Antimicrobial Original Research Paper
Genotyping and characterization of CTX-M-15 -producing Klebsiella pneumoniae isolated from an Iranian hospital Safoura Derakhshan, Shahin Najar Peerayeh*, Bita Bakhshi Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran The aims were to describe the genetic characterization of blaCTX-M-1 group gene in Klebsiella pneumoniae and to investigate the relationship between isolates by MLVA and PFGE. We analyzed 36 CTX-M group 1-ESBL producing K. pneumoniae. rmpA and wcaG virulence genes were identified by PCR. The genetic environment of blaCTX-M-1 was analyzed by PCR and sequencing. Plasmid replicons were determined using PCR-based replicon typing. The isolates were typed by MLVA and PFGE. All blaCTX-M-1 were blaCTX-M-15. The wcaG and rmpA were detected in 1 and 2 isolates, respectively. IncF were the most frequently detected replicons (63.88%). In all isolates, ISEcp1 was found upstream and orf477 downstream of blaCTX-M-15, IS26 was found in two isolates. MLVA identified 20 MLVA types, whereas PFGE identified 25 different profiles. The dissemination of CTX-M-15 in our isolates was due to the clonal spread of isolates and to the genetic transfer of mobile elements among unrelated strains. Keywords: CTX-M-15 b-lactamase, MLVA, Klebsiella pneumoniae, IncF
Introduction Klebsiella pneumoniae is a Gram-negative pathogen, frequently associated with nosocomial infections. It is usually encapsulated and capsule is considered to be an important virulence factor in K. pneumoniae that confers a mucoid phenotype.1 The plasmid gene rmpA (regulator of mucoid phenotype A) increases capsular polysaccharide production and results in hypermucoviscous phenotype.2 wcaG gene is located in the gene cluster responsible for capsule biosynthesis and needed for the conversion of mannose to fucose, which may enhance the ability of the bacteria to evade phagocytosis by macrophages.3 K. pneumoniae isolates are often associated with Extended Spectrum b-Lactamases (ESBLs) production. Among the ESBLs, the most widespread and clinically relevant are CTX-M-type b-lactamases.4 These enzymes have been classified into five major groups by amino acid sequence similarities: CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, and CTX-M-25.5 They have a preferential hydrolysis of cefotaxime over ceftazidime; although Poirel et al., (2002) have described some CTX-Ms, including CTX-M-15, with good activity against ceftazidime.6 A rapid increase of CTX-M-15 has been widely Correspondence to: Shahin Najar Peerayeh, Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Po Box: 14115158, Tehran, Iran. Tel: 0098-21-82883870, Fax: 0098-21-82884555. E-mail: [email protected]
ß 2015 Edizioni Scientifiche per l’Informazione su Farmaci e Terapia DOI 10.1179/1973947815Y.0000000002
reported, and CTX-M-15 is now the most common ESBL in much of the world.4 The rapid and wide spread of CTX-M enzymes worldwide is mainly due to the frequent association of them with different genetic mobile elements, such as transferable plasmids, transposons, and/or insertion sequences also responsible for the expression of b-lactamase-encoding genes (e.g. ISEcp1).7 Due to the role of plasmids in horizontal gene transfer, especially with regard to the emergence and dissemination of antimicrobial resistance, much attention has been paid to the identification and classification of bacterial plasmids. Carattoli et al.8 demonstrated a PCR-based replicon typing (PBRT) protocol that could be used to detect 18 plasmid replicons frequently found among the Enterobacteriaceae. However, epidemiology of CTX-M is more complex, involving not only horizontal gene transfer, but also the clonal spread of CTX-M-producing strains.9 Demonstration of clonal dissemination between K. pneumoniae isolates requires genotypic studies. Although Pulsed-Field Gel Electrophoresis (PFGE) is the current gold standard for bacterial typing, PFGE has several limitations, including the cost of the special equipment needed and poor reproducibility between laboratories.10 Multiple-Locus Variable-number tandem-repeat Analysis (MLVA) is a PCR - based typing method that involves the analysis of Variable-Number Tandem-Repeat
Journal of Chemotherapy
2015
VOL .
00
NO .
0
1
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
(VNTR) sequences found in the microbial genome and requires only basic equipment and allows interlaboratory comparisons of results.11 In this study, we aimed to describe the genetic characterization of blaCTX-M-1 group gene in Klebsiella pneumoniae isolated from Milad Hospital in Tehran, Iran and to investigate the relationship between isolates by MLVA and PFGE methods.
Materials and methods Bacterial isolates, identification, and ESBL characterization A total of 59 non-duplicate K. pneumoniae isolates were collected between May and December 2011 from different clinical specimens at Milad Hospital in Tehran, Iran and identified as K. pneumoniae using biochemical tests. Thirty-seven (62.7%) ESBL-producing K. pneumoniae isolates were detected by combined disk method.12 Amongst them, 36 CTX-M-1-producing isolates were detected by amplification of blaCTX-M-1 group gene and included in this study for further characterization. These 36 isolates were obtained between May and October 2011 and mostly isolated from urine (14/36 isolates, 38.8%), tracheal secretions (9/36 isolates, 25%), and wound (6/36 isolates, 16.6%). Primers and conditions used for amplification of blaCTX-M-1 group gene (amplicon size: 863 bp)13 are presented in Table 1.
Antibiotic susceptibility testing The antibiotic susceptibilities were determined by disk diffusion method on Mueller-Hinton agar plates (Merck, Darmstadt, Germany) according to the Clinical and Laboratory Standards Institute (CLSI) guidelines.12 The disks containing the following antibiotics (mg) were used (Mast, UK): aztreonam
(ATM, 30), cefotaxime (CTX, 30), ceftriaxone (CRO, 30), ceftazidime (CAZ, 30), cefepime (FEP, 30), cefoxitin (FOX, 30), amoxicillin-clavulanate (AMC, 30), imipenem (IPM, 10), ciprofloxacin (CIP, 5), tetracycline (TET, 30), trimethoprim-sulphamethoxazole (SXT, 25), tobramycin (TOB, 10), gentamicin (GEN, 10), and amikacin (AMK, 30). E. coli ATCC 25922 was used as quality control for antimicrobial susceptibility.
Detection of rmpA and wcaG genes Genomic DNA was prepared by freeze-thaw method and used as the template for PCR reactions.14 Amplification of rmpA and wcaG genes was performed as duplex-PCR on Gene Amp PCR System PTC-1148 (Biorad, USA) using published specific primer pairs for the rmpA (amplicon size: 535 bp)15 and wcaG (amplicon size: 169 bp) genes16 (Table 1). The PCR products were analyzed by electrophoresis with 1% agarose gels in 1X TAE (Tris-Acetate-EDTA) buffer. The gels were stained with ethidium bromide and the PCR products were visualized under UV light.
Conjugation and PCR amplification of blaCTX-M-1 group and virulence genes from transconjugants Mating experiments were performed with rifampicin resistant E. coli A15R- (kindly provided by Dr. Branca Bedenic, Zagreb, Croatia) as the recipient. Cultures of recipient strain and donor strains grown in Luria-Bertani broth (Scharlau, Spain) at 37 uC were mixed together at a 1:10 ratio (donor to recipient) and incubated at 37 uC for 16 h without shaking. Samples (0.1 mL) of this mixture were spread onto the surfaces of Mueller-Hinton agar plates containing 300 mg/mL rifampicin plus 3 mg/mL of cefotaxime.
Table 1 Sequences of the primers used to detect blaCTX-M-1, virulence genes, and genetic environment of blaCTX-M-1 group
2
Target
Primer name
Primer sequence (59 – 39)
Amplification conditions
Reference
blaCTX-M-1 group
M1F M1R
GGTTAAAAAATCACTGCGTC TTGGTGACGATTTTAGCCGC
13
rmpA
rmpAF rmpAR
ACTGGGCTACCTCTGCTTCA CTTGCATGAGCCATCTTTCA
wcaG
wcaGF wcaGR
GGTTGGGTCAGCAATCGTA ACTATTCCGCCAACTTTTGC
ISEcp1
ISEcp1 U1
AAAAATGATTGAAAGGTGGT
IS26
tnpA IS26
AGCGGTAAATCGTGGAGTGA
Orf477
ORF477R
CCAGGAACCACGGAGCTTAT
1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 52 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 58 uC, 90 s at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC
Journal of Chemotherapy
2015
VOL .
00
NO .
0
15
16
18
5
This study
Safoura Derakhshan et al.
Samples from donors and recipients were used as controls.17 The transconjugants growing on the selection plates were subjected to PCR to investigate the presence of blaCTX-M-1 group and the virulence genes (rmpA and wcaG) in transconjugants (Table 1).
Characterization of the genetic environment The genetic environment of blaCTX-M-1 group gene was characterized by PCR and sequencing of the regions surrounding these genes.18,19 The regions upstream of blaCTX-M-1 were amplified with forward primers for the insertion sequences ISEcp1 and IS26 and the CTX-M-1 reverse primer (M1R). The sequences located downstream of blaCTX-M-1 were studied with the forward primer M1F and the reverse primer orf477 (Table 1).
Plasmid replicon typing Plasmids from all isolates were assigned to incompatibility groups by PCR-based replicon typing (PBRT) performed on total DNA using previously described primers.8 Eighteen replicon types were searched for using five multiplex and three simplex-PCRs, recognizing the FIA, FIB, FIC, HI1, HI2, I1, L/M, N, P, W, T, A/C, K, B/O, X, Y, Frep, and FII replicons. Conditions used for PCR were as follows: 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 30 s at 60 uC, and 1 min at 72 uC; and a final extension of 7 min at 72 uC. Amplicons were visualized on 1% TAE agarose gels alongside a 100 bp ladder (GeneON, Germany). Positive controls used in the replicon typing procedure were kindly provided by Alessandra Carattoli (Istituto Superiore di Sanita, Rome, Italy).
