CENOMICS

11,974-980

(1991)

Genomic Organization

of the Human Erythropoietin

Receptor Gene

LAURA A. PENNY AND BERNARD G. FORGET Departments

of Human Genetics and Internal Medicine, Yale University School of Medicine, 333 Cedar Street, New Haven, Connecticut 06510 Received

April

18, 1991;

Erythropoietin (EPO) mediatesthe growth and differentiation of erythroid progenitors through its interaction with a specificreceptor. Using a partial cDNA clone for the murine erythropoietin receptor, we isolated a human genomic clone containing the erythropoietin receptor gene.The coding region of the human EPO receptor geneis contained within eight exons spanning approximately 6 kb. The human gene has a great deal of structural similarity and sequence homology with the murine gene. The murine gene also has eight exons, although the size of each intron is somewhatdifferent. The locations at which the introns interrupt the coding sequenceare conserved precisely. The genomic organization of the EPO receptor gene is also shown to be homologousto the genomicorganization of the IL-2 receptor /3 chain gene. The sequenceof 1.1 kb of 5’ flanking DNA was characterized and contains consensus sequencesfor both Spl and GATA-1 binding sites and an initiator (In+like element, but lacks both a canonical TATA box and the CACCCconsensussequencefound in the murine gene. 0 1991 Academic Press, Inc.

revised

July 10, 1991

derstanding of the tissue- and stage-specific regulation of the expression of the EPO receptor gene will help define the early events in erythroid differentiation and perhaps provide insight into how the decision for commitment to the erythroid or the megakaryocytic lineages is made. To this end we have begun to study the regulatory regions of the human EPO receptor gene. We and others have recently cloned the cDNA for the human EPO receptor (Winkelmann et al., 1990; Jones et al., 1990). In this paper, we report the genomic structure of the human EPO receptor gene and the sequence of the putative regulatory regions immediately 5’ to this gene. MATERIALS

AND METHODS

Oligonucleotides

All oligonucleotides were synthesized by the Yale University Department of Pathology DNA Synthesis Service using an Applied Biosystems (Foster City, CA) automated synthesizer.

INTRODUCTION Radiolabeling Nucleic Acids

Erythropoietin (EPO) is a glycoprotein hormone that is the major regulator of erythropoiesis. EPO is produced by the kidney in response to hypoxia and acts upon committed erythroid progenitor cells in the bone marrow. The effects of EPO stimulation on erythroid progenitor cells include proliferation, maintenance of viability, and initiation of erythroid-specific gene expression. EPO stimulates the erythroid progenitor cells via a specific cell surface receptor that is expressed at very low levels on these cells. Expression of the EPO receptor gene is probably one of the earliest events to occur in erythroid differentiation, as stimulation by EPO must occur before an erythroid progenitor can progress any further along the erythroid differentiation pathway. An unSequence EMBL/GenBank

data

o&3-7543/91

$3.00

Oligonucleotides were 5’-end-labeled by polynucleotide kinase (New England Biolabs, Beverly, MA) using [y-32P]adenosine triphosphate (Amersham, Arlington Heights, IL). Larger DNA probes were labeled with 32P using a multiprime DNA labeling system (Amersham, Arlington Heights, IL), according to the manufacturer’s specifications. Screening Procedures

A mouse erythroleukemia cell (MEL) cDNA library constructed in the Xgtll vector with EcoRI linkers (a gift of V. Pate11 was screened using as probes two synthetic 36-base oligonucleotides (B’-GATGGCCCCTACTCCCACCCCTATGAGAACAGCCTT-3’, a sense probe, and 5’-CACATAGCCGGGATGCAGAGGCTCTGAGTCTGGGAC-3’, an antisense

from this article have been deposited with the Data Libraries under Accession No. M77244.

Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.

