;26:2189–2194. [13] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics. 2006;22:195–201. [14] Schaagger H. von Jagow G. Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 1987;166: 368–379.
Inhibition of tumor cell proliferation by recombinant-He1
Downloaded by [FU Berlin] at 03:10 12 May 2015
[15] Arni R, Heinemann U, Tokuoka R, Saenger W. Three-dimensional structure of the ribonuclease T1/2′-GMP complex at 1.9-A resolution. J. Biol. Chem. 1998;263:15358–15368. [16] Abercrombie M, Ambrose EJ. The surface properties of cancer cells. Cancer Res. 1962;22:525–548.
217
[17] Ardelt W, Mikulski SM, Shogen K. Homology to pancreatic activity, ribonucleases. J. Biol. Chem. 1991;266:245–251. [18] Ardelt W, Shogen K, Darzynkiewicz Z. Onconase and amphinase, the antitumor ribonucleases from Rana pipiens oocytes. Curr. Pharm. Biotechnol. 2008;9:215–225.
