Arch Virol DOI 10.1007/s00705-013-1882-5

ORIGINAL ARTICLE

Genomic characterization and integrative properties of phiSMA6 and phiSMA7, two novel filamentous bacteriophages of Stenotrophomonas maltophilia Mayya Petrova • Natalya Shcherbatova Anton Kurakov • Sofia Mindlin

•

Received: 8 July 2013 / Accepted: 29 September 2013 Ó Springer-Verlag Wien 2013

Abstract Two novel filamentous phages, phiSMA6 and phiSMA7, were isolated from Stenotrophomonas maltophilia environmental strain Khak84. We identified and annotated 11 potential open reading frames in each phage. While the overall layout of the functional gene groups of both phages was similar to that of the known filamentous phages, they differed from them in their molecular structure. The genome of phiSMA6 is a mosaic that evolved by acquiring genes from at least three different filamentous S. maltophilia phages and one Xanthomonas campestris phage related to Cf1. In the phiSMA6 genome, a gene similar to the bacterial gene encoding the mating pair formation protein trbP was also found. We showed that phiSMA6 possesses lysogenic properties and upon induction produces high-titer lysates. The genome of phiSMA7 possesses a unique structure and was found to be closely related to a prophage present in the chromosome of the completely sequenced S. maltophilia clinical strain D457. We suggest that the other three filamentous phages of S. maltophilia described previously also have the capacity to integrate into the genome of their bacterial host.

Introduction In the past 50 years, extensive work has been done to isolate and study filamentous bacteriophages belonging to M. Petrova  N. Shcherbatova  A. Kurakov  S. Mindlin (&) Institute of Molecular Genetics, Russian Academy of Sciences, 2 Kurchatov sq., Moscow 123182, Russia e-mail: [email protected] A. Kurakov Department of Microbiology, Moscow State University, Moscow, Russia

the genus Inovirus of the family Inoviridae. At present, bacteriophages are found in many species of Gram-negative and Gram-positive bacteria, and despite their small size, play an important role in the variability and evolution of their bacterial hosts [1–11]. Many different aspects of interaction of bacteria and filamentous phages belonging to this group have been described. Some phages are known to increase the fitness of lysogens [12]. Others, such as phage Pf4, take part in the biofilm development of host bacteria [13, 14]. However, the greatest attention has been paid to a detailed examination of filamentous phages that play an important role in the emergence of human (e.g., Vibrio cholerae, Escherichia coli, Yersinia pestis), and plant (e.g., Xylella fastidiosa, Ralstonia solanacearum) pathogens [12, 14–19]. The best example of phages determining the toxigenic properties of host bacteria is the phage CTXu of V. cholerae, which carries in its genome specific genes encoding cholera toxin [4, 19, 20]. In addition, it should be noted that various approaches to the application of filamentous phages in molecular biology and bionanotechnology are now being intensively developed in many laboratories [21–24]. Against this background, only limited research has been devoted to filamentous phages of Stenotrophomonas maltophilia, although these bacteria are widespread in the environment, and in recent years, in the clinic, where they behave as opportunistic human pathogens, causing intrahospital infections in patients with weakened immunity [25–28]. To date, only one filamentous phage of S. maltophilia has been studied in detail [29], while two other putative filamentous phages were revealed only in a replicative form (RF) [HM150760; 30]. Almost nothing is known of the integrative properties of these phages and their role in lysogenic conversion.

123

M. Petrova et al.

In the present study, the molecular structure of two new filamentous phages, phiSMA6 and phiSMA7, isolated from an environmental strain of S. maltophilia, Khak84, is described and compared with that of previously isolated phages. It is shown that phages phiSMA6 and phiSMA7 possess integrative properties and that phage phiSMA6 contains an extra gene, related to a bacterial gene encoding the mating pair formation protein.

