Journal of Medical Virology 87:1192–1198 (2015)
Genotyping of Hepatitis B and C Virus Russian Isolates for Reference Serum Panel Construction Rinat A. Maksyutov,* Elena V. Gavrilova, Amir Z. Maksyutov, and Aleksandr N. Kanev State Research Center of Virology and Biotechnology “Vector”, Koltsovo, Novosibirsk Region, Russia
Approximately 2% and 5% of the world human population is estimated to be infected with HCV and HBV, respectively. Reference panels of HCV and HBV serum samples with defined genotypes and serotypes is necessary for monitoring of the specificity and sensitivity of diagnostic test kits. The aim of this study was to determine genotypes/serotypes of HBV and HCV circulating in Russia in order to construct a panel of reference sera containing these HCV genotypes and HBV serotypes. A total of 343 HBsAg-positive and 207 anti-HCV positive serum samples were collected from patients with HBV and HCV infection from different cities between years 2002 and 2010 in St. Petersburg, Krasnodar, Nizhny Novgorod, Novosibirsk, Barnaul, Gorno-Altaisk, and Khabarovsk. HBV DNA was found in 76.4% of HBsAg positive samples by PCR for the S gene and HCV RNA was found in 71.5, 70.0, and 64.7% of anti-HCV positive samples in the 50 UTR, Core, and NS5B regions, respectively. The prevalence and proportion of HBV genotype/serotype associations were as follows: A/adw2, 2.1%; D/ayw2, 54.0%; D/ayw3, 43.1%; D/adw2, 0.7%. A new combination of genotype D and adw2 serotype was discovered. The distribution of HCV genotypes was the following: 43.6%, b; 3.8%, 2a; and 52.6%, 3a. Russian National reference panels of HBV and HCV lyophilized sera were developed to monitor specificity and sensitivity of approved kits and for the certification of newly developed assays. J. Med. Virol. 87:1192– 1198, 2015. # 2015 Wiley Periodicals, Inc.
be infected with HCV and HBV, respectively [Perz et al., 2006]. Based on the high level of genome heterogeneity, HCV has been classified into six genotypes [Simmonds et al., 2005] and HBV has been classified into eight (A–H) genotypes [Arauz-Ruiz et al., 2002]. HCV heterogeneity is responsible for the failure of effective vaccine development and is clinically significant since HCV genotypes are associated with drug treatment regimen [Pawlotsky, 2004]. Human serum samples are tested for anti-hepatitis C virus antibodies using enzyme-linked immunosorbent assay based on several HCV antigens—Core, NS3, NS4, and NS5—as individual recombinant proteins or, for example, in the form of single multiple epitope fusion antigen [Chien et al., 1999]. In spite of the proven efficacy for blood screening and for the diagnosis of HCV infection in symptomatic patients, it is important to continue monitoring assays for their ability to detect samples with low titer anti-HCV antibodies of all genotypes. Thus, development of a reference panel of HCV serum samples with defined genotypes, including samples with low titer anti-HCV antibodies, is necessary to control the quality of diagnostic test kits. HCV genotype representation in reference panels must correspond to the prevalence of the different genotypes in the geographic area in which reference panel is going to be used. National reference panel for Russia should be composed of lyophilized sera containing HCV samples of 1b, 2a, and 3a genotypes [Kovalev et al., 2003; Shustov et al., 2005; Paintsil et al., 2009].
KEY WORDS:
Grant sponsor: US Ministry of Health and Social Security (DHHS, BTEP) under the contract with the International Science and Technology Center (ISTC), Projects number 3526p and number 1803p. Correspondence to: Rinat A. Maksyutov, State Research Center of Virology and Biotechnology “Vector”, Koltsovo, Novosibirsk Region 630559, Russia. E-mail: [email protected] Accepted 26 January 2015
HBV; HCV; genotypes; Russia; reference serum panel
INTRODUCTION Hepatitis C virus (HCV) and hepatitis B virus (HBV) are associated with chronic liver disease, cirrhosis of liver, and hepatocellular carcinoma. Approximately 2% and 5% of the world human population is estimated to C 2015 WILEY PERIODICALS, INC.
DOI 10.1002/jmv.24170 Published online 10 March 2015 in Wiley Online Library (wileyonlinelibrary.com).
Genotyping of HBV and HCV in Russia
1193
Similarly, the presence of HBsAg in the blood is the specific serologic marker for HBV infection and there are a number of sensitive enzyme immunoassays (EIA) that have improved the detection of HBV. However, it was recognized that there may be individuals with acute and chronic hepatitis B infection and asymptomatic patients where HBsAg levels may be too low to detect with EIAs [Satoh et al., 2008]. The antigenic determinants of HBsAg are classified into 10 immunological serotypes: ayw1, ayw2, ayw3, ayw4, adw2, adw3, adw4, ayr, adrq, adrqþ [Purdy et al., 2007] and Russian National reference panel should be composed of lyophilized sera containing HBV samples of ayw2, ayw3, adw2 serotypes of HBsAg, since they predominate in this country [Tallo et al., 2004, 2008]. The aim of this study was to determine genotypes and serotypes of HBV samples and genotypes of HCV samples in patients with chronic hepatitis B and C collected from cities located in different geographic regions of Russia in order to construct panels of reference sera composed of HBV and HCV genotypes circulating in Russia. MATERIALS AND METHODS A total of 343 HBsAg-positive serum samples were collected from patients with chronic HBV infection and 207 anti-HCV positive serum samples were collected from patients with chronic HCV infection in cities located in different geographic regions of Russia between years 2002 and 2010. The cities include St. Petersburg, Krasnodar, Nizhny Novgorod, Novosibirsk, Barnaul, Gorno-Altaisk, and Khabarovsk. HBsAg-positive samples were not collected in Barnaul and anti-HCV positive samples were not collected in Gorno-Altaisk and Nizhny Novgorod. All patients were from infectious hospitals or AIDS Centers. Samples from patients co-infected with HBV, HCV or HIV were excluded. Informed consent was obtained from each patient. Ethical Approval was given by Institutional Review Board at State