Genotyping by multi-locus variable number tandem repeat analysis (MLVA) The isolates were typed using the MLVA method. Oligonucleotide primers targeting the 59 and 39 flanking regions of 9 VNTR loci (A, E, H, J, K, D, N1, N2, and N4) were used for amplification.16,20 Reactions were carried out using 1X PCR buffer, 1.5 mM MgCl2, 0.4 mM each primer, 200 mM each dNTP, 3 ml DNA extract and 1 U Taq DNA polymerase (Fermentas, Germany) in a total reaction volume of 25 ml. Thermocycler conditions were as follows: initial denaturation at 94 uC for 5 min; followed by 35 cycles of 94 uC for 1 min, 52 uC for 1 min, 72 uC for 1 min and a final extension at 72 uC for 7 min. Conditions were the same for all genes except loci H, E, J for which annealing temperature was 55 uC. Amplicons were separated in a 1.5% (w/v) agarose gel in 1X TBE (Tris-Borate-EDTA) buffer and run at 8 V/cm for 5 h. After the run, the gels were stained in ethidium bromide for 15 to 30 min and then rinsed with water and photographed under UV light. The size of each amplicon was estimated by comparison with a size ladder. Since the sizes of the flanking
CTX-M-15 in Klebsiella pneumoniae
sequences and repeat units were known, the number of repeats at each locus for each isolate could be determined and these were recorded in the order of loci D, K, N1, N2, A, H, E, J, and N4 giving the VNTR profile. All data were input into http://mlvaplus.net, and Minimum Spanning Tree (MST) analysis was performed. A new genotype number is given when one difference is observed at any VNTR. Clonal complexes are defined as groups of isolates for which the genotype differs at a maximum of two VNTRs.21
Genotyping by pulsed-field gel electrophoresis (PFGE) All isolates were further investigated for molecular epidemiological relationships by Xba I pulsed-field gel electrophoresis using the protocol recommended by PulseNet22 with minor modifications. Agarose plugs were digested with 10 U of Xba I restriction enzyme (Jena Bioscience, Germany) for 6 h at 37 uC. The digested plugs were run on to a 1% low melting agarose (Sigma, USA) gel using CHEF-DR II Mapper (BioRad Laboratories, USA) with initial pulse time for 2.2 s and final time for 54.2 s at 6 V for 20 h. PFGE banding patterns were compared using the GelCompar II software, version 4.0 (Applied Maths NV, Belgium). A dendrogram was generated using band-based Dice similarity coefficient and unweighted pair group method with arithmetic mean (UPGMA) with 1.5% position tolerance. Salmonella Braenderup H9812 was used as the reference strain. The DNA banding patterns were interpreted according to Tenover et al.23
Statistical analysis The discriminatory power of PFGE and MLVA was determined by Simpson’s index of diversity.24 Adjusted Wallace coefficient was used for calculation of the congruence between the typing methods. This coefficient indicates the probability that a pair of isolates which is assigned to the same type by one typing method is also typed as identical by the other method.24 All calculations were done using the freely available online tool Comparing Partitions located at http://Darwin. phyloviz.net/ComparingPartitions.
Results Antimicrobial susceptibility Sequence analysis identified all blaCTX-M-1 genes as blaCTX-M-15 (The GenBank accession number for blaCTX-M-15 gene is KC131462). Analysis of the antimicrobial susceptibility profile of the 36 blaCTX-M-15 positive isolates showed that all were resistant to cefotaxime, ceftriaxone, ceftazidime, aztreonam, and amoxicillin-clavulanate and were susceptible to imipenem (100%). They were highly resistant to tobramycin (88.8%), gentamicin and cefepime (80.5%, each). 41.6% of the isolates (15/36) showed simultaneous resistance to cefotaxime, ceftriaxone,
Journal of Chemotherapy
2015
VOL .
00
NO .
0
3
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
ceftazidime, amoxicillin-clavulanate, aztreonam, tobramycin, and ciprofloxacin. Resistance to trimethoprimsulphamethoxazole, amikacin, ciprofloxacin, and tetracycline was 55.5%, 50%, 44.4%, and 25%, respectively. The isolates showed high susceptibility to cefoxitin. Only 2 isolates tested (5.5%) were resistant to cefoxitin.
Detection of rmpA and wcaG genes Of the 36 blaCTX-M-15 positive isolates, the genes encoding RmpA and WcaG were detected in 8.3% of the isolates (3/36), the rmpA was detected in two isolates (5.5%) and the wcaG in one isolate (2.7%). No isolates featured both virulence genes.
Molecular typing of isolates by PFGE and MLVA Using any band difference in a pattern to designate MLVA types, the 36 blaCTX-M-15- positive isolates were divided into 20 MLVA types (Figure 1). The discriminatory power of MLVA was 0.944 (Simpson’s diversity index) with 95% confidence interval 0.909–0.980. Allele string 2.5, 2.5, 2, 3, 4, 3.5, 5, 5.5, 1 was the most commonly found MLVA type representing 16.6% (6/36) of the isolates. To examine the relatedness among the identified MLVA types, a Minimum Spanning Tree (MST)
Transferability of resistance and virulence genes In the mating assay, transconjugants were obtained from all isolates. PCR amplification of the transconjugants, revealed transferability for the wcaG but not for the rmpA genes. All isolates were able to transfer the blaCTX-M-15 gene to a recipient E. coli except one.
Exploration of the genetic environment of blaCTX-M-15 Analysis of the upstream sequence of blaCTX-M-15 revealed the presence of right terminal inverted repeat of the insertion sequence ISEcp1 upstream of start codon of the blaCTX-M-15 gene in all isolates and the putative promoter region ({10 and {35) associated with this element. The right boundary of ISEcp1 was located 48 bp upstream of the start codon of the blaCTX-M-15 gene. IS26 was found in the upstream region of only two isolates (22 k and 34 k). These isolates contained a region of the IS26 transposase (211 bp) flanking a partially truncated ISEcp1 whose size was 497 and 238 bp, respectively, followed by an intergenic region. In all isolates studied, the open reading frame orf477 was detected downstream of the blaCTX-M-15.
Replicon typing of the isolates Replicon typing was performed with the oligonucleotide primers described by Carattoli et al.8 The isolates carried different replicons either alone or in combination. The replicons could not be determined in 7 (19.4%) of the 36 isolates tested. In total, 16 (44.4%) of the 36 isolates were multireplicon. IncF replicons were the most frequently detected replicon types (23/36 isolates, 63.8%); followed by IncL/M (15/36, 41.6%), IncHI1 (8/ 36, 22.2%), and IncK/B (7/36; 19.4%). Of IncF plasmids, the most belonged to FII replicon (13/23, 56.5%). Other replicons identified were as follows: FIC (7/36 isolates, 19.4%), B/O (4/36, 11.1%), N (3/36, 8.3%), X, Frep (2/36, 5.5%; each), and FIA, HI2 (1/36, 2.7%; each). FIB, W, P, T, I1, Y, and A/C replicons were not found.
4
Journal of Chemotherapy
2015
VOL .
00
NO .
0
Figure 1 Minimum Spanning Tree (MST) for MLVA of 36 K. pneumoniae isolates. Categorical coefficient was used to construct the MST. Each circle denotes an MLVA type, with the number of isolates in each type was indicated within the circle; the type number indicated beside the circle. The size of each circle indicates the number of isolates with this particular type. The circles surrounding the MLVA types denote types that belong to the same complex. MLVA complexes were assigned if 2 neighboring types did not differ in more than 2 VNTR loci. A thin line indicates allelic differences at 2 different VNTR loci and a dotted line denotes allelic differences at 3 or more VNTR loci.
Safoura Derakhshan et al.
analysis was performed based on the categorical data sets (Figure 1). Six clonal complexes (CCs) and five singletons were obtained. CC1 consisted of 13 isolates, was the largest clonal complex identified and grouped 5 MLVA types (MT1-MT5). 53.8% of CC1 strains (7/13) were isolated from Neonatal Intensive Care Unit (NICU). CC2 composed of 7 isolates grouped 2 MLVA types, MT9 and MT10 (MT10 was isolated from Intensive Care Unit (ICU) of hospital). Other complexes, CC3, CC4, CC5, and CC6 were composed of 4, 2, 2, and 2 isolates, respectively. Two rmpA- positive isolates were grouped in CC5 and CC6. PFGE analysis of the 36 blaCTX-M-15 positive isolates identified a total of 25 distinct PFGE profiles. Pulsotypes P3 and P14 were the most common pulsotypes that appeared in 6 (16.6%) isolates, each. The Simpson’s index of diversity for PFGE was 0.951 with the 95% confidence interval 0.908–0.994. Figure 2 shows the clustering of the PFGE types. The 25 PFGE types (pulsotypes) were grouped into four clusters (clusters I to IV), one major cluster (cluster I), and three medium and minor clusters (clusters II, III, and IV). Cluster I consisted of 16 isolates (44.4%), grouped 11 pulsotypes (P3-P13). Six isolates in this cluster
CTX-M-15 in Klebsiella pneumoniae
(pulsotype P3) were obtained from ICU ward and shared the same virulence-gene (as rmpA-, wcaG-) and MLVA profiles (as 2.5, 2.5, 2, 3, 4, 3.5, 5, 5.5, 1). Cluster II consisted of 13 isolates (36.1%), grouped 8 pulsotypes (P14-P21). The isolates in this cluster were collected from NICU (7 isolates), ICU (1), pediatric (1), women (1), neonatal (1), and emergency (2) wards. Similar PFGE pattern (similarity above 80%) was seen between isolates collected from NICU, women and neonatal wards and they shared identical virulence features (rmpA-, wcaG-) and almost identical VNTR profiles differing by only one locus (locus A). Clusters III and IV were smaller and contained 4 and 3 isolates, respectively. Four isolates in the cluster III were grouped into 4 pulsotypes (P22-P25) and their MLVA profiles were different in one locus (locus J). The antibiotic resistance and replicon contents of each pulsotype are presented in Table 2. As demonstrated in Table 2, most isolates with identical PFGE typing showed the similar antibiotic resistance profiles. For example, six isolates belonging to pulsotype P14 had the same resistance profile.