974

HUMAN

EPO

probe), corresponding to sequences from the 3’ end of the coding region of the murine EPO receptor cDNA (D’Andrea et al., 1989a). A single positively hybridizing clone, X29C, was isolated. A human genomic bacteriophage X library (Lawn et al., 1978) was screened under reduced stringency using a 1.5-kb SacI-CEaI fragment from the murine EPO receptor cDNA as a probe. The filters were hybridized to the probe at 37°C in hybridization buffer (750 m.&f NaCl; 75 mM Na citrate; 1 mg/ml BSA; 1 mg/ml polyvinylpyrrolidine; 1 mg/ml Ficoll400; 40 pg/ml salmon sperm DNA, 40 mA4 NaPO,, pH 7.0; 0.5% SDS; 50% formamide) for 36 h and washed at reduced stringency (0.1X SSC; 0.1% SDS, 5O’C) for 15 min. A single positively hybridizing bacteriophage clone, X13a, was isolated. Southern

Blotting

DNA samples were digested with restriction endonucleases, separated by electrophoresis on agarose gels, transferred to nitrocellulose filters (Schleicher and Schuell, Inc., Keene, NH), and hybridized with 32P-labeled probes as described (Maniatis et d., 1982). DNA Sequencing Nucleotide sequencing was performed on doublestranded plasmids by the dideoxynucleotide chain termination method (Sanger et aZ., 1977) using the Sequenase enzyme kit (USB, Cleveland, OH). Deoxyinosine triphosphate was substituted for deoxyguanosine triphosphate in sequencing reactions to resolve sequence ambiguities. Nucleotide sequences were analyzed using the University of Wisconsin Genetics Computer Group programs (Devereux et d., 1984; Devereux, 1989). Polymerase

Chain Reaction (PCR)

Two oligomers, a sense primer, 5’-CCAGTGGGCAGTGAGCATGC-S’, and an antisense primer, 5’CTCATATTGGATCCCTGATC-3, were used to amplify a 500-bp region of exon 8 of the human EPO receptor gene. DNA from a variety of sources was amplified (Saiki et al., 1988) using a Perkin-Elmer/Cetus (Norwalk, CT) DNA thermal cycler. The PCR reaction mixture contained 10 mM Tris-HCl (pH 8.3)/50 mM KC1/1.5 mM MgCl,/O.Ol% gelatin/200 PLM each dNTP/lOO ng each PCR primer, in a volume of 100 ~1. The denaturing step was done at 94°C for 1 min, the annealing step at 56°C for 2 min, and the extension step at 72’C for 2 min. The PCR product was gel purified and digested with MscI. Digestion products were analyzed on a 4% agarose gel.

RECEPTOR

975

GENE RESULTS

A human genomic DNA library was screened at reduced stringency with a 1.5-kb SacI-CZuI fragment that contains exons 2-7 and most of exon 8 of the murine EPO receptor cDNA. A single positively hybridizing clone, X13a, was isolated. The restriction endonuclease map of this clone was determined using EcoRI, BamHI, X&I, and HindIII and is shown schematically in Fig. 1. The exons comprising the 3’ end of the human EPO receptor gene were mapped by hybridization of the partial murine cDNA clone to Southern blots of subcloned fragments of X13a DNA. Because the extreme 5’ end of the murine EPO receptor gene was not represented in the murine cDNA clone that had ,been used as a probe, a synthetic oligonucleotide was used to determine the location of the 5’ end of the gene within the human genomic DNA. This oligonucleotide (5’-A TGGACAAACTCAGGGTGCCCCTCTGGCCT3’) is homologous to the extreme 5’ end of the coding region of the murine cDNA and is indicated by the asterisk above exon 1 in Fig. 1. Subcloned fragments of X13a DNA identified as containing exons by Southern blot analysis were sequenced. The coding sequence agrees with that predicted by the cDNA (Winkelmann et d., 1990; Jones et al., 1990) and encodes 508 amino acids corresponding to a molecular mass of 55 kDa. The translated amino acid sequence contains a putative 24-aminoacid signal peptide and a single transmembrane spanning domain at amino acids 251 through 272. The coding region of the human EPO receptor gene is contained within eight exons spanning approximately 6 kb. Exon 1 encodes the 5’ untranslated sequence, the predicted signal peptide, and the beginning of the mature protein. Exons 2 through 5 encode the remainder of the extracellular domain, exon 6 encodes the membrane spanning domain, and exons 7 and 8 encode the intracellular domain of the molecule. Exon 8 also contains an additional 200 bp of 3’ untranslated sequence. Figure 2 shows the sequences of the intron-exon junctions, the sizes of the introns, and the position at which each intron interrupts the coding sequence. The sequences of the donor and acceptor splice. sites conform to the consensus sequences for eukaryotic splice junctions. The locations of the intron-exon junctions within the coding sequence are conserved precisely between the human and the mouse genes. Introns 3,5, and 7 contain only 80 to 90 bp, which is close to the lower limit of intron size (Wieringa et al, 1984). ’ Figure 3 shows the sequence of the 3’ end of the cDNA clone ER2 (Winkelmann et al, 1990) aligned with the genomic sequence. ER2 sequence continues

976

I

0.5 kb

FIG. 1. clone X13a. Solid boxes Z-ZindIII; X,

2

PENNY

AND

34

56

intron AGC AAA G Ser Lys A 30

gtaaggatga..