Research Center of Virology and Biotechnology “Vector”. All serum samples were stored at 20 ˚C until use. HBV DNA and HCV RNA were extracted from serum using QIAamp DNA Mini kit (Qiagen, Valencia, CA) and QIAamp MinElute Virus Spin Kit (Qiagen), respectively, according to the manufacturer’s instructions. Briefly, 200 ml of serum was used for DNA/RNA extraction and 50 ml of elution buffer was used for elution. Two-round PCR was performed to amplify S region of HBV DNA [Purdy et al., 2007]. The sequences of the primers used in this study are shown in Table I. The first-round PCR was carried out in a 50 ml mixture containing 38.5 ml of extracted DNA, 60 mM Tris–HCl (pH 8.5), 1.5 mM MgCl2, 25 mM KCl, 10 mM 2-mercaptoethanol, 0.1% Triton X-100, 200 mM each of dNTPs, 400 nM of each primer and 2.5 units of Taq polymerase (Sibenzyme, Novosibirsk, Russia). The termocycler GeneAmp PCR System 9700 (Applied Biosystems, Grand Island, NE) was programmed for initial incubation of the samples for 2 min at 94 ˚C, followed by 45 cycles at 94 ˚C for 60 sec, 60 ˚C for 30 sec, 72 ˚C for 60 sec and final step at 72 ˚C for 5 min. For second-round PCR, 5 ml of the first-round PCR product was added to reaction mixture containing same final volume, concentration of primers, and PCR reactants as used for first-round PCR. Samples were thermocycled for 30 cycles (94 ˚C for 60 sec, 60 ˚C for 30 sec, 72 ˚C for 60 sec) with initial step at 94 ˚C for 2 min and final step at 72 ˚C for 5 min. To amplify HCV 50 UTR, Core, and NS5B regions synthesis of cDNA and first round of PCR were performed using a OneStep RT-PCR kit (Qiagen). The sequences of the primers used in this study are shown in Table I. The first-round RT-PCR was carried out in a 50 ml mixture containing 5.0 ml of extracted RNA, 1X QIAGEN OneStep RT-PCR Buffer with 2.5 mM MgCl2, 400 mM each of dNTPs, 400 nM of each primer and 2.0 ml of QIAGEN OneStep RTPCR Enzyme Mix. The thermocycler GeneAmp PCR
TABLE I. Primers Used for PCR and Sequencing of HBV DNA and RT-PCR and Sequencing of HCV RNA Virus
Region
HBV
S
HCV
50 UTR
Core
NS5B
Name
Round
Sequence (50 –30 )
Position
Size, bp
S_out_upper S_out_lower S_in_upper S_in_lower 50 UTR_out_upper 50 UTR_out_lower 50 UTR_in_upper 50 UTR_in_lower Core_out_upper Core_out_lower Core_in_upper Core_in_lower NS5B_upper NS5B_lower
I
CAGAGTCTAGACTCGTGGTGGACTT CCTACGAACCACTGAACAAATGGCAC TCTAGACTCGTGGTGGACTTCTCTCA CCACTGAACAAATGGCACTAGTAA CCCCTGTGAGGAACTWCTGTCTTCACG CTCGCAAGCACCCTATCAGGCAG GAAAGCGTCTAGCCATGGCGTTAG CCCTATCAGGCAGTACCACAAGGC CCTGATAGGGTGCTTGCGAGT ATGTACCCCATGAGGTCGGC TGCCCCGGGAGGTCTCGTAG CCGCAYGTRAGGGTATCGATGAC CRTATGAYACCCGCTGYTTTGACTC GAGTACCTRGTCATAGCCTCCGTGAAG
242–266 708–683 247–272 700–677 40–66 309–287 71–94 301–278 289–309 748–729 309–328 724–702 8254–8278 8641–8615
467
II I II I II I
454 270 231 460 416 388
J. Med. Virol. DOI 10.1002/jmv
1194
Maksyutov et al.
System 9700 (Applied Biosystems) was programmed to incubate the samples initially for 30 min at 50 ˚C and 15 min at 95 ˚C, followed by 40 cycles at 94 ˚C for 45 sec, 55 ˚C for 45 sec, 72 ˚C for 60 sec and final step at 72 ˚C for 10 min. The second-round PCR for 50 UTR and Core regions were carried out in a 50 ml mixture containing 5.0 ml of the first-round PCR product, 60 mM Tris–HCl (pH 8.5), 1.5 mM MgCl2, 25 mM KCl, 10 mM 2-mercaptoethanol, 0.1% Triton X-100, 200 mM each of dNTPs, 400 nM of each primer and 2.5 units of Taq polymerase (Sibenzyme, Novosibirsk, Russia). Samples were thermocycled for 30 cycles (94 ˚C for 45 sec, 55 ˚C for 45 sec, 72 ˚C for 60 sec) with initial step at 94 ˚C for 2 min and final step at 72 ˚C for 10 min. The amplified products were electrophoresed on a 2% agarose gel, stained with ethidium bromide and visualized under UV light. The PCR products of HBV S region and HCV NS5B region were purified using QIAquick PCR Purification kit (Qiagen), sequenced with corresponding primers (Table I) using BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems) and ABI 310 Genetic Analyzer (Applied Biosystems). Nucleotide sequences were aligned using the CLUSTAL W program [Thompson et al., 1994] with following phylogenetic analysis of a 404 bp fragment of the HBV S gene and 336 bp fragment of the HCV NS5B region by Kimurs’s 2-parameter algorithm with the neighbor-joining method [Saitou and Nei, 1987] using MEGA program (version 4.0) [Tamura et al., 2007]. To confirm the reliability of the phylogenetic tree, 1000 bootstrap replicates were performed. RESULTS During this study, HBV DNA was detected in 262 out of 343 HBsAg-positive samples (76.4%) and HCV RNA was detected by PCR in 148 out of 207 HCV samples (71.5%) for 50 UTR region, in 145 out of 207 HCV samples (70.0%) for Core region and in 134 out of 207 HCV samples (64.7%) for NS5B region. Nucleotide sequences of HBV S gene and HCV NS5B region were determined for 137 HBV and 133 HCV serum samples, respectively.
Distribution of HBV genotypes among 137 serum samples was the following: 134 (97.8%) for genotype D and 3 (2.2%) for genotype A (Table II). Genotypes B, C, E, F, G, and H were not detected in this study (Fig. 1). The distribution of HBV serotypes among 134 serum samples with genotype D was the following: 74 were determined as serotype ayw2 (55.2%), 59 were determined as serotype ayw3 (44.0%), one was determined as serotype adw2 (0.7%). All three serum samples of genotype A were classified as serotype adw2 (100%) (Table II). The prevalence of HBV serotypes differed in several cities of Russia. The prevalence of HBV serotypes was similar in St. Petersburg and Khabarovsk, with predominance of serotype ayw3 (82.6% and 95.0%, respectively), whereas serotype ayw2 was unique in Gorno-Altaisk. All three serotypes ayw2, ayw3, and adw2 were detected in Nizhny Novgorod and Novosibirsk with predominance of serotype ayw2. New combination of HBV genotype D and serotype adw2 was identified in Novosibirsk (Table III). Distribution of HCV genotypes among 133 serum samples was the following: 58 (43.6%) for genotype 1b, 5 (3.8%) for genotype 2a and 70 (52.6%) for genotype 3a (Fig. 2, Table II). The prevalence of HCV genotypes 1b and 3a in different cities was in conformity with average distribution in Russia. However, the prevalence of genotype 2a varied depending on the city as follows: from 0.0% for St. Petersburg and Novosibirsk to 3.7% for Barnaul, 4.3% for Krasnodar, and 23.0% for Khabarovsk. Trees reveal the presence of one cluster composed of eight identical sequences for HCV genotype 1b and two clusters composed of four and five identical sequences for HCV genotype 3a (Fig. 2). All these identical sequences were from Novosibirsk. DISCUSSION Several methods have been developed for HCV and HBV genotyping including direct nucleic acid sequencing [Okamoto et al., 1988; Simmonds et al., 1993], PCR-based restriction fragment length polymorphism [Mizokami et al., 1999; Chinchai et al.,
TABLE II. Distribution of HCV Genotypes and HBV Genotypes and Serotypes HCV
HBV
City
1b
2a
3a
A/adw2
D/ayw3
D/ayw2
D/adw2
St. Petersburg Krasnodar Novosibirsk Barnaul Khabarovsk Gorno-Altaisk Nizhny Novgorod Total
16/44% 11/48% 15/44% 12/44% 4/31% – – 58/43%
0/0% 1/4% 0/0% 1/4% 3/23% – – 5/4%
20/56% 11/48% 19/56% 14/52% 6/46% – – 70/53%
0/0% 0/0% 1/3% – 1/5% 0/0% 1/20% 3/2%
19/83% 13/37% 7/18% – 19/95% 0/0% 1/20% 59/43%
4/17% 22/63% 29/76% – 0/0% 16/100% 3/60% 74/54%
0/0% 0/0% 1/3% – 0/0% 0/0% 0/0% 1/1%
The number of isolates/percentage given for each city with defined HCV genotype and HBV serotype are shown.