Concordance between methods To assess the congruence between typing methods the adjusted Wallace index was calculated. A good directional correlation between MLVA and PFGE results was found: the probability of two isolates having the same MLVA type (MT) also sharing the same PFGE type was 54.9%. By contrast, the chance that two isolates sharing the same PFGE type also shared the same MT was 62.4%. PFGE showed, therefore, to be more discriminatory than MLVA; a few cases of disagreement between results generated by the two typing methods were observed: the MLVA profile 2.5,10,4,2,5,5.5,3,15,1 was assigned to three strains dividing into three PFGE patterns (P22, P23, and P25). The isolates with identical PFGE profile (e.g. pulsotype P14) had different MLVA profile, varying in one locus (A) (Table 2 and Figure 2).
Discussion Figure 2 Dendrogram showing a cluster analysis of 36 K. pneumoniae isolates based on the PFGE profiles of the Xba I – digested chromosomal DNA of the bacterial strains. The dendrogram was constructed using the Dice coefficient and UPGMA clustering parameters at 1.5% position tolerance. Roman numerals I to IV denote strain clusters. The allelic profile indicates the allele numbers of the VNTR loci, with the number of repeat units at each VNTR locus being given in the order D, K, N1, N2, A, H, E, J, and N4. A dash (–) in the VNTR profile indicates that no amplicon was detected at that locus. Strain numbers and their association with ward, specimen, virulence genes, and respective VNTR profiles are indicated. Trachea: Tracheal secretions.
Among the different groups of described ESBLs, CTX-M enzymes have become the most prevalent ESBLs worldwide.4 In our study, all blaCTX-M-1 genes were identified as the blaCTX-M-15 gene. In order to monitor the dissemination of CTX-M15-producing K. pneumoniae isolates in Iran, we characterized CTX-M-15 producers collected from Milad Hospital in Tehran. The blaCTX-M-15 gene, first described in 2001,25 is the most common of ESBLs reported in the world.4,26–28 All of our isolates were resistant to ceftazidime, which is consistent with the better activity of CTX-M-15
Journal of Chemotherapy
2015
VOL .
00
NO .
0
5
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
Table 2 Antimicrobial resistance and plasmid replicons among 36 CTX-M -15 -producing K. pneumoniae isolates Pulsotypes MLVA types Isolate(s)
Replicon types
Antimicrobial resistance1
P1
MT19
P2 P3
MT12 MT10
P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14
MT11 MT7 MT8 MT13 MT5 MT15 MT1 MT9 MT6 MT4 MT2 MT3 MT1 MT2 MT1 MT3 MT3 MT1 MT16 MT20 MT14 MT17 MT17 MT18 MT17
L/M, K, FIIs L/M,FIC,K,FIIs HI1,L/M,FIC FIIs L/M,X,FIIs NT FIIs HI1 L/M,B/O FIIs NT NT HI1,N,K NT HI1,N FIA,FIC,B/O,Frep,K,FIIs FIC,K,FIIs NT L/M L/M L/M HI1,L/M HI1 L/M,FIIs L/M NT HI1 L/M,FIC,Frep,FIIs N,FIC,K HI1,HI2,FIIs FIC,B/O,K,FIIs B/O NT
CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TET, FEP,FOX CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,GEN,FEP CTX,CRO,CAZ,AMC,ATM,TET,SXT CTX,CRO,CAZ,AMC,ATM,TET,SXT,FEP,FOX CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,SXT,FEP CTX,CRO,CAZ,AMC,ATM,TOB,SXT,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,SXT,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,GEN,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT,GEN,FEP,AMK
P15 P16 P17 P18 P19 P20 P21 P22 P23 P24 P25
138 k 195 k 136 k 148 k 197 k-200 k 48 k 51 k 68 k 20 k 12 k 99 k 144 k 46 k 97 k 47 k 137 k 194 k 34 k 11 k-9 k 21 k 25 k-69 k 49 k 43 k 192 k 35 k 101 k 70 k 153 k 22 k 143 k 152 k 151 k 23 k
Abbreviations: ATM, aztreonam; CTX, cefotaxime; CRO, ceftriaxone; CAZ, ceftazidime; FEP, cefepime; FOX, cefoxitin, AMC, amoxicillin-clavulanate; CIP, ciprofloxacin; TET, tetracycline; SXT, trimethoprim-sulphamethoxazole, TOB, tobramycin; GEN, gentamicin; AMK, amikacin. NT, non-typable. 1 The resistance profiles excluded antimicrobial agents that exhibited intermediate resistance.
against ceftazidime. Co-resistance to other antimicrobial agents, a common trait in our strains, has often been described for CTX-M producing clinical isolates.29,30 The blaCTX-M-15 gene often associated with other ESBLs, aminoglycosides, and quinolone resistance genes on the same plasmids. These arrays of resistance genes confer a multidrug resistance phenotype that can be transferred horizontally.31 The wide spread of blaCTX-M-15 has been shown to be linked to defined mobile genetic elements such as ISEcp1 and specific plasmid types.9 In the present study, analysis of the upstream region of the blaCTX-M-15 revealed the presence of the right terminal inverted repeat of the ISEcp1 and the promoter sequences ({10 and {35) associated with this element9 in all isolates, followed by an intergenic region (48 bp). Another insertion sequence, IS26, was found upstream of the blaCTX-M15 gene inserted at 497 and 238 nucleotides from the ISEcp1 terminus in two isolates (22 k and 34 k, respectively). The insertion site of IS26 observed for isolate 22 k has been also reported by Coelho et al.19 in Spanish isolates. The particular insertion site observed for K. pneumoniae 34 k has not been previously described, suggesting a different origin or a different insertion
6
Journal of Chemotherapy
2015
VOL .
00
NO .
0
event for this IS. The absence of amplification of the IS26–blaCTX-M-15 region in the remaining studied strains might be due to the presence of a truncated IS26 sequence.18 All isolates studied harbored the orf477 downstream of the blaCTX-M-15. A similar organization has been reported for blaCTX-M-15 in several Enterobacteriaceae isolates in many geographical locations.5,9,32 The genetic location of the blaCTX-M-15 gene has not been studied in this work, but the results of conjugation experiment provided a good evidence for the localization of the blaCTX-M-15 on transferable plasmids in all of the isolates studied except one. Inability to achieve the blaCTX-M-15 transfer in this isolate might be due to chromosomal integration of this gene as was previously reported by Coelho et al.19 or, to the localization of blaCTX-M-15 on nontransferable plasmids.9 Resistance and virulence are not independent properties and their relationship may play an important role in the pathogenesis of K. pneumoniae infection.2 Plasmid-borne RmpA (regulator of mucoid phenotype A) is a virulence factor in K. pneumoniae, which confers a highly mucoviscous phenotype by enhancing
Safoura Derakhshan et al.
extracapsular polysaccharide synthesis. Another virulence gene, wcaG, encodes capsular fucose synthesis and enhances the ability of bacteria to evade phagocytosis by macrophages.3 The prevalence of these virulence genes in our strains was low (3/36 isolates, 8.3%). The rmpA gene has been identified to be located on a 180-kilobase large plasmid and wcaG gene is located in the gene clusters responsible for K. pneumoniae capsule biosynthesis.2 Our data revealed transferability for the wcaG, possibly because the wcaG is encoded on the transferable regions of chromosome.3 The results from the mating assay obtained for the wcaG gene should be confirmed by hybridization experiments. Although, PCR amplification of the transconjugants obtained from two rmpA-positive parents didn’t show the presence of the rmpA gene in the transconjugants, transfer might have occurred but the transconjugants bearing the rmpA plasmid were unable to grow in the presence of cefotaxime. PCR-based plasmid replicon typing of the isolates showed a high prevalence of the heterogeneous IncF plasmid family in our strain collection (63.8%), which is in agreement with other reports.33,34 A total of 11 different replicons, dominated by repL/M, FII, and HI1 suggested a heterogeneous plasmid replicon contents in our isolates. In this study, we didn’t determine the precise location of the blaCTX-M-15 gene and it was not clear which replicon type carried the CTX-M-15 gene. The replicons could not be determined in 19.4% of the 36 isolates tested. Although PBRT is a good method for detecting the replicons in large collections of plasmids, a potential pitfall with this technique is that classification is currently based on plasmids belonging to the classic Inc groups and divergent or novel replicons will be missed with this procedure.33 All of our isolates harbored a CTX-M-15 enzyme, enabling us to determine whether these clinical isolates were genetically related. Hence, we performed a population structure analysis of all isolates by Xba I-PFGE and MLVA methods. PFGE typing revealed a relatively high genotypic diversity with identification of the 25 PFGE types among the 36 isolates. The genetic diversity detected can be attributed to the diversity of sources introduced to this hospital. It is one of the largest hospitals in Iran and patients are referred to it from nearly all parts of the country. However, the PFGE profiles demonstrated the clonal dissemination of the strains in hospital wards especially in ICU and NICU. It appears that a pulsotype detected in the NICU (P14) was related to a strain isolated from women’s ward, as both of them produced similar PFGE patterns and belonged to one cluster (Fig. 2). Indeed, admission to ICU is one of the most important risk
CTX-M-15 in Klebsiella pneumoniae
factors for acquisition of ESBL producing enterobacteria.35 The clonal spread of isolates might have been due to the migration of patients within departments. An epidemiological study should be conducted to clarify the origins of suspected cross transmission and the possibility of a common source of infection within the unit or from an unidentified environmental source. MLVA data supported the PFGE analysis indicated a relatively high genotypic diversity of isolates with identification of the 20 MLVA types among the 36 isolates. Based on the adjusted Wallace values calculated, a good accordance was generally seen between the two methods, although MLVA was less discriminatory than PFGE, and a few cases of disagreement between the two methods were observed, with MLVA profiles typically corresponding to several PFGE profiles. Also, isolates with identical PFGE profiles did sometimes have different MLVA profiles. MLVA is a PCR – based typing method that requires only basic equipment and allows interlaboratory comparisons of results in contrast to PFGE.10 Recently, Brink et al., have developed an MLVA scheme for K. pneumoniae using a single-tube fluorescently primed multiplex PCR for 8 VNTRs and automated fragment size analysis. Their MLVA scheme showed a good genotyping resolution equal to that of MLST. Their results positioned this MLVA scheme as an appropriate, highthroughput and promising tool for K. pneumoniae epidemiology and outbreak management – at least preceding or in combination with MLST.36 In conclusion, CTX-M-15 is the most prevalent b-lactamase detected among the ESBL-positive K. pneumoniae isolates with a CTX-M-1 group phenotype in our hospital. The presence of the blaCTX-M-15 gene among the unrelated strains might be due to horizontal dissemination of mobile genetic elements among the unrelated strains. The presence of isolates with identical patterns suggests that clonal spread also played a role in the dissemination of ESBL-producing isolates. Results of this study may improve understanding of the resistance patterns and transmission dynamics of CTX-M-15- producing K. pneumoniae in Iran, thus aiding in stimulating the implementation of regulations and suitable infection control measures to control the further spread of CTX-M-15 producing K. pneumoniae strains.