. (.gOlkb).

. .ccctccccag

39

CG GCC TTG la Ala Leu 39

40

41

n

CAG CTC GA Gin Leu Gl 82

83

gtgagtccga...(.90Lkb)...gggcgcatag

84

u ASQ Glu 85 86

TG CTC CTA al Leu Leu 143 144 145

Glu Val V 141 142 143 GTA CAG AGG Val Gln Arg 193 194 195

gtgaggccag..

CCT AGC G Pro Ser A

gtgaggccca...(.0g5kb)...cg8efcffag

246

G GAT GAG a4

GAA GTA G

245

. ( .5Z41cb). . .ccgcccccag

247

GTG GAG ATC Val Glu Ile 196 197 198 AC CTG GAC SQ Leu Asp 247

248

249

6

CAC CGC CG His

Arg

Ar

274

275

276

AAC TTC CAG Asn Phe Gln 303

304

305

7

0

Genomic organization of the human EPO receptor gene. The top line shows the restriction map of the genomic The lower line shows the exon/intron organization of the EPO receptor gene. Exons are boxed and numbered represent coding regions, open boxes represent noncoding regions. (E), synthetic linker EcoRI sites; E, EcoRI; X&I. The asterisk represents the oligonucleotide that was used to map exon 1.

for 212 bp after a TAG termination codon and has an additional 13 adenosine residues that are not contained in the genomic DNA. A canonical poly(A) addition sequence (AATAAA) is not found in this region, although a GT-rich element, reported to be involved in 3’ end processing (reviewed by Proudfoot, 1991), is found in the genomic DNA just 3’to the point at which the cDNA and genomic sequences diverge. This element is underlined in Fig. 3. The nucleotide sequence of the coding region in X13a is identical to that of the published sequence (Winkelmann et al., 1990; Jones et al., 1990) except for one region of discrepancy. Exon 8 contains a 15bp insertion and another 7 bp that do not match a 7-bp

37

FORGET

gtgagctc.....(l.6

kb)...gcttcaacag

gtaggtggcc...(.09

kb)...atttcttcag

G GCT CTG g Ala Leu 276

277

270

CTG TGG CTG Leu Trp Leu 306

307

308

FIG. 2. Sequences of the intron-exon junctions of the human EPO receptor gene. Exon sequences are shown in uppercase letters, and intron sequences in lowercase letters. The encoded amino acid and its position are indicated below the exon sequences. The length of each intron is shown in parentheses.

DNA insert of below the line. B, BumHI; H,

region in the cDNA at the insertion site (see Fig. 4A). This insert does not introduce a frameshift or a stop codon into the sequence, and it is possible that this insertion was present in the patient whose DNA was used to construct the library. Because the original DNA of this patient was not available for e&&ation, we examined the library as well as other DNAs for the presence of this insert. A 500-bp fragment spanning the insert was amplified by PCR from a variety of DNAs. The resulting products were digested with MscI, producing a 380-bp fragment and either a 1% or 130-bp fragment, depending on whether normal DNA or DNA with the insert had been amplified (see Fig. 4B). This size difference was used to determine whether or not a DNA sample contained the insert. Both X13a and the subcloned fragment used to sequence this region contained the insert, indicating that the insert was not an artifact that had been created while subcloning X13a. The human genomic library from which clone X13a had been isolated was analyzed, and it was found to contain both the normal form of the gene and DNA with the insert. Fifty-four human chromosomes, including 12 Asian, 6 American black, 10 African black, 16 Caucasian, and 10 South American Indian chromosomes, were analyzed and none of these were found to contain the insert (data not shown). These results indicate that the insert is probably a cloning artifact and not a naturally occuring polymorphism. Figure 5 shows the sequence of 1.1 kb of 5’ flanking DNA of the human EPO receptor gene, including the putative promoter. A potential binding site for the ubiquitous transcription factor Spl (inverted complement of GGGCGG; Dynan and Tjian, 1983) is found at -152 from the ATG. A potential binding site for the erythroid- and megakaryocyte-specific tram-acting factor GATA-1 (inverted complement of (A/ T}GATA{A/G}; Martin et al., 1989) is found at -179. A 12-bp region identical in sequence and position to the sequence surrounding the murine cap site is found in the human promoter. Four nucleotides in the