J. Med. Virol. DOI 10.1002/jmv
Genotyping of HBV and HCV in Russia
1195
Fig. 1. Example of a Neighbor-joining tree for HBV S sequence (404 bp) (positions 273–676). Phylogenies for genotypes A–H sequences are shown. The numbers at the nodes represent the percent bootstrap support for 1,000 replicates. Only values over 75% are shown. Bar at the base of the tree shows the genetic divergence. Letters following isolate names indicate city of origin of patients: KR, Krasnodar; NN, Nizhny Novgorod; NV, Novosibirsk; KH, Khabarovsk.
2003], a reverse hybridization line probe assay [Stuyver et al., 1996; Grandjacques et al., 2000], PCR amplification assay using subtype-specific primers [Okamoto et al., 1992; Naito et al., 2001], heteroduplex mobility analysis [White et al., 2000], and others. Nevertheless, nucleic acid sequencing and subsequent phylogenetic analysis remains the reference method for HCV and HBV genotyping. The 50 UTR region is one of the most highly conserved regions of the HCV genome and is the best choice for qualitative HCV RNA detection due to its high sensitivity and for routine genotyping of HCV in the determination of major genotypes [Simmonds, 1995]. However, due to high level of conservation, 50 UTR is limited in its ability to discriminate all genotypes and subtypes [Smith et al., 1995]. The core region is conserved enough for high sensitivity, but due to greater sequence divergence than the 50 UTR region is more preferred for accurate genotyping [Lole et al., 2003]. HCV genotyping based on hyper variable NS5B region provides the highest resolution to determine genotypes and subtypes, and remains the gold standard. However, it is not always possible to amplify NS5B region and such reduced sensitivity is provided by lack of conservation in the primer binding sites. In this study, 50 UTR, Core, and NS5B regions were independently amplified for each serum sample for qualitative HCV RNA detection with subsequent accurate genotyping based on NS5B region. Reduced sensitivity for NS5B region (64.7%) compared to Core (70.0%) and 50 UTR (71.5%) regions may also be explained by running only one round of PCR for NS5B instead of two rounds as for other regions. Due to variability of the NS5B region degenerate primers were used for detecting all known subtypes of HCV RNA. Subsequent phylogenetic analysis showed that 43.6% of 133 sequences were clustered into HCV genotype 1b, 52.6% sequences were of genotype 3a and 3.8% sequences were of genotype 2a (Table II). This was comparable with previous reports on the geographical distribution of HCV genotypes in Russia
TABLE III. Associations Between HBV Genotypes and Serotypes Serotype Genotype
ayw1
A B C D E F G H
X X
ayw2
X X
ayw3
X X X
ayw4
X X X
adw2 X X X Y X X
adw3
adw4
ayr
adrqþ
adrq–
X
X
X
X X X X
The X marks the genotype/serotype pairs that have been described previously [Arauz-Ruiz et al., 2002; Purdy et al., 2007]. The Y marks a new genotype/serotype association described in this paper.
J. Med. Virol. DOI 10.1002/jmv
1196
Maksyutov et al.
Fig. 2. Neighbor-joining trees for HCV NS5B sequences (336 bp) (positions 8279–8614). Phylogenies for genotype 1 (a) and genotype 3 (b) sequences are shown. The numbers at the nodes represent the percent bootstrap support for 1,000 replicates. Only values over 75% are shown. Bars at the base of the trees show the genetic divergence. Letters following isolate names indicate city of origin of patients: SP, St. Petersburg; KR, Krasnodar; NV, Novosibirsk; BR, Barnaul; KH, Khabarovsk.
J. Med. Virol. DOI 10.1002/jmv
Genotyping of HBV and HCV in Russia
with significant dominance of genotypes 1b and 3a [Kalinina et al., 2001; Kovalev et al., 2003; Shustov et al., 2005; Paintsil et al., 2009]. A very high circulation of HCV genotype 2a in Khabarovsk may be explained by close location to northeast regions of China with predominance of this genotype [Wang et al., 1993]. Three clusters composed of identical sequences for samples from Novosibirsk identified in this study may be explained by the circulation of three major isolates of HCV with a high percentage of distribution in this region. There were no epidemiological links between samples in each cluster and laboratory contamination was ruled out. Probably, we would not see such clusters of identical sequences if we used whole genome sequences for construction of phylogenies. The geographical distribution of HBV genotypes among 137 serum samples was comparable with previous reports with significant dominance of genotype D in Russia [Flodgren et al., 2000; Abe et al., 2004]. Previously, HBV has been classified into immunological serotypes, and there is exact correlation between serotype and specific amino acid composition of HBsAg [Purdy et al., 2007]. The d or y determinant is specified by a lysine or arginine residue at position 122 of HBsAg, and the w or r is specified by lysine or arginine at position 160. Additional subdeterminants of w (w1 to w4) are determined by positions 122, 127, 140, and 159. In this study, all 137 serum samples with defined sequences of S gene were subtyped based on the deduced amino acid sequences at positions 122, 127, 140, 159, and 160 of HBsAg (Table II). New combination of HBV genotype D and adw2 serotype, based on lysine residues at positions 122 and 160 and proline residue at position 127 of HBsAg, was identified for the first time, since it hasn’t been described previously [Purdy et al., 2007] (Table III). Such unusual genotype/subtype associations were found previously: Purdy et al. [2007] declared two isolates with genotypes D, but subtype ayw4–is a subtype most commonly associated with genotype E. A genotype/ subtype E/ayw2 association detected in this study is thought unusual because a much more common association for ayw2 subtype is D/ayw2 (Table III). The discovered genotype D and adw2 serotype association is not very impressive, due to the fact that adw2 subtype has the maximum number of associations with different genotypes (A, B, C, D, F, and G) and genotype D has the maximum number of associations with different subtypes (ayw2, ayw3, ayw4, adw2, and adw3). Results of this study allowed the construction of anti-HCV reference panel comprising 200 serum samples containing and not containing anti-HCV antibodies as well as the construction of the reference HBsAg serum panel comprising 370 samples with different subtype and genotype content and negative samples. Developed National reference panels of
1197