Acknowledgements This study was supported by a grant from Tarbiat Modares University, Faculty of Medical Sciences, Tehran, Iran. We are grateful to the staff of the microbiology laboratory at the Milad hospital for collecting K. pneumoniae isolates used in this study.
Journal of Chemotherapy
2015
VOL .
00
NO .
0
7
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
Disclaimer Statements Contributors Safoura Derakhshan performed the microbiological and molecular studies. Shahin Najar Peerayeh designed the research, Bita Bakhshi advised the research.
Funding This study was supported by a grant from Tarbiat Modares University, Faculty of Medical Sciences, Tehran, Iran.
Conflicts of interest None.
Ethical approval This is an in vitro study and ethical approval was not required.
References 1 Cheng HY, Chen YS, Wu CY, Chang HY, Lai YC, Peng HL. RmpA regulation of capsular polysaccharide biosynthesis in Klebsiella pneumoniae CG43. J Bacteriol. 2010;192:3144–58. 2 Vila A, Cassata A, Pagella H, Amadio C, Yeh KM, Chang FY, et al. Appearance of Klebsiella pneumoniae liver abscess syndrome in Argentina: case report and review of molecular mechanisms of pathogenesis. Open Microbiol J. 2011;5:107–13. 3 Shu HY, Fung CP, Liu YM, Wu KM, Chen YT, Li LH, et al. Genetic diversity of capsular polysaccharide biosynthesis in Klebsiella pneumoniae clinical isolates. Microbiology. 2009;155: 4170–83. 4 Lee MY, Ko KS, Kang C-I, Chung DR, Peck KR, Song J-H. High prevalence of CTX-M-15-producing Klebsiella pneumoniae isolates in Asian countries: diverse clones and clonal dissemination. Int J Antimicrob Agents. 2011;38:160–3. 5 Eckert C, Gautier V, Arlet G. DNA sequence analysis of the genetic environment of various blaCTX-M genes. J Antimicrob Chemother. 2006;57:14–23. 6 Poirel L, Gniadkowski M, Nordmann P. Biochemical analysis of the ceftazidime-hydrolysing extended-spectrum beta-lactamase CTX-M-15 and of its structurally related beta-lactamase CTX-M-3. J Antimicrob Chemother. 2002;50:1031–4. 7 Necho S, Pharm AD, Peixe LV, Machado E, Referenciar C, Artigo E. Characterization of CTX-M-type extended-spectrum b-lactamases (ESBLs) among Entrobacteriaceae from a Portuguese hospital. Revista da Faculdade de Ciencias da Saude. 2009;6:254–63. 8 Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63:219–28. 9 Abbassi MS, Torres C, Achour W, Vinue L, Saenz Y, Costa D, et al. Genetic characterisation of CTX-M-15-producing Klebsiella pneumoniae and Escherichia coli strains isolated from stem cell transplant patients in Tunisia. Int J Antimicrob Agents. 2008;32:308–14. 10 Sekse C, Sunde M, Lindstedt BA, Hopp P, Bruheim T, Cudjoe KS, et al. Potentially human-pathogenic Escherichia coli O26 in Norwegian sheep flocks. Appl Environ Microbiol. 2011;77: 4949–58. 11 Gierczynski R, Golubov A, Neubauer H, Pham JN, Rakin A. Development of multiple-locus variable-number tandemrepeat analysis for Yersinia enterocolitica subsp. palearctica and its application to bioserogroup 4/O3 subtyping. J Clin Microbiol. 2007;45:2508–15. 12 Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twentieth Informational Supplement M100-S20. Wayne, PA: USA: CLSI; 2011. 13 Li G, Wei Q, Wang Y, Du X, Zhao Y, Jiang X. Novel genetic environment of the plasmid-mediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China. Eur J Clin Microbiol Infect Dis. 2011;30:575–80.
8
Journal of Chemotherapy
2015
VOL .
00
NO .
0
14 Kuske CR, Banton KL, Adorada DL, Stark PC, Hill KK, Jackson PJ. Small-scale DNA sample preparation method for field PCR detection of microbial cells and spores in soil. Appl Environ Microbiol. 1998;64:2463–72. 15 Nadasy KA, Domiati-Saad R, Tribble MA. Invasive Klebsiella pneumoniae syndrome in North America. Clin Infect Dis. 2007;45:e25–8. 16 Turton JF, Perry C, Elgohari S, Hampton CV. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J Med Microbiol. 2010;59:541–7. 17 Park YJ, Park SY, Oh EJ, Park JJ, Lee KY, Woo GJ, et al. Occurrence of extended-spectrum beta-lactamases among chromosomal AmpC-producing Enterobacter cloacae, Citrobacter freundii, and Serratia marcescens in Korea and investigation of screening criteria. Diagn Microbiol Infect Dis. 2005;51:265–9. 18 Saladin M, Cao VT, Lambert T, Donay JL, Herrmann JL, Ould-Hocine Z, et al. Diversity of CTX-M beta-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol Lett. 2002;209:161–8. 19 Coelho A, Gonzalez-Lopez JJ, Miro E, Alonso-Tarres C, Mirelis B, Larrosa MN, et al. Characterisation of the CTX-M-15-encoding gene in Klebsiella pneumoniae strains from the Barcelona metropolitan area: plasmid diversity and chromosomal integration. Int J Antimicrob Agents. 2010;36: 73–8. 20 Morris D, Boyle F, Morris C, Condon I, Delannoy-Vieillard AS, Power L, et al. Inter-hospital outbreak of Klebsiella pneumoniae producing KPC-2 carbapenemase in Ireland. J Antimicrob Chemother. 2012;67:2367–72. 21 Vu-Thien H, Corbineau G, Hormigos K, Fauroux B, Corvol H, Clement A, et al. Multiple-locus variable-number tandem-repeat analysis for longitudinal survey of sources of Pseudomonas aeruginosa infection in cystic fibrosis patients. J Clin Microbiol. 2007;45:3175–83. 22 Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, et al. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis. 2006;3:59–67. 23 Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33: 2233–9. 24 Elberse KE, Nunes S, Sa-Leao R, van der Heide HG, Schouls LM. Multiple-locus variable number tandem repeat analysis for Streptococcus pneumoniae: comparison with PFGE and MLST. PLoS One. 2011;6:e19668. 25 Karim A, Poirel L, Nagarajan S, Nordmann P. Plasmidmediated extended-spectrum b-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol Lett. 2001;201:237–41. 26 Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP, Canica MM, et al. Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J Antimicrob Chemother. 2008;61:273–81. 27 Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, et al. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum beta-lactamase CTX-M-15. Emerg Infect Dis. 2008;14:195–200. 28 Feizabadi MM, Mahamadi-Yeganeh S, Mirsalehian A, Mirafshar M, Mahboobi M, Nili F, et al. Genetic characterization of ESBL producing strains of Klebsiella pneumoniae from Tehran hospitals. J Infect Dev Ctries. 2010;4:609–15. 29 Karisik E, Ellington MJ, Pike R, Warren RE, Livermore DM, Woodford N. Molecular characterisation of plasmids encoding CTX-M-15 beta-lactamases from Escherichia coli strains in the United Kingdom. J Antimicrob Chemother. 2006;58:665–8. 30 Machado E, Coque TM, Canton R, Baquero F, Sousa JC, Peixe L, et al. Dissemination in Portugal of CTX-M-15-, OXA-1-, and TEM-1-producing Enterobacteriaceae strains containing the aac(6’)-Ib-cr gene, which encodes an aminoglycoside- and fluoroquinolone-modifying enzyme. Antimicrob Agents Chemother. 2006;50:3220–1. 31 Habeeb MA, Haque A, Iversen A, Giske CG. Occurrence of virulence genes, 16S rRNA methylases, and plasmid-mediated quinolone resistance genes in CTX-M-producing Escherichia coli from Pakistan. Eur J Clin Microbiol Infect Dis. 2013;, doi: 10.1007/s10096-013-1970-1.
Safoura Derakhshan et al.
32 Jouini A, Vinue L, Slama KB, Saenz Y, Klibi N, Hammami S, et al. Characterisation of CTX-M and SHV extended-spectrum b-lactamases and associated resistance genes in Escherichia coli strains of food samples in Tunisia. J Antimicrob Chemother. 2007;60:1137–41. 33 Carattoli A. Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents Chemother. 2009;53:2227–38. 34 Kamatchi C, Sumathi G, Vaidyanathan R. A pilot study on replicon typing of plasmids associated with ESBL genes in Klebsiella pneumoniae from Chennai. Advances BioTech. 2011;11:5–10.
CTX-M-15 in Klebsiella pneumoniae
35 Nedjai S, Barguigua A, Djahmi N, Jamali L, Zerouali K, Dekhil M, et al. Prevalence and characterization of extended spectrum beta-lactamases in Klebsiella-EnterobacterSerratia group bacteria, in Algeria. Med Mal Infect. 2012;42: 20–9. 36 Brink AA, von Wintersdorff CJ, van der Donk CF, Peeters AM, Beisser PS, Stobberingh EE, et al. Development and validation of a single-tube multiple-locus variable number tandem repeat analysis for Klebsiella pneumoniae. PloS One. 2014;9: e91209.
Journal of Chemotherapy
2015
VOL .
00
NO .