HUMAN genomic

EPO RECEPTOR

GENE

977

CTATGTGGCTTGCTCTTAGGACACCAGGCTGCAGATGATCAGGGATCCAA

cDNA

1511

genomic

IlillllllllllllllllIlIIIllIIIIIIlIIIllIIIIIIlIIIIIIIIIIIIIIiIIIIIIIIIl

CTATGTGGCTTGCTCTTAGGCAGGCTGCAGATGATCTG YVACS*

1580

CAGACTCAA;;ACTTATGGFACAGGATGGCGAGGCCTCT~T~GGAG~~GGG~TTGC~GATTTTGTC~

cDNA

1581

genomic

IllllllllllllllllllIIIIIlIIIIIIIlIIIIIIIIIIIIIIIlIIlIIIIIIlIIIIIIIIIIl

CAGACTCAAGACTTATGGAACAGGGATGGCGAGGCCTCTCTCTCAGGAGCAGGGGCATTGCTGATTTTGTCT 1650 GCCCAATCCATCCTGCTCAGGAAACCACAACCTTGCAGTA

cDNA

1651

genomic

IIlIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIlIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIl

GCCCAATCCATCCTGCTCAGGAAACCACAACCTTGCAGTATTTTTTTTTGTAT

1720

CTATATATATATATACACATATGTATGTAAGTTTTTCTAC

cDNA

1721

IIIIIIIIIIIIIl

IIIIIII

CTATATATATATATACACAT AAAAAAAAAAAAAA

1790

FIG. 3. The 3’ untranslated region of the human EPO receptor gene. The genomic sequence is shown on the top line, and the cDNA sequence of clone ER2 is shown on the bottom line. The nucleotide position within the cDNA (0 is the first nucleotide of the initiator ATG) .sindicated to the sides of the sequence. The asterisk indicates the termination codon. A GT-rich sequence located immediately downstream If the site at which the cDNA and genomic DNA diverge is underlined.

:enter of this region match the core four nucleotides )f the Inr consensus (Smale and Baltimore, 1989; 3male et aZ., 1990) of TATA-less promoters. The TATA box motif and the CCAAT box motif, Found in many other erythroid promoters, are not found in this region, and this region does not contain 3 CACCC box which is present in the murine EPO receptor promoter (Youssoufian et aZ., 1990; Kuramochi et cd., 1990). A stretch of simple repeat sequence (G,A,) is lo:ated between -460 and -570. This repeat is similar to the CT simple repeat found in the flanking DNA of ;he sea urchin histone genes (Sures et cd., 1978). A

DISCUSSION

In this report we have described the genomic structure of the human EPO receptor gene. The coding region is contained within eight exons and spans approximately 6 kb. The first five exons encode the extracellular domain, exon 6 encodes the membrane spanning domain, and exons 7 and 8 encode the intracellular domain of the molecule. The human EPO receptor gene has a number of structural similarities with the murine EPO receptor gene (Youssoufian et uZ., 1990; Kuramochi et uZ., 1990). The murine gene also contains eight exons. The locations of the in-