HBV and HCV lyophilized sera could be used to monitor specificity and sensitivity of approved kits and for the certification of newly developed assays. In conclusion, the findings of this study confirm and update the previous data that HCV genotypes 1b (43.6%) and 3a (52.6%) and HBV genotype D (97.8%) are predominant in Russia, whereas only 3.8% of HCV RNA isolates were attributed to HCV genotype 2a and 2.2% of HBV DNA isolates to HBV genotype A. A new combination of HBV genotype D and adw2 serotype was discovered for the first time, and was also included in Russian National reference panel. REFERENCES Abe K, Hayakawa E, Sminov AV, Rossina AL, Ding X, Huy TT, Sata T, Uchaikin VF. 2004. Molecular epidemiology of hepatitis B, C, D and E viruses among children in Moscow, Russia J Clin Virol 30:57–61. Arauz-Ruiz P, Norder H, Robertson BH, Magnius LO. 2002. Genotype H: A new Ameridian genotype of hepatitis B virus revealed in Central America. J Gen Virol 83:2059–2073. Chien DY, Arcangel P, Medina-Selby A, Coit D, Baumeister M, Nguyen S, George-Nascimento C, Gyenes A, Kuo G, Valenzuela P. 1999. Use of a novel hepatitis C virus (HCV) major-epitope chimeric polypeptide for diagnosis of HCV infection. J Clin Microbiol 37:1393–1397. Chinchai T, Labout J, Noppornpanth S, Theamboonlers A, Haagmans BL, Osterhaus AD, Poovorawan Y. 2003. Comparative study of different methods to genotype hepatitis C virus type 6 variants. J Virol Methods 109:195–201. Flodgren E, Bengtsson S, Knutsson M, Strebkova EA, Kidd AH, Alexeyev OA, Kidd-Ljunggren K. 2000. Recent high incidence of fulminant hepatitis in Samara, Russia: Molecular analysis of prevailing hepatitis B and D virus strains. J Clin Microbiol 38:3311–3316. Grandjacques C, Pradat P, Stuyver L, Chevallier M, Chevallier P, Pichoud C, Maisonnas M, Trepo C, Zoulim F. 2000. Rapid detection of genotypes and mutations in the pre-core promoter and the pre-core region of hepatitis B virus genome: Correlation with viral persistence and disease severity. J Hepatol 33: 430–439. Kalinina O, Norder H, Vetrov T, Zhdanov K, Barzunova M, Plotnikova V, Mukomolov S, Magnius LO. 2001. Shift in predominating subtype of HCV from 1b to 3a in St. Petersburg mediated by increase in injecting drug use. J Med Virol 65: 517–524. Kovalev SIu, Maliushenko OI, Glinskikh NP. 2003. [Genetic variations of hepatitis C virus circulating in the Ural region]. Vopr Virusol 48:11–14. Lole KS, Jha JA, Shrotri SP, Tandon BN, Prasad VG, Arankalle VA. 2003. Comparison of hepatitis C virus genotyping by 50 noncoding region- and core-based reverse transcriptase PCR assay with sequencing and use of the assay for determining subtype distribution in India. J Clin Microbiol 41:5240–5244. Mizokami M, Nakano T, Orito E, Tanaka Y, Sakugawa H, Mukaide M, Robertson BH. 1999. Hepatitis B virus genotype assignment using restriction fragment length polymorphism patterns. FEBS Lett 450:66–71. Naito H, Hayashi S, Abe K. 2001. Rapid and specific genotyping system for hepatitis B virus corresponding to six major genotypes by PCR using type-specific primers. J Clin Microbiol 39: 362–364. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka T, Sato K, Tsuda F, Miyakawa Y. 1992. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: Application to clinical surveys and tracing infectious sources. J Gen Virol 73:673–679. Okamoto H, Tsuda F, Sakugawa H, Sastrosoewignjo RI, Imai M, Miyakawa Y, Mayumi M. 1988. Typing hepatitis B virus by homology in nucleotide sequence: Comparison of surface antigen subtypes. J Gen Virol 69:2575–2583. Paintsil E, Verevochkin SV, Dukhovlinova E, Niccolai L, Barbour R, White E, Toussova OV, Alexander L, Kozlov AP, Heimer R.
J. Med. Virol. DOI 10.1002/jmv
1198 2009. Hepatitis C virus infection among drug injectors in St Petersburg, Russia: Social and molecular epidemiology of an endemic infection. Addiction 104:1881–1890. Pawlotsky JM. 2004. Treating hepatitis C in “difficult-to-treat” patients. N Engl J Med 351:422–423. Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. 2006. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol 45:529–538. Purdy MA, Talekar G, Swenson P, Araujo A, Fields H. 2007. A new algorithm for deduction of hepatitis B surface antigen subtype determinants from the amino acid sequence. Intervirology 50: 45–51. Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. Satoh K, Iwata-Takakura A, Yoshikawa A, Gotanda Y, Tanaka T, Yamaguchi T, Mizoguchi H. 2008. A new method of concentrating hepatitis B virus (HBV) DNA and HBV surface antigen: An application of the method to the detection of occult HBV infection. Vox Sang 95:174–180. Shustov AV, Kochneva GV, Sivolobova GF, Grazhdantseva AA, Gavrilova IV, Akinfeeva LA, Rakova IG, Aleshina MV, Bukin VN, Orlovsky VG, Bespalov VS, Robertson BH, Netesov SV. 2005. Molecular epidemiology of the hepatitis C virus in Western Siberia. J Med Virol 77:382–389. Simmonds P. 1995. Variability of hepatitis C virus. Hepatology 21:570–583. Simmonds P, Bukh J, Combet C, Dele’age G, Enomoto N, Feinstone S, Halfon P, Inchauspe’ G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin-I T, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. 2005. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 42:962–973.
J. Med. Virol. DOI 10.1002/jmv
Maksyutov et al. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, Beall E, Yap PL, Kolberg J, Urdea MS. 1993. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 74:2391–2399. Smith DB, Mellor J, Jarvis LM, Davidson F, Kolberg J, Urdea M, Yap PL, Simmonds P. 1995. Variation of the hepatitis C virus 50 -noncoding region: Implications for secondary structure, virus detection, and typing. J Gen Virol 76:1749–1761. Stuyver L, Wyseur A, van Arnhem W, Hernandez F, Maertens G. 1996. Second-generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol 34:2259–2266. Tallo T, Norder H, Tefanova V, Krispin T, Priima¨gi L, Mukomolov S, Mikhailov M, Magnius LO. 2004. Hepatitis B virus genotype D strains from Estonia share sequence similarity with strains from Siberia and may specify ayw4. J Med Virol 74:221–227. Tallo T, Tefanova V, Priima¨gi L, Schmidt J, Katargina O, Michailov M, Mukomolov S, Magnius L, Norder H. 2008. D2: Major subgenotype of hepatitis B virus in Russia and the Baltic region: J Gen Virol 89:1829–1839. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0 Mol Biol Evol 24:1596–1599. Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. Wang Y, Okamoto H, Tsuda F, Nagayama R, Tao QM, Mishiro S. 1993. Prevalence, genotypes, and an isolate (HC-C2) of hepatitis C virus in Chinese patients with liver disease. J Med Virol 40: 254–260. White PA, Zhai X, Carter I, Zhao Y, Rawlinson WD. 2000. Simplified hepatitis C virus genotyping by heteroduplex mobility analysis. J Clin Microbiol 38:477–482.