0
9
Genotyping and characterization of CTX-M-15 -producing Klebsiella pneumoniae isolated from an Iranian hospital Safoura Derakhshan, Shahin Najar Peerayeh*, Bita Bakhshi Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran The aims were to describe the genetic characterization of blaCTX-M-1 group gene in Klebsiella pneumoniae and to investigate the relationship between isolates by MLVA and PFGE. We analyzed 36 CTX-M group 1-ESBL producing K. pneumoniae. rmpA and wcaG virulence genes were identified by PCR. The genetic environment of blaCTX-M-1 was analyzed by PCR and sequencing. Plasmid replicons were determined using PCR-based replicon typing. The isolates were typed by MLVA and PFGE. All blaCTX-M-1 were blaCTX-M-15. The wcaG and rmpA were detected in 1 and 2 isolates, respectively. IncF were the most frequently detected replicons (63.88%). In all isolates, ISEcp1 was found upstream and orf477 downstream of blaCTX-M-15, IS26 was found in two isolates. MLVA identified 20 MLVA types, whereas PFGE identified 25 different profiles. The dissemination of CTX-M-15 in our isolates was due to the clonal spread of isolates and to the genetic transfer of mobile elements among unrelated strains. Keywords: CTX-M-15 b-lactamase, MLVA, Klebsiella pneumoniae, IncF
Introduction Klebsiella pneumoniae is a Gram-negative pathogen, frequently associated with nosocomial infections. It is usually encapsulated and capsule is considered to be an important virulence factor in K. pneumoniae that confers a mucoid phenotype.1 The plasmid gene rmpA (regulator of mucoid phenotype A) increases capsular polysaccharide production and results in hypermucoviscous phenotype.2 wcaG gene is located in the gene cluster responsible for capsule biosynthesis and needed for the conversion of mannose to fucose, which may enhance the ability of the bacteria to evade phagocytosis by macrophages.3 K. pneumoniae isolates are often associated with Extended Spectrum b-Lactamases (ESBLs) production. Among the ESBLs, the most widespread and clinically relevant are CTX-M-type b-lactamases.4 These enzymes have been classified into five major groups by amino acid sequence similarities: CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, and CTX-M-25.5 They have a preferential hydrolysis of cefotaxime over ceftazidime; although Poirel et al., (2002) have described some CTX-Ms, including CTX-M-15, with good activity against ceftazidime.6 A rapid increase of CTX-M-15 has been widely Correspondence to: Shahin Najar Peerayeh, Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Po Box: 14115158, Tehran, Iran. Tel: 0098-21-82883870, Fax: 0098-21-82884555. E-mail: [email protected]
ß 2015 Edizioni Scientifiche per l’Informazione su Farmaci e Terapia DOI 10.1179/1973947815Y.0000000002
reported, and CTX-M-15 is now the most common ESBL in much of the world.4 The rapid and wide spread of CTX-M enzymes worldwide is mainly due to the frequent association of them with different genetic mobile elements, such as transferable plasmids, transposons, and/or insertion sequences also responsible for the expression of b-lactamase-encoding genes (e.g. ISEcp1).7 Due to the role of plasmids in horizontal gene transfer, especially with regard to the emergence and dissemination of antimicrobial resistance, much attention has been paid to the identification and classification of bacterial plasmids. Carattoli et al.8 demonstrated a PCR-based replicon typing (PBRT) protocol that could be used to detect 18 plasmid replicons frequently found among the Enterobacteriaceae. However, epidemiology of CTX-M is more complex, involving not only horizontal gene transfer, but also the clonal spread of CTX-M-producing strains.9 Demonstration of clonal dissemination between K. pneumoniae isolates requires genotypic studies. Although Pulsed-Field Gel Electrophoresis (PFGE) is the current gold standard for bacterial typing, PFGE has several limitations, including the cost of the special equipment needed and poor reproducibility between laboratories.10 Multiple-Locus Variable-number tandem-repeat Analysis (MLVA) is a PCR - based typing method that involves the analysis of Variable-Number Tandem-Repeat
Journal of Chemotherapy
2015
VOL .
00
NO .
0
1
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
(VNTR) sequences found in the microbial genome and requires only basic equipment and allows interlaboratory comparisons of results.11 In this study, we aimed to describe the genetic characterization of blaCTX-M-1 group gene in Klebsiella pneumoniae isolated from Milad Hospital in Tehran, Iran and to investigate the relationship between isolates by MLVA and PFGE methods.
Materials and methods Bacterial isolates, identification, and ESBL characterization A total of 59 non-duplicate K. pneumoniae isolates were collected between May and December 2011 from different clinical specimens at Milad Hospital in Tehran, Iran and identified as K. pneumoniae using biochemical tests. Thirty-seven (62.7%) ESBL-producing K. pneumoniae isolates were detected by combined disk method.12 Amongst them, 36 CTX-M-1-producing isolates were detected by amplification of blaCTX-M-1 group gene and included in this study for further characterization. These 36 isolates were obtained between May and October 2011 and mostly isolated from urine (14/36 isolates, 38.8%), tracheal secretions (9/36 isolates, 25%), and wound (6/36 isolates, 16.6%). Primers and conditions used for amplification of blaCTX-M-1 group gene (amplicon size: 863 bp)13 are presented in Table 1.
Antibiotic susceptibility testing The antibiotic susceptibilities were determined by disk diffusion method on Mueller-Hinton agar plates (Merck, Darmstadt, Germany) according to the Clinical and Laboratory Standards Institute (CLSI) guidelines.12 The disks containing the following antibiotics (mg) were used (Mast, UK): aztreonam
(ATM, 30), cefotaxime (CTX, 30), ceftriaxone (CRO, 30), ceftazidime (CAZ, 30), cefepime (FEP, 30), cefoxitin (FOX, 30), amoxicillin-clavulanate (AMC, 30), imipenem (IPM, 10), ciprofloxacin (CIP, 5), tetracycline (TET, 30), trimethoprim-sulphamethoxazole (SXT, 25), tobramycin (TOB, 10), gentamicin (GEN, 10), and amikacin (AMK, 30). E. coli ATCC 25922 was used as quality control for antimicrobial susceptibility.
Detection of rmpA and wcaG genes Genomic DNA was prepared by freeze-thaw method and used as the template for PCR reactions.14 Amplification of rmpA and wcaG genes was performed as duplex-PCR on Gene Amp PCR System PTC-1148 (Biorad, USA) using published specific primer pairs for the rmpA (amplicon size: 535 bp)15 and wcaG (amplicon size: 169 bp) genes16 (Table 1). The PCR products were analyzed by electrophoresis with 1% agarose gels in 1X TAE (Tris-Acetate-EDTA) buffer. The gels were stained with ethidium bromide and the PCR products were visualized under UV light.
Conjugation and PCR amplification of blaCTX-M-1 group and virulence genes from transconjugants Mating experiments were performed with rifampicin resistant E. coli A15R- (kindly provided by Dr. Branca Bedenic, Zagreb, Croatia) as the recipient. Cultures of recipient strain and donor strains grown in Luria-Bertani broth (Scharlau, Spain) at 37 uC were mixed together at a 1:10 ratio (donor to recipient) and incubated at 37 uC for 16 h without shaking. Samples (0.1 mL) of this mixture were spread onto the surfaces of Mueller-Hinton agar plates containing 300 mg/mL rifampicin plus 3 mg/mL of cefotaxime.
Table 1 Sequences of the primers used to detect blaCTX-M-1, virulence genes, and genetic environment of blaCTX-M-1 group
2
Target
Primer name
Primer sequence (59 – 39)
Amplification conditions
Reference
blaCTX-M-1 group
M1F M1R
GGTTAAAAAATCACTGCGTC TTGGTGACGATTTTAGCCGC
13
rmpA
rmpAF rmpAR
ACTGGGCTACCTCTGCTTCA CTTGCATGAGCCATCTTTCA
wcaG
wcaGF wcaGR
GGTTGGGTCAGCAATCGTA ACTATTCCGCCAACTTTTGC
ISEcp1
ISEcp1 U1
AAAAATGATTGAAAGGTGGT
IS26
tnpA IS26
AGCGGTAAATCGTGGAGTGA
Orf477
ORF477R
CCAGGAACCACGGAGCTTAT
1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 52 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 58 uC, 90 s at 72 uC; 1 cycle of 7 min at 72 uC 1 cycle of 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 1 min at 54 uC, 1 min at 72 uC; 1 cycle of 7 min at 72 uC
Journal of Chemotherapy
2015
VOL .
00
NO .
0
15
16
18
5
This study
Safoura Derakhshan et al.
Samples from donors and recipients were used as controls.17 The transconjugants growing on the selection plates were subjected to PCR to investigate the presence of blaCTX-M-1 group and the virulence genes (rmpA and wcaG) in transconjugants (Table 1).
Characterization of the genetic environment The genetic environment of blaCTX-M-1 group gene was characterized by PCR and sequencing of the regions surrounding these genes.18,19 The regions upstream of blaCTX-M-1 were amplified with forward primers for the insertion sequences ISEcp1 and IS26 and the CTX-M-1 reverse primer (M1R). The sequences located downstream of blaCTX-M-1 were studied with the forward primer M1F and the reverse primer orf477 (Table 1).
Plasmid replicon typing Plasmids from all isolates were assigned to incompatibility groups by PCR-based replicon typing (PBRT) performed on total DNA using previously described primers.8 Eighteen replicon types were searched for using five multiplex and three simplex-PCRs, recognizing the FIA, FIB, FIC, HI1, HI2, I1, L/M, N, P, W, T, A/C, K, B/O, X, Y, Frep, and FII replicons. Conditions used for PCR were as follows: 5 min at 94 uC; 35 cycles of 1 min at 94 uC, 30 s at 60 uC, and 1 min at 72 uC; and a final extension of 7 min at 72 uC. Amplicons were visualized on 1% TAE agarose gels alongside a 100 bp ladder (GeneON, Germany). Positive controls used in the replicon typing procedure were kindly provided by Alessandra Carattoli (Istituto Superiore di Sanita, Rome, Italy).