genomic

PSEDLPGL LEQQQBA S V D I V CCCAGTGAGGACCTCCCAGGGC TGTTGGAGCAACAACAGGATGC CAGTGTGGACATAG

cDNA 1140

CCCAGTGAGGACCTCCCC CTGGTGG............... PSEDLPGP GG

IIIIIIIIIIIIII

IIIIIIIIIIIIIIIIIIIIII

CAGTGTGGACATAG 1182 S V D I V

B C

I

2

34

5

6

FIG. 4. Analysis of an insert found in exon 8 of the human EPO receptor gene. (A) Nucleotide and amino acid sequence of the region mrrounding a 15-bp insert in clone X13a. The genomic (X13a) sequence is shown on the top line, with its translated amino acid sequence above. The sequence of cDNA clone ER2 is shown on the bottom line, with ita translated amino acid sequence below. The nucleotide positions within the cDNA are indicated to the sides of the sequence. (B) Schematic diagram of the PCR product used to determine whether L given DNA sample contains the insert found in clone X13a. PCR primers are indicated by the boxes with arrows. Digestion with MscI results in a 33@bp fragment and either a 115- or 130-bp fragment, depending on whether the amplified product contains the insert. (C) MscI-digested PCR products fractionated by 4% agarose gel. The left lane contains DNA size standards, whose sizes are indicated in base pairs. Lane 1, LAP29 DNA, a subclone of h13a used to sequence the region containing the insert; lane 2, h13a DNA, lane 3, DNA from the human genomic library used to clone X13a; lane 4, EPO receptor cDNA ER2; lane 5, DNA from a human fetal liver cDNA library (Ref. (14)); lane 6, genomic DNA from a random individual. The human genomic library (lane 3) from which clone X13a was isolated appears to contain both normal DNA and DNA with the insert.

978

PENNY

AND

FORGET

-950

ACTCCTGACCTCAAGTGATTTGCCCACGTCGGCCTCCCAATG

-1049

-850

-a49 .

BarnHI.

AAGACCAGCCTGGACAACATAGTGGGATCCCATCCCATCTCTAC~G~TTTT~TTAGCCAGGT~AGTGGG~GATTGCTTCAGTCCAGA~CTGCAGT

-650

AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGTTTTTA

-450

-649

GAAGTCTGAAGCTCAGGTAAGGTAAGTCACCTGTCCAGGGCCACAAAGB

CGTGTGTCTGAAGCCAGAACGGGAGCTGTTGCGGCCCAACT GATA-1 SPl

ApaI

-250

. -150

PVUII -149 -49

PVUII

PVUII

TCGGGGATCTGCCACTTAGAGCCT~~CGGGAAGGGC

-50

GGAGACGGAGGGGCAGGAGCCCTGGGCTCCCCGTGGCGGGCTTTGTCTC

50

MDHLGASLWPQVGSLCL FIG. boxed.

6. Sequence of the DNA flanking the 5’ end of the human EPO receptor A 1%bp region conserved in both the mouse and human genes that flanks

tron-exon junctions within the coding sequence are conserved precisely between the human and the mouse genes. Introns 5 and 7 in both the human and the murine genes, and intron 3 of the human gene, are very small, consisting of only 70 to 90 bp. The significance of their small size is unknown. The sequence of the cDNA (Winkelmann et al., 1990) diverges from that of the genomic DNA 212 bp downstream from a termination codon. This cDNA clone then has an additional 13 adenosine residues that are not present in the genomic sequence. Three other cDNA clones from a human fetal liver cDNA library also end at this site (J. Winkelmann, personal communication). There is no canonical poly(A) addition signal (AATAAA) found in the region 10 to 30 bp upstream from the site at which the cDNA and genomic sequences diverge, although a GT-rich region, reported to be involved in 3’ end processing (reviewed by Proudfoot, 1991), lies immediately 3’ to this site. The murine gene does not have a canonical poly(A) signal either, although a 5/6 match to the poly(A) addition signal (AATATA) is present 130 bp downstream from the termination codon (Kuramochi et al., 1990). This site is 26 bp upstream from the point at which the murine cDNA and genomic DNA sequences diverge (Youssoufian et al., 1990; Kuramochi et al., 1990). Such a 5/6 bp match to the poly(A) addition signal is not present in the 3’ untranslated sequence of the hu-

gene. Potential binding the mouse transcription

sites for GATA-1 and Spl initiation site is underlined.