Genotyping of Hepatitis B and C Virus Russian Isolates for Reference Serum Panel Construction Rinat A. Maksyutov,* Elena V. Gavrilova, Amir Z. Maksyutov, and Aleksandr N. Kanev State Research Center of Virology and Biotechnology “Vector”, Koltsovo, Novosibirsk Region, Russia
Approximately 2% and 5% of the world human population is estimated to be infected with HCV and HBV, respectively. Reference panels of HCV and HBV serum samples with defined genotypes and serotypes is necessary for monitoring of the specificity and sensitivity of diagnostic test kits. The aim of this study was to determine genotypes/serotypes of HBV and HCV circulating in Russia in order to construct a panel of reference sera containing these HCV genotypes and HBV serotypes. A total of 343 HBsAg-positive and 207 anti-HCV positive serum samples were collected from patients with HBV and HCV infection from different cities between years 2002 and 2010 in St. Petersburg, Krasnodar, Nizhny Novgorod, Novosibirsk, Barnaul, Gorno-Altaisk, and Khabarovsk. HBV DNA was found in 76.4% of HBsAg positive samples by PCR for the S gene and HCV RNA was found in 71.5, 70.0, and 64.7% of anti-HCV positive samples in the 50 UTR, Core, and NS5B regions, respectively. The prevalence and proportion of HBV genotype/serotype associations were as follows: A/adw2, 2.1%; D/ayw2, 54.0%; D/ayw3, 43.1%; D/adw2, 0.7%. A new combination of genotype D and adw2 serotype was discovered. The distribution of HCV genotypes was the following: 43.6%, b; 3.8%, 2a; and 52.6%, 3a. Russian National reference panels of HBV and HCV lyophilized sera were developed to monitor specificity and sensitivity of approved kits and for the certification of newly developed assays. J. Med. Virol. 87:1192– 1198, 2015. # 2015 Wiley Periodicals, Inc.
be infected with HCV and HBV, respectively [Perz et al., 2006]. Based on the high level of genome heterogeneity, HCV has been classified into six genotypes [Simmonds et al., 2005] and HBV has been classified into eight (A–H) genotypes [Arauz-Ruiz et al., 2002]. HCV heterogeneity is responsible for the failure of effective vaccine development and is clinically significant since HCV genotypes are associated with drug treatment regimen [Pawlotsky, 2004]. Human serum samples are tested for anti-hepatitis C virus antibodies using enzyme-linked immunosorbent assay based on several HCV antigens—Core, NS3, NS4, and NS5—as individual recombinant proteins or, for example, in the form of single multiple epitope fusion antigen [Chien et al., 1999]. In spite of the proven efficacy for blood screening and for the diagnosis of HCV infection in symptomatic patients, it is important to continue monitoring assays for their ability to detect samples with low titer anti-HCV antibodies of all genotypes. Thus, development of a reference panel of HCV serum samples with defined genotypes, including samples with low titer anti-HCV antibodies, is necessary to control the quality of diagnostic test kits. HCV genotype representation in reference panels must correspond to the prevalence of the different genotypes in the geographic area in which reference panel is going to be used. National reference panel for Russia should be composed of lyophilized sera containing HCV samples of 1b, 2a, and 3a genotypes [Kovalev et al., 2003; Shustov et al., 2005; Paintsil et al., 2009].
KEY WORDS:
Grant sponsor: US Ministry of Health and Social Security (DHHS, BTEP) under the contract with the International Science and Technology Center (ISTC), Projects number 3526p and number 1803p. Correspondence to: Rinat A. Maksyutov, State Research Center of Virology and Biotechnology “Vector”, Koltsovo, Novosibirsk Region 630559, Russia. E-mail: [email protected] Accepted 26 January 2015
HBV; HCV; genotypes; Russia; reference serum panel
INTRODUCTION Hepatitis C virus (HCV) and hepatitis B virus (HBV) are associated with chronic liver disease, cirrhosis of liver, and hepatocellular carcinoma. Approximately 2% and 5% of the world human population is estimated to C 2015 WILEY PERIODICALS, INC.
DOI 10.1002/jmv.24170 Published online 10 March 2015 in Wiley Online Library (wileyonlinelibrary.com).
Genotyping of HBV and HCV in Russia
1193
Similarly, the presence of HBsAg in the blood is the specific serologic marker for HBV infection and there are a number of sensitive enzyme immunoassays (EIA) that have improved the detection of HBV. However, it was recognized that there may be individuals with acute and chronic hepatitis B infection and asymptomatic patients where HBsAg levels may be too low to detect with EIAs [Satoh et al., 2008]. The antigenic determinants of HBsAg are classified into 10 immunological serotypes: ayw1, ayw2, ayw3, ayw4, adw2, adw3, adw4, ayr, adrq, adrqþ [Purdy et al., 2007] and Russian National reference panel should be composed of lyophilized sera containing HBV samples of ayw2, ayw3, adw2 serotypes of HBsAg, since they predominate in this country [Tallo et al., 2004, 2008]. The aim of this study was to determine genotypes and serotypes of HBV samples and genotypes of HCV samples in patients with chronic hepatitis B and C collected from cities located in different geographic regions of Russia in order to construct panels of reference sera composed of HBV and HCV genotypes circulating in Russia. MATERIALS AND METHODS A total of 343 HBsAg-positive serum samples were collected from patients with chronic HBV infection and 207 anti-HCV positive serum samples were collected from patients with chronic HCV infection in cities located in different geographic regions of Russia between years 2002 and 2010. The cities include St. Petersburg, Krasnodar, Nizhny Novgorod, Novosibirsk, Barnaul, Gorno-Altaisk, and Khabarovsk. HBsAg-positive samples were not collected in Barnaul and anti-HCV positive samples were not collected in Gorno-Altaisk and Nizhny Novgorod. All patients were from infectious hospitals or AIDS Centers. Samples from patients co-infected with HBV, HCV or HIV were excluded. Informed consent was obtained from each patient. Ethical Approval was given by Institutional Review Board at State