Table 1 List of S. maltophilia strains used and their characteristics Name of strain

Isolation site, source

Phage detected

Sensitivity to phage phiSMA6

MR7-1

Coast of East-Siberian Sea, permafrost

No

-

MR7-3

Coast of East-Siberian Sea, permafrost

No

-

ED5143-1

Khomus-Yuriakh coast, permafrost

No

-

Materials and methods

Khak-84

Lake Baikal region, Hakusi spring water

phiSMA6 phiSMA7

-

Bacterial strains and growth conditions

Khak-94

Lake Baikal region, Hakusi spring water

phiSMA6

-

Table 1 shows the origins of the 17 S. maltophilia strains included in this work. All strains were grown in Luria-Bertani (LB) broth and on LB agar plates at 30°C. Bacterial strains were preserved for long-term storage by freeze drying.

Bor-40

Yaroslavl region, pond Borok, water

phiSMA6 phiSMA7

-

Bor-50

Yaroslavl region, pond Borok, water

phiSMA6

-

TC50

Moscow region, rhizosphere

No

-

Phage isolation

TC79

Voronezh region, soil

No

?

TC118

Kiev region, soil

No

?

Overnight cultures of S. maltophilia were diluted 50-fold in fresh LB medium and grown in 5 ml of LB for 5-7 h with shaking (240 rpm) at 30 °C. One milliliter of each culture was filtered through a 0.22-lm-pore-size membrane filter. To confirm that the filtrates were free from bacterial cells, an aliquot (50 ll) of the filtered supernatant was plated on solid LB and incubated overnight at 30 °C. The presence of phage particles was determined using a spot test.

TC267

ND

No

-

TC270

Moscow region, soil

No

?

TC276

Moscow region, soil

No

-

TC292

Moscow region, soil

No

?

TC323

Moscow region, soil

No

?

TC407 TC457

Kiev region, rhizosphere ND

No No

? -

Phage induction

Determination of the number of phages in LB liquid medium

Overnight culture of S. maltophilia grown in LB (0.5 ml) was placed into fresh LB (5 ml) containing ciprofloxacin at concentrations ranging from 2 to 4 lg/ml and grown with shaking at 30 °C for 24-48 h. Crude phage suspension was prepared by centrifugation of the culture to remove the cells, passing the supernatant through a membrane filter (0.22-lm-pore-size) and checking it for sterility. The presence of phage particles was determined using a spot test. Spot test The spot test was conducted using a double-layer technique. The host culture (0.1 ml) was mixed with molten soft LB agar (4 ml, 0.5 %), which was then overlaid on the surface of the solidified basal LB agar (1.2 %). Phage suspension (10 ll) was spotted onto the plate, which was then incubated overnight at 30 °C. After incubation, the bacterial lawns were inspected for the appearance of inhibition halos. To determine the phage host ranges, drops of the viral suspension (10 ll) were placed onto lawns of each of the 17 Stenotrophomonas strains.

123

To calculate the number of phages, we measured the absorbance of phage DNA extracted from a crude suspension of phages. The number of phages released into liquid medium was determined from published values of the absorbance of phage DNA at 260 nm [31]. DNA sequencing and analysis of the genomic sequence The genomes of RFs of phiSMA6 and phiSMA7 were sequenced using a Roche 454 GS FLX pyrosequencing platform in the Evrogen Lab (Moscow, Russia). The sequences were assembled using CLC Genomics Workbench software (CLC Bio, Aarhus, Denmark). Open reading frames (ORFs) were searched using ORF Finder and BLAST software at NCBI. To determine ORFs of phiSMA7, the sequence of the S. maltophilia D457 genome was analyzed. The nucleotide sequences of phiSMA6 and phiSMA7 were compared to sequences in the GenBank databases, and a protein homology search was conducted using the NCBI BLAST server program.