are

man gene for which we have sequence. However, the presence of the 13 adenosine residues at the 3’ end of cDNA clone ER2 and the fact that several other cDNA clones end at this site suggest that this clone is a full-length clone in the 3’ direction and that this region serves as the polyadenylation site. The cloned EPO receptor belongs to the cytokine receptor superfamily (D’Andrea et al., 1989b) that includes the interleukin (IL)-2 receptor B chain (Hatakeyama et al., 1989), the IL-3 receptor (Itoh et al., 1990), the IL-4 receptor (Mosley et aZ., 1989), the IL-6 receptor (Yamasaki et al., 1988), the IL-7 receptor (Goodwin et al., 1990), the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor (Gearing et al., 1989), and the prolactin and growth hormone receptors (Bazan, 1989). The overall level of homology among the members of this family is low (25-35%) but extends throughout the length of each molecule and is highest in the amino acid residues located to either side of the membrane spanning domains. The members of this family have an extracellular domain (duplicated in the case of the IL-3 receptor) that contains four conserved cysteines and a tryptophan-serine-X-tryptophan-serine (W-S) motif (D’Andrea et al., 1989b). The IL-2 receptor @chain gene has been characterized (Shibuya et al, 1990) and has been shown to consist of 10 exons spanning 24.3 kb. Despite this out-

HUMAN

EPO

EPO receptor 123

IL-2

receptor

4

56

7

a

!3 chain motif i-l

I2345

6

7

a9

IO

FIG. 6. Comparison of the exonic structures of the EPO receptor gene and the IL-2 receptor /3 chain gene. Introns are not drawn to scale, nor is the 3’ untranslated region of the IL-2 receptor fl chain gene drawn to scale. Solid boxes represent coding regions, open boxes represent noncoding regions, and slashed boxes represent the membrane-spanning domains. The exon numbers are indicated above the EPO receptor gene and below the IL-2 receptor /3 chain gene. Protein domains encoded by the exons are indicated at the bottom. The position of the tryptophan-serine (W-S) motif is indicated. Adapted from Ref. (10).

ward dissimilarity, the EPO receptor gene and the IL-2 receptor @chain gene have a number of striking similarities. The two extra exons in the IL-2 receptor @chain gene can be accounted for by observing that (1) an additional exon at the 5’ end of the IL-2 receptor p chain gene contains only untranslated sequence, and (2) one exon in the EPO receptor gene (exon 3) is roughly equivalent to two exons (4 and 5) in the IL-2 receptor @ chain gene. If the coding regions are aligned as proposed by D’Andrea et al. (1989b), the homology between the EPO receptor gene and the IL2 @chain gene begins in exon 2 of the EPO receptor and exon 3 of the IL-2 /3 chain gene and extends through the large final exon of both genes (see Fig. 6). This alignment superimposes the transmembrane domains and the tryptophan-serine (W-S) motifs of both molecules. Introns interrupt this alignment of the coding regions at roughly the same locations in both genes. The existence of these similarities in both amino acid sequence and genomic organization supports the hypothesis that the EPO receptor gene and the IL-2 receptor B chain gene, and possibly the entire cytokine receptor superfamily, arose from a common ancestral gene. To our knowledge, the genomic structures of the genes for the other receptors in this family have not yet been reported, and it is unknown whether they are similar in structure as well. We have characterized the putative regulatory elements in the region of DNA immediately 5’ to the EPO receptor gene. The 5’ flanking DNA contains a potential Spl binding site (Dynan and Tjian, 1983) at -152 from the initiator ATG. Spl is a ubiquitous

RECEPTOR

GENE

979

transcription factor whose binding site is found in the promoters and enhancers of many genes, and is therefore unlikely to regulate the tissue- or stage-specific expression of the EPO receptor gene. Of particular interest, however, is a potential binding site for the transcription factor GATA-1 at -179 from the ATG. GATA-1 is a transcription factor originally identified as an erythroid-specific DNA binding protein (Martin et al., 1989; Tsai et al., 1989) with a DNA sequence binding motif that is found in the cisregulatory elements of the majority of genes expressed in the erythroid cells of all vertebrates examined so far (Trainor et al, 1990, and references therein). Zon et al. (1990) have recently reported that the GATA-1 site in murine EPO receptor promotergrowth hormone reporter gene fusion constructs plays an important role in the expression of this promoter in both erythroid (MEL) cells and nonerythroid cells that have been cotransfected with the GATA-1 cDNA. The results of Zon et al. (1990) and the conservation of the GATA-1 site in the human EPO receptor gene promoter suggest that this transcription factor plays an important role in the expression of the EPO receptor gene. The human EPO receptor gene promoter does not contain a canonical TATA motif, and it is possible that the transcription start site is specified by an initiator element. The Inr sequence, which surrounds the transcription start site in many TATA-less promoters, serves to direct transcription initiation to a specific nucleotide within its sequence @male and Baltimore, 1989; Smale et al., 1990). Youssoufian et al. (1990) have demonstrated that transcription initiation of the mouse EPO receptor gene, which also lacks a TATA box, begins at a cluster of 3 nucleotides 150 bp upstream from the initiator ATG. There are 12 bp surrounding this cap site that are conserved in sequence and location in the human gene. The center of this region matches the 4 core nucleotides (CANT) of the mammalian Inr consensus sequence. This homology to both the mouse transcription start site and the Inr consensus suggests that the human EPO receptor gene initiates here as well. The human EPO receptor gene promoter region does not contain a consensus binding site for a CACCC box-binding factor, as is found in the promoter region of the murine gene (Youssoufian et al., 1990). The specific role of GATA-1 or Spl in the regulation of the expression of the EPO receptor gene remains to be determined. The cloning of the promoter region of the EPO receptor gene will allow the role of these factors to be examined and will also allow the identification of other transcription factors that play a role in regulating the expression of the EPO receptor gene.