Genotyping by multi-locus variable number tandem repeat analysis (MLVA) The isolates were typed using the MLVA method. Oligonucleotide primers targeting the 59 and 39 flanking regions of 9 VNTR loci (A, E, H, J, K, D, N1, N2, and N4) were used for amplification.16,20 Reactions were carried out using 1X PCR buffer, 1.5 mM MgCl2, 0.4 mM each primer, 200 mM each dNTP, 3 ml DNA extract and 1 U Taq DNA polymerase (Fermentas, Germany) in a total reaction volume of 25 ml. Thermocycler conditions were as follows: initial denaturation at 94 uC for 5 min; followed by 35 cycles of 94 uC for 1 min, 52 uC for 1 min, 72 uC for 1 min and a final extension at 72 uC for 7 min. Conditions were the same for all genes except loci H, E, J for which annealing temperature was 55 uC. Amplicons were separated in a 1.5% (w/v) agarose gel in 1X TBE (Tris-Borate-EDTA) buffer and run at 8 V/cm for 5 h. After the run, the gels were stained in ethidium bromide for 15 to 30 min and then rinsed with water and photographed under UV light. The size of each amplicon was estimated by comparison with a size ladder. Since the sizes of the flanking
CTX-M-15 in Klebsiella pneumoniae
sequences and repeat units were known, the number of repeats at each locus for each isolate could be determined and these were recorded in the order of loci D, K, N1, N2, A, H, E, J, and N4 giving the VNTR profile. All data were input into http://mlvaplus.net, and Minimum Spanning Tree (MST) analysis was performed. A new genotype number is given when one difference is observed at any VNTR. Clonal complexes are defined as groups of isolates for which the genotype differs at a maximum of two VNTRs.21
Genotyping by pulsed-field gel electrophoresis (PFGE) All isolates were further investigated for molecular epidemiological relationships by Xba I pulsed-field gel electrophoresis using the protocol recommended by PulseNet22 with minor modifications. Agarose plugs were digested with 10 U of Xba I restriction enzyme (Jena Bioscience, Germany) for 6 h at 37 uC. The digested plugs were run on to a 1% low melting agarose (Sigma, USA) gel using CHEF-DR II Mapper (BioRad Laboratories, USA) with initial pulse time for 2.2 s and final time for 54.2 s at 6 V for 20 h. PFGE banding patterns were compared using the GelCompar II software, version 4.0 (Applied Maths NV, Belgium). A dendrogram was generated using band-based Dice similarity coefficient and unweighted pair group method with arithmetic mean (UPGMA) with 1.5% position tolerance. Salmonella Braenderup H9812 was used as the reference strain. The DNA banding patterns were interpreted according to Tenover et al.23
Statistical analysis The discriminatory power of PFGE and MLVA was determined by Simpson’s index of diversity.24 Adjusted Wallace coefficient was used for calculation of the congruence between the typing methods. This coefficient indicates the probability that a pair of isolates which is assigned to the same type by one typing method is also typed as identical by the other method.24 All calculations were done using the freely available online tool Comparing Partitions located at http://Darwin. phyloviz.net/ComparingPartitions.
Results Antimicrobial susceptibility Sequence analysis identified all blaCTX-M-1 genes as blaCTX-M-15 (The GenBank accession number for blaCTX-M-15 gene is KC131462). Analysis of the antimicrobial susceptibility profile of the 36 blaCTX-M-15 positive isolates showed that all were resistant to cefotaxime, ceftriaxone, ceftazidime, aztreonam, and amoxicillin-clavulanate and were susceptible to imipenem (100%). They were highly resistant to tobramycin (88.8%), gentamicin and cefepime (80.5%, each). 41.6% of the isolates (15/36) showed simultaneous resistance to cefotaxime, ceftriaxone,
Journal of Chemotherapy
2015
VOL .
00
NO .
0
3
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
ceftazidime, amoxicillin-clavulanate, aztreonam, tobramycin, and ciprofloxacin. Resistance to trimethoprimsulphamethoxazole, amikacin, ciprofloxacin, and tetracycline was 55.5%, 50%, 44.4%, and 25%, respectively. The isolates showed high susceptibility to cefoxitin. Only 2 isolates tested (5.5%) were resistant to cefoxitin.
Detection of rmpA and wcaG genes Of the 36 blaCTX-M-15 positive isolates, the genes encoding RmpA and WcaG were detected in 8.3% of the isolates (3/36), the rmpA was detected in two isolates (5.5%) and the wcaG in one isolate (2.7%). No isolates featured both virulence genes.
Molecular typing of isolates by PFGE and MLVA Using any band difference in a pattern to designate MLVA types, the 36 blaCTX-M-15- positive isolates were divided into 20 MLVA types (Figure 1). The discriminatory power of MLVA was 0.944 (Simpson’s diversity index) with 95% confidence interval 0.909–0.980. Allele string 2.5, 2.5, 2, 3, 4, 3.5, 5, 5.5, 1 was the most commonly found MLVA type representing 16.6% (6/36) of the isolates. To examine the relatedness among the identified MLVA types, a Minimum Spanning Tree (MST)
Transferability of resistance and virulence genes In the mating assay, transconjugants were obtained from all isolates. PCR amplification of the transconjugants, revealed transferability for the wcaG but not for the rmpA genes. All isolates were able to transfer the blaCTX-M-15 gene to a recipient E. coli except one.
Exploration of the genetic environment of blaCTX-M-15 Analysis of the upstream sequence of blaCTX-M-15 revealed the presence of right terminal inverted repeat of the insertion sequence ISEcp1 upstream of start codon of the blaCTX-M-15 gene in all isolates and the putative promoter region ({10 and {35) associated with this element. The right boundary of ISEcp1 was located 48 bp upstream of the start codon of the blaCTX-M-15 gene. IS26 was found in the upstream region of only two isolates (22 k and 34 k). These isolates contained a region of the IS26 transposase (211 bp) flanking a partially truncated ISEcp1 whose size was 497 and 238 bp, respectively, followed by an intergenic region. In all isolates studied, the open reading frame orf477 was detected downstream of the blaCTX-M-15.
Replicon typing of the isolates Replicon typing was performed with the oligonucleotide primers described by Carattoli et al.8 The isolates carried different replicons either alone or in combination. The replicons could not be determined in 7 (19.4%) of the 36 isolates tested. In total, 16 (44.4%) of the 36 isolates were multireplicon. IncF replicons were the most frequently detected replicon types (23/36 isolates, 63.8%); followed by IncL/M (15/36, 41.6%), IncHI1 (8/ 36, 22.2%), and IncK/B (7/36; 19.4%). Of IncF plasmids, the most belonged to FII replicon (13/23, 56.5%). Other replicons identified were as follows: FIC (7/36 isolates, 19.4%), B/O (4/36, 11.1%), N (3/36, 8.3%), X, Frep (2/36, 5.5%; each), and FIA, HI2 (1/36, 2.7%; each). FIB, W, P, T, I1, Y, and A/C replicons were not found.
4
Journal of Chemotherapy
2015
VOL .
00
NO .
0
Figure 1 Minimum Spanning Tree (MST) for MLVA of 36 K. pneumoniae isolates. Categorical coefficient was used to construct the MST. Each circle denotes an MLVA type, with the number of isolates in each type was indicated within the circle; the type number indicated beside the circle. The size of each circle indicates the number of isolates with this particular type. The circles surrounding the MLVA types denote types that belong to the same complex. MLVA complexes were assigned if 2 neighboring types did not differ in more than 2 VNTR loci. A thin line indicates allelic differences at 2 different VNTR loci and a dotted line denotes allelic differences at 3 or more VNTR loci.
Safoura Derakhshan et al.
analysis was performed based on the categorical data sets (Figure 1). Six clonal complexes (CCs) and five singletons were obtained. CC1 consisted of 13 isolates, was the largest clonal complex identified and grouped 5 MLVA types (MT1-MT5). 53.8% of CC1 strains (7/13) were isolated from Neonatal Intensive Care Unit (NICU). CC2 composed of 7 isolates grouped 2 MLVA types, MT9 and MT10 (MT10 was isolated from Intensive Care Unit (ICU) of hospital). Other complexes, CC3, CC4, CC5, and CC6 were composed of 4, 2, 2, and 2 isolates, respectively. Two rmpA- positive isolates were grouped in CC5 and CC6. PFGE analysis of the 36 blaCTX-M-15 positive isolates identified a total of 25 distinct PFGE profiles. Pulsotypes P3 and P14 were the most common pulsotypes that appeared in 6 (16.6%) isolates, each. The Simpson’s index of diversity for PFGE was 0.951 with the 95% confidence interval 0.908–0.994. Figure 2 shows the clustering of the PFGE types. The 25 PFGE types (pulsotypes) were grouped into four clusters (clusters I to IV), one major cluster (cluster I), and three medium and minor clusters (clusters II, III, and IV). Cluster I consisted of 16 isolates (44.4%), grouped 11 pulsotypes (P3-P13). Six isolates in this cluster
CTX-M-15 in Klebsiella pneumoniae
(pulsotype P3) were obtained from ICU ward and shared the same virulence-gene (as rmpA-, wcaG-) and MLVA profiles (as 2.5, 2.5, 2, 3, 4, 3.5, 5, 5.5, 1). Cluster II consisted of 13 isolates (36.1%), grouped 8 pulsotypes (P14-P21). The isolates in this cluster were collected from NICU (7 isolates), ICU (1), pediatric (1), women (1), neonatal (1), and emergency (2) wards. Similar PFGE pattern (similarity above 80%) was seen between isolates collected from NICU, women and neonatal wards and they shared identical virulence features (rmpA-, wcaG-) and almost identical VNTR profiles differing by only one locus (locus A). Clusters III and IV were smaller and contained 4 and 3 isolates, respectively. Four isolates in the cluster III were grouped into 4 pulsotypes (P22-P25) and their MLVA profiles were different in one locus (locus J). The antibiotic resistance and replicon contents of each pulsotype are presented in Table 2. As demonstrated in Table 2, most isolates with identical PFGE typing showed the similar antibiotic resistance profiles. For example, six isolates belonging to pulsotype P14 had the same resistance profile.
Concordance between methods To assess the congruence between typing methods the adjusted Wallace index was calculated. A good directional correlation between MLVA and PFGE results was found: the probability of two isolates having the same MLVA type (MT) also sharing the same PFGE type was 54.9%. By contrast, the chance that two isolates sharing the same PFGE type also shared the same MT was 62.4%. PFGE showed, therefore, to be more discriminatory than MLVA; a few cases of disagreement between results generated by the two typing methods were observed: the MLVA profile 2.5,10,4,2,5,5.5,3,15,1 was assigned to three strains dividing into three PFGE patterns (P22, P23, and P25). The isolates with identical PFGE profile (e.g. pulsotype P14) had different MLVA profile, varying in one locus (A) (Table 2 and Figure 2).