Research Center of Virology and Biotechnology “Vector”. All serum samples were stored at 20 ˚C until use. HBV DNA and HCV RNA were extracted from serum using QIAamp DNA Mini kit (Qiagen, Valencia, CA) and QIAamp MinElute Virus Spin Kit (Qiagen), respectively, according to the manufacturer’s instructions. Briefly, 200 ml of serum was used for DNA/RNA extraction and 50 ml of elution buffer was used for elution. Two-round PCR was performed to amplify S region of HBV DNA [Purdy et al., 2007]. The sequences of the primers used in this study are shown in Table I. The first-round PCR was carried out in a 50 ml mixture containing 38.5 ml of extracted DNA, 60 mM Tris–HCl (pH 8.5), 1.5 mM MgCl2, 25 mM KCl, 10 mM 2-mercaptoethanol, 0.1% Triton X-100, 200 mM each of dNTPs, 400 nM of each primer and 2.5 units of Taq polymerase (Sibenzyme, Novosibirsk, Russia). The termocycler GeneAmp PCR System 9700 (Applied Biosystems, Grand Island, NE) was programmed for initial incubation of the samples for 2 min at 94 ˚C, followed by 45 cycles at 94 ˚C for 60 sec, 60 ˚C for 30 sec, 72 ˚C for 60 sec and final step at 72 ˚C for 5 min. For second-round PCR, 5 ml of the first-round PCR product was added to reaction mixture containing same final volume, concentration of primers, and PCR reactants as used for first-round PCR. Samples were thermocycled for 30 cycles (94 ˚C for 60 sec, 60 ˚C for 30 sec, 72 ˚C for 60 sec) with initial step at 94 ˚C for 2 min and final step at 72 ˚C for 5 min. To amplify HCV 50 UTR, Core, and NS5B regions synthesis of cDNA and first round of PCR were performed using a OneStep RT-PCR kit (Qiagen). The sequences of the primers used in this study are shown in Table I. The first-round RT-PCR was carried out in a 50 ml mixture containing 5.0 ml of extracted RNA, 1X QIAGEN OneStep RT-PCR Buffer with 2.5 mM MgCl2, 400 mM each of dNTPs, 400 nM of each primer and 2.0 ml of QIAGEN OneStep RTPCR Enzyme Mix. The thermocycler GeneAmp PCR
TABLE I. Primers Used for PCR and Sequencing of HBV DNA and RT-PCR and Sequencing of HCV RNA Virus
Region
HBV
S
HCV
50 UTR
Core
NS5B
Name
Round
Sequence (50 –30 )
Position
Size, bp
S_out_upper S_out_lower S_in_upper S_in_lower 50 UTR_out_upper 50 UTR_out_lower 50 UTR_in_upper 50 UTR_in_lower Core_out_upper Core_out_lower Core_in_upper Core_in_lower NS5B_upper NS5B_lower
I
CAGAGTCTAGACTCGTGGTGGACTT CCTACGAACCACTGAACAAATGGCAC TCTAGACTCGTGGTGGACTTCTCTCA CCACTGAACAAATGGCACTAGTAA CCCCTGTGAGGAACTWCTGTCTTCACG CTCGCAAGCACCCTATCAGGCAG GAAAGCGTCTAGCCATGGCGTTAG CCCTATCAGGCAGTACCACAAGGC CCTGATAGGGTGCTTGCGAGT ATGTACCCCATGAGGTCGGC TGCCCCGGGAGGTCTCGTAG CCGCAYGTRAGGGTATCGATGAC CRTATGAYACCCGCTGYTTTGACTC GAGTACCTRGTCATAGCCTCCGTGAAG
242–266 708–683 247–272 700–677 40–66 309–287 71–94 301–278 289–309 748–729 309–328 724–702 8254–8278 8641–8615
467
II I II I II I
454 270 231 460 416 388
J. Med. Virol. DOI 10.1002/jmv
1194
Maksyutov et al.
System 9700 (Applied Biosystems) was programmed to incubate the samples initially for 30 min at 50 ˚C and 15 min at 95 ˚C, followed by 40 cycles at 94 ˚C for 45 sec, 55 ˚C for 45 sec, 72 ˚C for 60 sec and final step at 72 ˚C for 10 min. The second-round PCR for 50 UTR and Core regions were carried out in a 50 ml mixture containing 5.0 ml of the first-round PCR product, 60 mM Tris–HCl (pH 8.5), 1.5 mM MgCl2, 25 mM KCl, 10 mM 2-mercaptoethanol, 0.1% Triton X-100, 200 mM each of dNTPs, 400 nM of each primer and 2.5 units of Taq polymerase (Sibenzyme, Novosibirsk, Russia). Samples were thermocycled for 30 cycles (94 ˚C for 45 sec, 55 ˚C for 45 sec, 72 ˚C for 60 sec) with initial step at 94 ˚C for 2 min and final step at 72 ˚C for 10 min. The amplified products were electrophoresed on a 2% agarose gel, stained with ethidium bromide and visualized under UV light. The PCR products of HBV S region and HCV NS5B region were purified using QIAquick PCR Purification kit (Qiagen), sequenced with corresponding primers (Table I) using BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems) and ABI 310 Genetic Analyzer (Applied Biosystems). Nucleotide sequences were aligned using the CLUSTAL W program [Thompson et al., 1994] with following phylogenetic analysis of a 404 bp fragment of the HBV S gene and 336 bp fragment of the HCV NS5B region by Kimurs’s 2-parameter algorithm with the neighbor-joining method [Saitou and Nei, 1987] using MEGA program (version 4.0) [Tamura et al., 2007]. To confirm the reliability of the phylogenetic tree, 1000 bootstrap replicates were performed. RESULTS During this study, HBV DNA was detected in 262 out of 343 HBsAg-positive samples (76.4%) and HCV RNA was detected by PCR in 148 out of 207 HCV samples (71.5%) for 50 UTR region, in 145 out of 207 HCV samples (70.0%) for Core region and in 134 out of 207 HCV samples (64.7%) for NS5B region. Nucleotide sequences of HBV S gene and HCV NS5B region were determined for 137 HBV and 133 HCV serum samples, respectively.
Distribution of HBV genotypes among 137 serum samples was the following: 134 (97.8%) for genotype D and 3 (2.2%) for genotype A (Table II). Genotypes B, C, E, F, G, and H were not detected in this study (Fig. 1). The distribution of HBV serotypes among 134 serum samples with genotype D was the following: 74 were determined as serotype ayw2 (55.2%), 59 were determined as serotype ayw3 (44.0%), one was determined as serotype adw2 (0.7%). All three serum samples of genotype A were classified as serotype adw2 (100%) (Table II). The prevalence of HBV serotypes differed in several cities of Russia. The prevalence of HBV serotypes was similar in St. Petersburg and Khabarovsk, with predominance of serotype ayw3 (82.6% and 95.0%, respectively), whereas serotype ayw2 was unique in Gorno-Altaisk. All three serotypes ayw2, ayw3, and adw2 were detected in Nizhny Novgorod and Novosibirsk with predominance of serotype ayw2. New combination of HBV genotype D and serotype adw2 was identified in Novosibirsk (Table III). Distribution of HCV genotypes among 133 serum samples was the following: 58 (43.6%) for genotype 1b, 5 (3.8%) for genotype 2a and 70 (52.6%) for genotype 3a (Fig. 2, Table II). The prevalence of HCV genotypes 1b and 3a in different cities was in conformity with average distribution in Russia. However, the prevalence of genotype 2a varied depending on the city as follows: from 0.0% for St. Petersburg and Novosibirsk to 3.7% for Barnaul, 4.3% for Krasnodar, and 23.0% for Khabarovsk. Trees reveal the presence of one cluster composed of eight identical sequences for HCV genotype 1b and two clusters composed of four and five identical sequences for HCV genotype 3a (Fig. 2). All these identical sequences were from Novosibirsk. DISCUSSION Several methods have been developed for HCV and HBV genotyping including direct nucleic acid sequencing [Okamoto et al., 1988; Simmonds et al., 1993], PCR-based restriction fragment length polymorphism [Mizokami et al., 1999; Chinchai et al.,
TABLE II. Distribution of HCV Genotypes and HBV Genotypes and Serotypes HCV
HBV
City
1b
2a
3a
A/adw2
D/ayw3
D/ayw2
D/adw2
St. Petersburg Krasnodar Novosibirsk Barnaul Khabarovsk Gorno-Altaisk Nizhny Novgorod Total
16/44% 11/48% 15/44% 12/44% 4/31% – – 58/43%
0/0% 1/4% 0/0% 1/4% 3/23% – – 5/4%
20/56% 11/48% 19/56% 14/52% 6/46% – – 70/53%
0/0% 0/0% 1/3% – 1/5% 0/0% 1/20% 3/2%
19/83% 13/37% 7/18% – 19/95% 0/0% 1/20% 59/43%
4/17% 22/63% 29/76% – 0/0% 16/100% 3/60% 74/54%
0/0% 0/0% 1/3% – 0/0% 0/0% 0/0% 1/1%
The number of isolates/percentage given for each city with defined HCV genotype and HBV serotype are shown.