Stenotrophomonas maltophilia phages phiSMA6 and phiSMA7

Nucleotide sequence accession numbers The nucleotide sequences of the phiSMA6 and phiSMA7 genomes have been registered in GenBank under accession numbers HG315669 and HG007973, respectively. DNA techniques General DNA techniques such as the isolation of total DNA, plasmid DNA, and phage ssDNA, treatment of DNA with nucleases (DNase, RNase, S1 nuclease), restriction analysis, and Southern hybridization were performed as described by Sambrook et al. [32]. Nuclease and restriction enzyme digestions of the phage DNA were conducted following the instructions provided by the enzyme supplier (Lithuania, Vilnius, Thermo Scientific). Screening of phiSMA6 and phiSMA7 in a collection of environmental S. maltophilia strains was performed using Southern blot analysis with radioactively labeled genes of zonula occludens toxins, corresponding to the zonula occludens toxin genes (zot) of both phages (positions 3806-4657 of HG315669 and 4951-5978 of HG007973). The presence of the phage genome in the chromosome of S. maltophilia strains was determined by comparative Southern blot analysis of total DNA and plasmid preparations from the native strains as described previously [4, 33].

Results Isolation of phages from S. maltophilia Khak84 During genetic studies of antibiotic-resistance determinants in environmental strains of S. maltophilia, we revealed an extrachromosomal genetic element in DNA preparations from strain Khak84. We assumed that this strain carries a circular double-stranded DNA plasmid and determined its complete sequence. In the sequence analysis we revealed two contigs with an approximate size of 7 kb, and based on preliminary studies of them, assumed that they correspond to genomes of two distinct filamentous phages that have not been described earlier. For verification of this assumption, we executed a series of experiments. First of all, we checked several strains from our S. maltophilia collection for sensitivity to assumed phages using a spot test. Among five originally checked strains, two (TC79 and TC118) exhibited inhibition halos on their lawns when a supernatant from strain Khak84 was spotted on the double-layer agar (Table 1). Thus, we confirmed the presence of phage

particles in culture fluids of Khak84 and in the further studies used strain TC79 as a test strain. In accordance with the two sequenced phage genomes, we defined the corresponding phages as phiSMA6 and phiSMA7. It should be noted that the quantity of phiSMA7 DNA contained in preparations of Khak84 was about 50 times less than that of phiSMA6 DNA. To determine sequence identity between the phiSMA6 phage genome and the RF of this phage, we extracted nucleic acid from crude Khak84 phage preparations and performed PCR experiments with DNA from both preparations using phage-specific primers. Thus, we showed that the virion DNA of phiSMA6 is a ssDNA. It was resistant to treatment with RNase and sensitive to S1 nuclease (data not shown). Genomic organization of phiSMA6 The nucleotide sequence of phiSMA6 consisted of 7648 bp and contained 11 ORFs, 10 of which were homologous to ORFs encoding peptides in other filamentous phages (Table 2). Similar to all of the previously characterized filamentous phages, phiSMA6 had a modular organization and included four modules: a replication module, a structural module, an assembly module, and a regulator module (Fig. 1). Within the replication module we identified two ORFs: ORF351 and ORF 92, similar to ORFs of filamentous phage phiSMA9 with putative functions in rolling-circle replication and ssDNA binding, respectively [29, 34]. Within the putative structural module of phiSMA6 we identified four ORFs: ORF67, ORF76, ORF630, and ORF103, whose positions are similar to those of genes encoding the capsid structural proteins of the known filamentous phages of S. maltophilia and other bacteria (Fig. 1). It should be noted that ORF76 was found entirely embedded out of frame within the 50 region of ORF630. We identified the product of this gene as a major coat protein by homology to that of other filamentous phages. For instance, identical amino acids (71 %) were found in the C-terminal ends of the ORF76 protein of the phage phiSMA6 and the major coat protein of the X. oryzae phage Xf. It is important to mention that the C-terminal end of the phage Xf protein has been shown to be a functionally important region [35]. Thus, it is possible to assume that the remaining three ORFs, ORF67, ORF630, and ORF103, encode the minor coat proteins of phiSMA6. In confirmation of this suggestion, sequences with a high level of a homology to the phiSMA6 structural genes ORF67 and ORF630 were found in the X. campestris genome as a part of the assumed prophage related to Cf1 (Table 2). At the same time, unlike

123

M. Petrova et al. Table 2 Genomic organization of phage phiSMA6 ORF (start position-stop position)

Product length, aa

Putative product function

Strain with closest nt hit

nt (aa) identity, %

AC

ORF351 (1-1056)