Discussion Figure 2 Dendrogram showing a cluster analysis of 36 K. pneumoniae isolates based on the PFGE profiles of the Xba I – digested chromosomal DNA of the bacterial strains. The dendrogram was constructed using the Dice coefficient and UPGMA clustering parameters at 1.5% position tolerance. Roman numerals I to IV denote strain clusters. The allelic profile indicates the allele numbers of the VNTR loci, with the number of repeat units at each VNTR locus being given in the order D, K, N1, N2, A, H, E, J, and N4. A dash (–) in the VNTR profile indicates that no amplicon was detected at that locus. Strain numbers and their association with ward, specimen, virulence genes, and respective VNTR profiles are indicated. Trachea: Tracheal secretions.
Among the different groups of described ESBLs, CTX-M enzymes have become the most prevalent ESBLs worldwide.4 In our study, all blaCTX-M-1 genes were identified as the blaCTX-M-15 gene. In order to monitor the dissemination of CTX-M15-producing K. pneumoniae isolates in Iran, we characterized CTX-M-15 producers collected from Milad Hospital in Tehran. The blaCTX-M-15 gene, first described in 2001,25 is the most common of ESBLs reported in the world.4,26–28 All of our isolates were resistant to ceftazidime, which is consistent with the better activity of CTX-M-15
Journal of Chemotherapy
2015
VOL .
00
NO .
0
5
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
Table 2 Antimicrobial resistance and plasmid replicons among 36 CTX-M -15 -producing K. pneumoniae isolates Pulsotypes MLVA types Isolate(s)
Replicon types
Antimicrobial resistance1
P1
MT19
P2 P3
MT12 MT10
P4 P5 P6 P7 P8 P9 P10 P11 P12 P13 P14
MT11 MT7 MT8 MT13 MT5 MT15 MT1 MT9 MT6 MT4 MT2 MT3 MT1 MT2 MT1 MT3 MT3 MT1 MT16 MT20 MT14 MT17 MT17 MT18 MT17
L/M, K, FIIs L/M,FIC,K,FIIs HI1,L/M,FIC FIIs L/M,X,FIIs NT FIIs HI1 L/M,B/O FIIs NT NT HI1,N,K NT HI1,N FIA,FIC,B/O,Frep,K,FIIs FIC,K,FIIs NT L/M L/M L/M HI1,L/M HI1 L/M,FIIs L/M NT HI1 L/M,FIC,Frep,FIIs N,FIC,K HI1,HI2,FIIs FIC,B/O,K,FIIs B/O NT
CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TET, FEP,FOX CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,GEN,FEP CTX,CRO,CAZ,AMC,ATM,TET,SXT CTX,CRO,CAZ,AMC,ATM,TET,SXT,FEP,FOX CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,CIP,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,SXT,FEP CTX,CRO,CAZ,AMC,ATM,TOB,SXT,GEN,FEP,AMK CTX,CRO,CAZ,AMC,ATM,TOB,SXT,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT,GEN,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,GEN,FEP CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT,GEN CTX,CRO,CAZ,AMC,ATM,CIP,TOB,TET,SXT,GEN,FEP,AMK
P15 P16 P17 P18 P19 P20 P21 P22 P23 P24 P25
138 k 195 k 136 k 148 k 197 k-200 k 48 k 51 k 68 k 20 k 12 k 99 k 144 k 46 k 97 k 47 k 137 k 194 k 34 k 11 k-9 k 21 k 25 k-69 k 49 k 43 k 192 k 35 k 101 k 70 k 153 k 22 k 143 k 152 k 151 k 23 k
Abbreviations: ATM, aztreonam; CTX, cefotaxime; CRO, ceftriaxone; CAZ, ceftazidime; FEP, cefepime; FOX, cefoxitin, AMC, amoxicillin-clavulanate; CIP, ciprofloxacin; TET, tetracycline; SXT, trimethoprim-sulphamethoxazole, TOB, tobramycin; GEN, gentamicin; AMK, amikacin. NT, non-typable. 1 The resistance profiles excluded antimicrobial agents that exhibited intermediate resistance.
against ceftazidime. Co-resistance to other antimicrobial agents, a common trait in our strains, has often been described for CTX-M producing clinical isolates.29,30 The blaCTX-M-15 gene often associated with other ESBLs, aminoglycosides, and quinolone resistance genes on the same plasmids. These arrays of resistance genes confer a multidrug resistance phenotype that can be transferred horizontally.31 The wide spread of blaCTX-M-15 has been shown to be linked to defined mobile genetic elements such as ISEcp1 and specific plasmid types.9 In the present study, analysis of the upstream region of the blaCTX-M-15 revealed the presence of the right terminal inverted repeat of the ISEcp1 and the promoter sequences ({10 and {35) associated with this element9 in all isolates, followed by an intergenic region (48 bp). Another insertion sequence, IS26, was found upstream of the blaCTX-M15 gene inserted at 497 and 238 nucleotides from the ISEcp1 terminus in two isolates (22 k and 34 k, respectively). The insertion site of IS26 observed for isolate 22 k has been also reported by Coelho et al.19 in Spanish isolates. The particular insertion site observed for K. pneumoniae 34 k has not been previously described, suggesting a different origin or a different insertion
6
Journal of Chemotherapy
2015
VOL .
00
NO .
0
event for this IS. The absence of amplification of the IS26–blaCTX-M-15 region in the remaining studied strains might be due to the presence of a truncated IS26 sequence.18 All isolates studied harbored the orf477 downstream of the blaCTX-M-15. A similar organization has been reported for blaCTX-M-15 in several Enterobacteriaceae isolates in many geographical locations.5,9,32 The genetic location of the blaCTX-M-15 gene has not been studied in this work, but the results of conjugation experiment provided a good evidence for the localization of the blaCTX-M-15 on transferable plasmids in all of the isolates studied except one. Inability to achieve the blaCTX-M-15 transfer in this isolate might be due to chromosomal integration of this gene as was previously reported by Coelho et al.19 or, to the localization of blaCTX-M-15 on nontransferable plasmids.9 Resistance and virulence are not independent properties and their relationship may play an important role in the pathogenesis of K. pneumoniae infection.2 Plasmid-borne RmpA (regulator of mucoid phenotype A) is a virulence factor in K. pneumoniae, which confers a highly mucoviscous phenotype by enhancing
Safoura Derakhshan et al.
extracapsular polysaccharide synthesis. Another virulence gene, wcaG, encodes capsular fucose synthesis and enhances the ability of bacteria to evade phagocytosis by macrophages.3 The prevalence of these virulence genes in our strains was low (3/36 isolates, 8.3%). The rmpA gene has been identified to be located on a 180-kilobase large plasmid and wcaG gene is located in the gene clusters responsible for K. pneumoniae capsule biosynthesis.2 Our data revealed transferability for the wcaG, possibly because the wcaG is encoded on the transferable regions of chromosome.3 The results from the mating assay obtained for the wcaG gene should be confirmed by hybridization experiments. Although, PCR amplification of the transconjugants obtained from two rmpA-positive parents didn’t show the presence of the rmpA gene in the transconjugants, transfer might have occurred but the transconjugants bearing the rmpA plasmid were unable to grow in the presence of cefotaxime. PCR-based plasmid replicon typing of the isolates showed a high prevalence of the heterogeneous IncF plasmid family in our strain collection (63.8%), which is in agreement with other reports.33,34 A total of 11 different replicons, dominated by repL/M, FII, and HI1 suggested a heterogeneous plasmid replicon contents in our isolates. In this study, we didn’t determine the precise location of the blaCTX-M-15 gene and it was not clear which replicon type carried the CTX-M-15 gene. The replicons could not be determined in 19.4% of the 36 isolates tested. Although PBRT is a good method for detecting the replicons in large collections of plasmids, a potential pitfall with this technique is that classification is currently based on plasmids belonging to the classic Inc groups and divergent or novel replicons will be missed with this procedure.33 All of our isolates harbored a CTX-M-15 enzyme, enabling us to determine whether these clinical isolates were genetically related. Hence, we performed a population structure analysis of all isolates by Xba I-PFGE and MLVA methods. PFGE typing revealed a relatively high genotypic diversity with identification of the 25 PFGE types among the 36 isolates. The genetic diversity detected can be attributed to the diversity of sources introduced to this hospital. It is one of the largest hospitals in Iran and patients are referred to it from nearly all parts of the country. However, the PFGE profiles demonstrated the clonal dissemination of the strains in hospital wards especially in ICU and NICU. It appears that a pulsotype detected in the NICU (P14) was related to a strain isolated from women’s ward, as both of them produced similar PFGE patterns and belonged to one cluster (Fig. 2). Indeed, admission to ICU is one of the most important risk
CTX-M-15 in Klebsiella pneumoniae
factors for acquisition of ESBL producing enterobacteria.35 The clonal spread of isolates might have been due to the migration of patients within departments. An epidemiological study should be conducted to clarify the origins of suspected cross transmission and the possibility of a common source of infection within the unit or from an unidentified environmental source. MLVA data supported the PFGE analysis indicated a relatively high genotypic diversity of isolates with identification of the 20 MLVA types among the 36 isolates. Based on the adjusted Wallace values calculated, a good accordance was generally seen between the two methods, although MLVA was less discriminatory than PFGE, and a few cases of disagreement between the two methods were observed, with MLVA profiles typically corresponding to several PFGE profiles. Also, isolates with identical PFGE profiles did sometimes have different MLVA profiles. MLVA is a PCR – based typing method that requires only basic equipment and allows interlaboratory comparisons of results in contrast to PFGE.10 Recently, Brink et al., have developed an MLVA scheme for K. pneumoniae using a single-tube fluorescently primed multiplex PCR for 8 VNTRs and automated fragment size analysis. Their MLVA scheme showed a good genotyping resolution equal to that of MLST. Their results positioned this MLVA scheme as an appropriate, highthroughput and promising tool for K. pneumoniae epidemiology and outbreak management – at least preceding or in combination with MLST.36 In conclusion, CTX-M-15 is the most prevalent b-lactamase detected among the ESBL-positive K. pneumoniae isolates with a CTX-M-1 group phenotype in our hospital. The presence of the blaCTX-M-15 gene among the unrelated strains might be due to horizontal dissemination of mobile genetic elements among the unrelated strains. The presence of isolates with identical patterns suggests that clonal spread also played a role in the dissemination of ESBL-producing isolates. Results of this study may improve understanding of the resistance patterns and transmission dynamics of CTX-M-15- producing K. pneumoniae in Iran, thus aiding in stimulating the implementation of regulations and suitable infection control measures to control the further spread of CTX-M-15 producing K. pneumoniae strains.