J. Med. Virol. DOI 10.1002/jmv
Genotyping of HBV and HCV in Russia
1195
Fig. 1. Example of a Neighbor-joining tree for HBV S sequence (404 bp) (positions 273–676). Phylogenies for genotypes A–H sequences are shown. The numbers at the nodes represent the percent bootstrap support for 1,000 replicates. Only values over 75% are shown. Bar at the base of the tree shows the genetic divergence. Letters following isolate names indicate city of origin of patients: KR, Krasnodar; NN, Nizhny Novgorod; NV, Novosibirsk; KH, Khabarovsk.
2003], a reverse hybridization line probe assay [Stuyver et al., 1996; Grandjacques et al., 2000], PCR amplification assay using subtype-specific primers [Okamoto et al., 1992; Naito et al., 2001], heteroduplex mobility analysis [White et al., 2000], and others. Nevertheless, nucleic acid sequencing and subsequent phylogenetic analysis remains the reference method for HCV and HBV genotyping. The 50 UTR region is one of the most highly conserved regions of the HCV genome and is the best choice for qualitative HCV RNA detection due to its high sensitivity and for routine genotyping of HCV in the determination of major genotypes [Simmonds, 1995]. However, due to high level of conservation, 50 UTR is limited in its ability to discriminate all genotypes and subtypes [Smith et al., 1995]. The core region is conserved enough for high sensitivity, but due to greater sequence divergence than the 50 UTR region is more preferred for accurate genotyping [Lole et al., 2003]. HCV genotyping based on hyper variable NS5B region provides the highest resolution to determine genotypes and subtypes, and remains the gold standard. However, it is not always possible to amplify NS5B region and such reduced sensitivity is provided by lack of conservation in the primer binding sites. In this study, 50 UTR, Core, and NS5B regions were independently amplified for each serum sample for qualitative HCV RNA detection with subsequent accurate genotyping based on NS5B region. Reduced sensitivity for NS5B region (64.7%) compared to Core (70.0%) and 50 UTR (71.5%) regions may also be explained by running only one round of PCR for NS5B instead of two rounds as for other regions. Due to variability of the NS5B region degenerate primers were used for detecting all known subtypes of HCV RNA. Subsequent phylogenetic analysis showed that 43.6% of 133 sequences were clustered into HCV genotype 1b, 52.6% sequences were of genotype 3a and 3.8% sequences were of genotype 2a (Table II). This was comparable with previous reports on the geographical distribution of HCV genotypes in Russia
TABLE III. Associations Between HBV Genotypes and Serotypes Serotype Genotype
ayw1
A B C D E F G H
X X
ayw2
X X
ayw3
X X X
ayw4
X X X
adw2 X X X Y X X
adw3
adw4
ayr
adrqþ
adrq–
X
X
X
X X X X
The X marks the genotype/serotype pairs that have been described previously [Arauz-Ruiz et al., 2002; Purdy et al., 2007]. The Y marks a new genotype/serotype association described in this paper.
J. Med. Virol. DOI 10.1002/jmv
1196
Maksyutov et al.
Fig. 2. Neighbor-joining trees for HCV NS5B sequences (336 bp) (positions 8279–8614). Phylogenies for genotype 1 (a) and genotype 3 (b) sequences are shown. The numbers at the nodes represent the percent bootstrap support for 1,000 replicates. Only values over 75% are shown. Bars at the base of the trees show the genetic divergence. Letters following isolate names indicate city of origin of patients: SP, St. Petersburg; KR, Krasnodar; NV, Novosibirsk; BR, Barnaul; KH, Khabarovsk.
J. Med. Virol. DOI 10.1002/jmv
Genotyping of HBV and HCV in Russia
with significant dominance of genotypes 1b and 3a [Kalinina et al., 2001; Kovalev et al., 2003; Shustov et al., 2005; Paintsil et al., 2009]. A very high circulation of HCV genotype 2a in Khabarovsk may be explained by close location to northeast regions of China with predominance of this genotype [Wang et al., 1993]. Three clusters composed of identical sequences for samples from Novosibirsk identified in this study may be explained by the circulation of three major isolates of HCV with a high percentage of distribution in this region. There were no epidemiological links between samples in each cluster and laboratory contamination was ruled out. Probably, we would not see such clusters of identical sequences if we used whole genome sequences for construction of phylogenies. The geographical distribution of HBV genotypes among 137 serum samples was comparable with previous reports with significant dominance of genotype D in Russia [Flodgren et al., 2000; Abe et al., 2004]. Previously, HBV has been classified into immunological serotypes, and there is exact correlation between serotype and specific amino acid composition of HBsAg [Purdy et al., 2007]. The d or y determinant is specified by a lysine or arginine residue at position 122 of HBsAg, and the w or r is specified by lysine or arginine at position 160. Additional subdeterminants of w (w1 to w4) are determined by positions 122, 127, 140, and 159. In this study, all 137 serum samples with defined sequences of S gene were subtyped based on the deduced amino acid sequences at positions 122, 127, 140, 159, and 160 of HBsAg (Table II). New combination of HBV genotype D and adw2 serotype, based on lysine residues at positions 122 and 160 and proline residue at position 127 of HBsAg, was identified for the first time, since it hasn’t been described previously [Purdy et al., 2007] (Table III). Such unusual genotype/subtype associations were found previously: Purdy et al. [2007] declared two isolates with genotypes D, but subtype ayw4–is a subtype most commonly associated with genotype E. A genotype/ subtype E/ayw2 association detected in this study is thought unusual because a much more common association for ayw2 subtype is D/ayw2 (Table III). The discovered genotype D and adw2 serotype association is not very impressive, due to the fact that adw2 subtype has the maximum number of associations with different genotypes (A, B, C, D, F, and G) and genotype D has the maximum number of associations with different subtypes (ayw2, ayw3, ayw4, adw2, and adw3). Results of this study allowed the construction of anti-HCV reference panel comprising 200 serum samples containing and not containing anti-HCV antibodies as well as the construction of the reference HBsAg serum panel comprising 370 samples with different subtype and genotype content and negative samples. Developed National reference panels of
1197