PENNY

980

AND FORGET

ACKNOWLEDGMENTS We thank Dr. Vikram Pate1 for the MEL cDNA library, Dr. John Winkelmann for cDNA clone ER2 and for helpful discussions, and Dr. Lynn Cooley for her computer expertise. This work was supported in part by grants from the NIH.

16.

338: 17.

REFERENCES 1. BAZAN, J. F. (1989). A novel family of growth factor receptors. B&hem. Biophys. Res. Commun. 164: 788-795. 2. D’ANDREA, A. D., LODISH, H. F., AND WONG, G. G. (1989a). Expression cloning of the murine erythropoietin receptor. Cell 6’7: 277-285. 3. D’ANDREA, A. D., FASMAN, G. D., AND LODISH, H. F. (198913). Erythropoietin receptor and Interleukin-2 receptor B chain: A new receptor family. CeU 58: 1023-1024. 4. DEVE~UX, J., HAEBERLI, P., AND SMITHIES, 0. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387-395. 5. DEVEREUX, J. (1989). “The GCG Sequence Analysis Software Package, Version 6.0,” Genetics Computer Group, Inc., Madison, WI. 6. DYNAN, W. S., AND TJIAN, R. (1983). The promoter specific transcription factor Spl binds to upstream sequences in the SV40 early promoter. CeU 36: 79-87. 7. GEARING, D. P., KING, J. A., GOUGH, N. M., AND NICOLA, N. A. (1989). Expression cloning of a receptor for human granulocyte-macrophage colony-stimulating factor. EMBO

18. 19.

20.

21.

22. 23.

J. 8: 3667-3676.

GOODWIN, R. G., FRIEND, D., ZIEGLER, S. F., JERZY, R., FALK, B. A., GIMPEL, S., COSMAN, D., DOWER, S. K., MARCH, C. J., NAMEN, A. E., AND PARK, L. S. (1990). Cloning of the human and murine interleukin-7 receptors: Demonstration of a soluble form and homology to a new receptor superfamily. Cell 60: 941-951. 9. HATAKEYAMA, M., TSUDO, M., MINAMOTO, S., KONO, T., DOI, T., MNATA, T., MNASAKA, M., AND TANIGUCHI, T. (1989). Interleukin-2 receptor 6 chain gene: Generation of three receptor forms by cloned human 01and fl chain cDNA’s. Science 244: 551-556. 10. XTOH, N., YONEHARA, S., SCHREURS, J., GORMAN, D. M., MARUYAMA, K., ISHII, A., YAHARA, I., ARAI, K.-I., AND MNAJIMA, A. (1990). Cloning of an interleukin-3 receptor gene: A memher of a distinct receptor gene family. Science 247: 3248.

24.

25. 26.

27.

327.

11. JONES, S. S., D’ANDREX, A. D., HAINES, L. L., AND WONG, G. G. (1996). Human erythropoietin receptor: Cloning, expression and biological characterization. Blood 76: 31-35. 12. KURAMOCHI, S., IKAWA, Y., AND TODOKORO, K. (1990). Characterization of murine erythropoietin receptor genes. J. Mol. Biol. 216: 567-575. 13. LAWN, R. M., FRITSCH, E. F., PARKER, R. C., BLAKE, G., AND MANIATIS, T. (1978). The isolation and characterization of linked S- and @globin genes from a cloned library of human DNA. Cell 15: 1157-1174. 14. LUNDWALL, A., DACKOWSKI, W., COHEN, E., SHAFFER, M., MAHR, A., DAHLEIACK, B., STENFLO, J., AND WYDRO, R. (1986). Isolation and sequence of the cDNA for human protein S, a regulator of blood coagulation. Proc. Natl. Acad. Sci. USA 83: 6716-6720. 15. MANUTIS, T., FRITSCH, E. F., AND SAMBROOK, J. (1982).

“Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. MARTIN, D. I. K., TSAI, S.-F., AND ORKIN, S. H. (1989). Increased y-globin expression in a nondeletion HPFH mediated by an erythroid-specific DNA-binding factor. Nature

28.

29.

30.

435-438.

MOSLEY, B., BECKMANN, M. P., MARCH, C. J., ID-A, R. L., GIMPEL, S. D., VANDEN Bos, T., FRIEND, D., ALPERT, A., ANDERSON, D., JACKSON, J., WIGNALL, J. M., SMITH,C., GALLIS, B., SIMS, J. E., URDAL, D., WIDMER, M. B., COSMAN, D., AND PARK, L. S. (1989). The murine interleukin-4 receptor: Molecular cloning and characterization of secreted and membrane bound forms. Cell 59: 335-343. PROUDFOOT, N. (1991). Poly(A) signals. Cell 64: 671-674. SAIKI, R. K., GELFAND, D. H., STOFFEL, S., SCHARF, S. J., HIGUCHI, R., HORN, G. T., MULLIS, K. B., AND ERLICH, H. A. (1988). Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491. SANGER, F., NICKLEN, S., AND COULGON, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. SHIBUYA, H., YONEYAMA, M., NAKAMURA, Y., HARADA, H., HATAKEYAMA, M., MINAMOTO, S., KONO, T., DOI, T., WHITE, R., AND TANIGUCHI, T. (1990). The human interleukin-2 @chain gene: Genomic organization, promoter analysis and chromosomal assignment. Nucleic Acids Res. 18: 3697-3703. SMALE, S. T., AND BALTIMORE, D. (1989). The “initiator” as a transcription control element. Cell 57: 103-113. SMALE, S. T., SCHMIDT, M. C., BERK, A. J., AND BALTIMORE, D. (1990). Transcriptional activation by Spl as directed through TATA or initiator: Specific requirement for mammalian transcription factor IID. Proc. Natl. Acad. Sci. USA 87: 4509-4513. SURES, I., LOWRY, J., AND KEDES, L. (1978). The DNA sequence of sea urchin (S. purpuratus) H2A, H2B and H3 histone coding and spacer regions. Cell 15: 1033-1044. TRAINOR, C. D., EVANS, T., FELSENFELD, G., AND BOGUSKI, M. S. (1990). Nature 343: 92-96. TSAI, S.-F., MARTIN, D. I. K., ZON, L. I., D’ANDREA, A. D., WONG, G. G., AND ORKIN, S. H. (1989). Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 339: 446451. WIERINGA, B., HOFER, E., AND WEISSMANN, C. (1984). A minimal intron length but no specific internal sequence is required for splicing the large rabbit ,&globin intron. Cell 37: 915-925. WINKELMANN, J. C., PENNY, L. A., DEAVEN, L. L., FORGET, B. G., AND JENKINS, R. B. (1990). The gene for the human erythropoietin receptor: Analysis of the coding sequence and assignment to chromosome 19p. Blood 76: 24-30. YAMASAKI, K., TAGA, T., HIRATA, Y., YAWATA, H., KAWANISHI, Y., SEED, B., TANIGUCHI, T., HIRANO, T., AND KISHIMOTO, T. (1988). Cloning and expression of the human interleukin-6 (BSF-2/IRNa2) receptor. Science 241: 825-828. YOUSSOLJFIAN,H., ZON, L. I., ORKIN, S. H., D’ANDREA, A. D., AND LODLSH, H. F. (1990). Structure and transcription of the mouse erythropoietin receptor gene. Mol. Cell. BioL 10: 36753682.

31.

ZON, L. I., YOUSSOVFIAN, H., LODISH, H., AND ORKIN, S. H. (1990). Regulation of the erythropoietin receptor promoter by the cell-specific transcription factor GF-1. Blood SuppL I 76: 174a.