Acknowledgements This study was supported by a grant from Tarbiat Modares University, Faculty of Medical Sciences, Tehran, Iran. We are grateful to the staff of the microbiology laboratory at the Milad hospital for collecting K. pneumoniae isolates used in this study.
Journal of Chemotherapy
2015
VOL .
00
NO .
0
7
Safoura Derakhshan et al.
CTX-M-15 in Klebsiella pneumoniae
Disclaimer Statements Contributors Safoura Derakhshan performed the microbiological and molecular studies. Shahin Najar Peerayeh designed the research, Bita Bakhshi advised the research.
Funding This study was supported by a grant from Tarbiat Modares University, Faculty of Medical Sciences, Tehran, Iran.
Conflicts of interest None.
Ethical approval This is an in vitro study and ethical approval was not required.
References 1 Cheng HY, Chen YS, Wu CY, Chang HY, Lai YC, Peng HL. RmpA regulation of capsular polysaccharide biosynthesis in Klebsiella pneumoniae CG43. J Bacteriol. 2010;192:3144–58. 2 Vila A, Cassata A, Pagella H, Amadio C, Yeh KM, Chang FY, et al. Appearance of Klebsiella pneumoniae liver abscess syndrome in Argentina: case report and review of molecular mechanisms of pathogenesis. Open Microbiol J. 2011;5:107–13. 3 Shu HY, Fung CP, Liu YM, Wu KM, Chen YT, Li LH, et al. Genetic diversity of capsular polysaccharide biosynthesis in Klebsiella pneumoniae clinical isolates. Microbiology. 2009;155: 4170–83. 4 Lee MY, Ko KS, Kang C-I, Chung DR, Peck KR, Song J-H. High prevalence of CTX-M-15-producing Klebsiella pneumoniae isolates in Asian countries: diverse clones and clonal dissemination. Int J Antimicrob Agents. 2011;38:160–3. 5 Eckert C, Gautier V, Arlet G. DNA sequence analysis of the genetic environment of various blaCTX-M genes. J Antimicrob Chemother. 2006;57:14–23. 6 Poirel L, Gniadkowski M, Nordmann P. Biochemical analysis of the ceftazidime-hydrolysing extended-spectrum beta-lactamase CTX-M-15 and of its structurally related beta-lactamase CTX-M-3. J Antimicrob Chemother. 2002;50:1031–4. 7 Necho S, Pharm AD, Peixe LV, Machado E, Referenciar C, Artigo E. Characterization of CTX-M-type extended-spectrum b-lactamases (ESBLs) among Entrobacteriaceae from a Portuguese hospital. Revista da Faculdade de Ciencias da Saude. 2009;6:254–63. 8 Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63:219–28. 9 Abbassi MS, Torres C, Achour W, Vinue L, Saenz Y, Costa D, et al. Genetic characterisation of CTX-M-15-producing Klebsiella pneumoniae and Escherichia coli strains isolated from stem cell transplant patients in Tunisia. Int J Antimicrob Agents. 2008;32:308–14. 10 Sekse C, Sunde M, Lindstedt BA, Hopp P, Bruheim T, Cudjoe KS, et al. Potentially human-pathogenic Escherichia coli O26 in Norwegian sheep flocks. Appl Environ Microbiol. 2011;77: 4949–58. 11 Gierczynski R, Golubov A, Neubauer H, Pham JN, Rakin A. Development of multiple-locus variable-number tandemrepeat analysis for Yersinia enterocolitica subsp. palearctica and its application to bioserogroup 4/O3 subtyping. J Clin Microbiol. 2007;45:2508–15. 12 Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twentieth Informational Supplement M100-S20. Wayne, PA: USA: CLSI; 2011. 13 Li G, Wei Q, Wang Y, Du X, Zhao Y, Jiang X. Novel genetic environment of the plasmid-mediated KPC-3 gene detected in Escherichia coli and Citrobacter freundii isolates from China. Eur J Clin Microbiol Infect Dis. 2011;30:575–80.
8
Journal of Chemotherapy
2015
VOL .
00
NO .
0
14 Kuske CR, Banton KL, Adorada DL, Stark PC, Hill KK, Jackson PJ. Small-scale DNA sample preparation method for field PCR detection of microbial cells and spores in soil. Appl Environ Microbiol. 1998;64:2463–72. 15 Nadasy KA, Domiati-Saad R, Tribble MA. Invasive Klebsiella pneumoniae syndrome in North America. Clin Infect Dis. 2007;45:e25–8. 16 Turton JF, Perry C, Elgohari S, Hampton CV. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J Med Microbiol. 2010;59:541–7. 17 Park YJ, Park SY, Oh EJ, Park JJ, Lee KY, Woo GJ, et al. Occurrence of extended-spectrum beta-lactamases among chromosomal AmpC-producing Enterobacter cloacae, Citrobacter freundii, and Serratia marcescens in Korea and investigation of screening criteria. Diagn Microbiol Infect Dis. 2005;51:265–9. 18 Saladin M, Cao VT, Lambert T, Donay JL, Herrmann JL, Ould-Hocine Z, et al. Diversity of CTX-M beta-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol Lett. 2002;209:161–8. 19 Coelho A, Gonzalez-Lopez JJ, Miro E, Alonso-Tarres C, Mirelis B, Larrosa MN, et al. Characterisation of the CTX-M-15-encoding gene in Klebsiella pneumoniae strains from the Barcelona metropolitan area: plasmid diversity and chromosomal integration. Int J Antimicrob Agents. 2010;36: 73–8. 20 Morris D, Boyle F, Morris C, Condon I, Delannoy-Vieillard AS, Power L, et al. Inter-hospital outbreak of Klebsiella pneumoniae producing KPC-2 carbapenemase in Ireland. J Antimicrob Chemother. 2012;67:2367–72. 21 Vu-Thien H, Corbineau G, Hormigos K, Fauroux B, Corvol H, Clement A, et al. Multiple-locus variable-number tandem-repeat analysis for longitudinal survey of sources of Pseudomonas aeruginosa infection in cystic fibrosis patients. J Clin Microbiol. 2007;45:3175–83. 22 Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB, Swaminathan B, et al. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis. 2006;3:59–67. 23 Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33: 2233–9. 24 Elberse KE, Nunes S, Sa-Leao R, van der Heide HG, Schouls LM. Multiple-locus variable number tandem repeat analysis for Streptococcus pneumoniae: comparison with PFGE and MLST. PLoS One. 2011;6:e19668. 25 Karim A, Poirel L, Nagarajan S, Nordmann P. Plasmidmediated extended-spectrum b-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol Lett. 2001;201:237–41. 26 Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP, Canica MM, et al. Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J Antimicrob Chemother. 2008;61:273–81. 27 Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, et al. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum beta-lactamase CTX-M-15. Emerg Infect Dis. 2008;14:195–200. 28 Feizabadi MM, Mahamadi-Yeganeh S, Mirsalehian A, Mirafshar M, Mahboobi M, Nili F, et al. Genetic characterization of ESBL producing strains of Klebsiella pneumoniae from Tehran hospitals. J Infect Dev Ctries. 2010;4:609–15. 29 Karisik E, Ellington MJ, Pike R, Warren RE, Livermore DM, Woodford N. Molecular characterisation of plasmids encoding CTX-M-15 beta-lactamases from Escherichia coli strains in the United Kingdom. J Antimicrob Chemother. 2006;58:665–8. 30 Machado E, Coque TM, Canton R, Baquero F, Sousa JC, Peixe L, et al. Dissemination in Portugal of CTX-M-15-, OXA-1-, and TEM-1-producing Enterobacteriaceae strains containing the aac(6’)-Ib-cr gene, which encodes an aminoglycoside- and fluoroquinolone-modifying enzyme. Antimicrob Agents Chemother. 2006;50:3220–1. 31 Habeeb MA, Haque A, Iversen A, Giske CG. Occurrence of virulence genes, 16S rRNA methylases, and plasmid-mediated quinolone resistance genes in CTX-M-producing Escherichia coli from Pakistan. Eur J Clin Microbiol Infect Dis. 2013;, doi: 10.1007/s10096-013-1970-1.
Safoura Derakhshan et al.
32 Jouini A, Vinue L, Slama KB, Saenz Y, Klibi N, Hammami S, et al. Characterisation of CTX-M and SHV extended-spectrum b-lactamases and associated resistance genes in Escherichia coli strains of food samples in Tunisia. J Antimicrob Chemother. 2007;60:1137–41. 33 Carattoli A. Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents Chemother. 2009;53:2227–38. 34 Kamatchi C, Sumathi G, Vaidyanathan R. A pilot study on replicon typing of plasmids associated with ESBL genes in Klebsiella pneumoniae from Chennai. Advances BioTech. 2011;11:5–10.
CTX-M-15 in Klebsiella pneumoniae
35 Nedjai S, Barguigua A, Djahmi N, Jamali L, Zerouali K, Dekhil M, et al. Prevalence and characterization of extended spectrum beta-lactamases in Klebsiella-EnterobacterSerratia group bacteria, in Algeria. Med Mal Infect. 2012;42: 20–9. 36 Brink AA, von Wintersdorff CJ, van der Donk CF, Peeters AM, Beisser PS, Stobberingh EE, et al. Development and validation of a single-tube multiple-locus variable number tandem repeat analysis for Klebsiella pneumoniae. PloS One. 2014;9: e91209.
Journal of Chemotherapy
2015
VOL .
00
NO .
0
9