HBV and HCV lyophilized sera could be used to monitor specificity and sensitivity of approved kits and for the certification of newly developed assays. In conclusion, the findings of this study confirm and update the previous data that HCV genotypes 1b (43.6%) and 3a (52.6%) and HBV genotype D (97.8%) are predominant in Russia, whereas only 3.8% of HCV RNA isolates were attributed to HCV genotype 2a and 2.2% of HBV DNA isolates to HBV genotype A. A new combination of HBV genotype D and adw2 serotype was discovered for the first time, and was also included in Russian National reference panel. REFERENCES Abe K, Hayakawa E, Sminov AV, Rossina AL, Ding X, Huy TT, Sata T, Uchaikin VF. 2004. Molecular epidemiology of hepatitis B, C, D and E viruses among children in Moscow, Russia J Clin Virol 30:57–61. Arauz-Ruiz P, Norder H, Robertson BH, Magnius LO. 2002. Genotype H: A new Ameridian genotype of hepatitis B virus revealed in Central America. J Gen Virol 83:2059–2073. Chien DY, Arcangel P, Medina-Selby A, Coit D, Baumeister M, Nguyen S, George-Nascimento C, Gyenes A, Kuo G, Valenzuela P. 1999. Use of a novel hepatitis C virus (HCV) major-epitope chimeric polypeptide for diagnosis of HCV infection. J Clin Microbiol 37:1393–1397. Chinchai T, Labout J, Noppornpanth S, Theamboonlers A, Haagmans BL, Osterhaus AD, Poovorawan Y. 2003. Comparative study of different methods to genotype hepatitis C virus type 6 variants. J Virol Methods 109:195–201. Flodgren E, Bengtsson S, Knutsson M, Strebkova EA, Kidd AH, Alexeyev OA, Kidd-Ljunggren K. 2000. Recent high incidence of fulminant hepatitis in Samara, Russia: Molecular analysis of prevailing hepatitis B and D virus strains. J Clin Microbiol 38:3311–3316. Grandjacques C, Pradat P, Stuyver L, Chevallier M, Chevallier P, Pichoud C, Maisonnas M, Trepo C, Zoulim F. 2000. Rapid detection of genotypes and mutations in the pre-core promoter and the pre-core region of hepatitis B virus genome: Correlation with viral persistence and disease severity. J Hepatol 33: 430–439. Kalinina O, Norder H, Vetrov T, Zhdanov K, Barzunova M, Plotnikova V, Mukomolov S, Magnius LO. 2001. Shift in predominating subtype of HCV from 1b to 3a in St. Petersburg mediated by increase in injecting drug use. J Med Virol 65: 517–524. Kovalev SIu, Maliushenko OI, Glinskikh NP. 2003. [Genetic variations of hepatitis C virus circulating in the Ural region]. Vopr Virusol 48:11–14. Lole KS, Jha JA, Shrotri SP, Tandon BN, Prasad VG, Arankalle VA. 2003. Comparison of hepatitis C virus genotyping by 50 noncoding region- and core-based reverse transcriptase PCR assay with sequencing and use of the assay for determining subtype distribution in India. J Clin Microbiol 41:5240–5244. Mizokami M, Nakano T, Orito E, Tanaka Y, Sakugawa H, Mukaide M, Robertson BH. 1999. Hepatitis B virus genotype assignment using restriction fragment length polymorphism patterns. FEBS Lett 450:66–71. Naito H, Hayashi S, Abe K. 2001. Rapid and specific genotyping system for hepatitis B virus corresponding to six major genotypes by PCR using type-specific primers. J Clin Microbiol 39: 362–364. Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka T, Sato K, Tsuda F, Miyakawa Y. 1992. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: Application to clinical surveys and tracing infectious sources. J Gen Virol 73:673–679. Okamoto H, Tsuda F, Sakugawa H, Sastrosoewignjo RI, Imai M, Miyakawa Y, Mayumi M. 1988. Typing hepatitis B virus by homology in nucleotide sequence: Comparison of surface antigen subtypes. J Gen Virol 69:2575–2583. Paintsil E, Verevochkin SV, Dukhovlinova E, Niccolai L, Barbour R, White E, Toussova OV, Alexander L, Kozlov AP, Heimer R.
J. Med. Virol. DOI 10.1002/jmv
1198 2009. Hepatitis C virus infection among drug injectors in St Petersburg, Russia: Social and molecular epidemiology of an endemic infection. Addiction 104:1881–1890. Pawlotsky JM. 2004. Treating hepatitis C in “difficult-to-treat” patients. N Engl J Med 351:422–423. Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. 2006. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide. J Hepatol 45:529–538. Purdy MA, Talekar G, Swenson P, Araujo A, Fields H. 2007. A new algorithm for deduction of hepatitis B surface antigen subtype determinants from the amino acid sequence. Intervirology 50: 45–51. Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425. Satoh K, Iwata-Takakura A, Yoshikawa A, Gotanda Y, Tanaka T, Yamaguchi T, Mizoguchi H. 2008. A new method of concentrating hepatitis B virus (HBV) DNA and HBV surface antigen: An application of the method to the detection of occult HBV infection. Vox Sang 95:174–180. Shustov AV, Kochneva GV, Sivolobova GF, Grazhdantseva AA, Gavrilova IV, Akinfeeva LA, Rakova IG, Aleshina MV, Bukin VN, Orlovsky VG, Bespalov VS, Robertson BH, Netesov SV. 2005. Molecular epidemiology of the hepatitis C virus in Western Siberia. J Med Virol 77:382–389. Simmonds P. 1995. Variability of hepatitis C virus. Hepatology 21:570–583. Simmonds P, Bukh J, Combet C, Dele’age G, Enomoto N, Feinstone S, Halfon P, Inchauspe’ G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin-I T, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. 2005. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 42:962–973.
J. Med. Virol. DOI 10.1002/jmv
Maksyutov et al. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, Beall E, Yap PL, Kolberg J, Urdea MS. 1993. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 74:2391–2399. Smith DB, Mellor J, Jarvis LM, Davidson F, Kolberg J, Urdea M, Yap PL, Simmonds P. 1995. Variation of the hepatitis C virus 50 -noncoding region: Implications for secondary structure, virus detection, and typing. J Gen Virol 76:1749–1761. Stuyver L, Wyseur A, van Arnhem W, Hernandez F, Maertens G. 1996. Second-generation line probe assay for hepatitis C virus genotyping. J Clin Microbiol 34:2259–2266. Tallo T, Norder H, Tefanova V, Krispin T, Priima¨gi L, Mukomolov S, Mikhailov M, Magnius LO. 2004. Hepatitis B virus genotype D strains from Estonia share sequence similarity with strains from Siberia and may specify ayw4. J Med Virol 74:221–227. Tallo T, Tefanova V, Priima¨gi L, Schmidt J, Katargina O, Michailov M, Mukomolov S, Magnius L, Norder H. 2008. D2: Major subgenotype of hepatitis B virus in Russia and the Baltic region: J Gen Virol 89:1829–1839. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0 Mol Biol Evol 24:1596–1599. Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. Wang Y, Okamoto H, Tsuda F, Nagayama R, Tao QM, Mishiro S. 1993. Prevalence, genotypes, and an isolate (HC-C2) of hepatitis C virus in Chinese patients with liver disease. J Med Virol 40: 254–260. White PA, Zhai X, Carter I, Zhao Y, Rawlinson WD. 2000. Simplified hepatitis C virus genotyping by heteroduplex mobility analysis. J Clin Microbiol 38:477–482.