351

Phage replication protein RstA

S. maltophilia phage phiSMA9

93.0*

AM040673

Single–stranded DNA binding protein

S. maltophilia phage phiSMA9

87

AM040673

ORF92 (1038-1316)

92

ORF67 (1320-1523)

67

Minor Coat protein

X. campestris ps.vesicatoria Cf1-related phage

84

AM039952

ORF76 (1532-1762)

76

Major Coat protein

X. campestris ps.vesicatoria Cf1-related phage

75

AM039952

ORF630 (1435-3327)

630

Minor Coat protein

S. maltophilia phage phiSHP1;

75*

EF489910

X. campestris ps.vesicatoria Cf1-related phage

71

AM039952

ORF103 (3330-3641)

103

Minor Coat protein

X. campestris ps.vesicatoria Cf1-related phage

(37-40)

AM039952

ORF400 (3643-4845)

400

Zot-related protein

X. campestris ps.vesicatoria Cf1-related phage

73*

AM039952

ORF192 (4890-5468)

192

Conjugal transfer protein TrbP

X. campestris ps.vesicatoria

74*

AM039952

ORF112 (6369-6031)

112

Repressor

S. maltophilia phage phiSHP1 phiSHP2

EF489910 HM150760

EF489910 HM150760

ORF148 (6818-6372)

148

Repressor

Burkholderia pseudomallei; S. maltophilia phage phiSHP2

96

AF283839

75*

HM150760

Burkholderia pseudomallei; S. maltophilia phage phiSHP2

81*

AF283839

89*

HM150760

ORF86 (6952-7212)

86

Hypotetical protein

* partial homology (not for the entire length) Fig. 1 Genomic organization of S. maltophilia filamentous phages. Linear ORF maps are aligned by using the first base of the replication initiation gene (rstA). The location and polarity of genes and ORFs are shown by open arrows; lengths of products of ORFs are indicated in amino acids. Intergenic regions are indicated by straight lines

other filamentous phages, phiSMA6 contained four, instead of five, structural genes, one of which, ORF630, was characterized by its unusually large size. The putative assembly module contained one gene, ORF400, encoding a product that was very similar to an unidentified protein of a filamentous phage related to Cf1 of X. campestris pv vesicatoria (81 % identity over 238 residues). A high level of identity (66 %-74 % identity over 97 and 82 residues, respectively) was also revealed

123

between products of ORF400 and the zot gene of Xylella fastidiosa (GQ429146). However, it should be noted that the protein product of ORF400 is not homologous to the virulence factor (Zot) encoded by the filamentous phage CTXphi of V. cholerae; the latter has a dual function and, in addition to its involvement in phage morphogenesis, has enterotoxic activity because of the properties of the C-terminal part of the Zot protein [36]. Because the whole C-terminal part of Zot from phiSMA6 is divergent from

Stenotrophomonas maltophilia phages phiSMA6 and phiSMA7

Vibrio Zot, the toxic potential of S. maltophilia Zot protein seems to be in question. In the regulator module, we identified ORF112 and ORF148 transcribed in the direction opposite to the direction of transcription of most of the ORFs of phiSMA6 (Fig. 1). ORF112 has a high level of identity to a putative regulator gene of previously described filamentous phage of S. maltophilia, phiSHP2 (HM150760), while ORF148 was shown to be closely related to the gene of a putative repressor of Burkholderia pseudomallei phage (Table 2). It is essential also to specify that the sizes and positions of ORF112 and ORF148 are similar to those of genes encoding the repressors of filamentous phage VGJphi of V. cholerae (Fig. 1). The two additional ORFs, ORF86 and ORF192, could not be included in any of the four modules described above. ORF86 has partial homology to the unannotated ORFs of S. maltophilia phages phiSHP2 (not identified ORF) and phiSMA7 (ORF76) and to a fragment of the prophage present in the genome of S. maltophilia D457 (see below). In addition, the size and position of ORF86 is similar to those of ORF104 in the VGJphi genome (Fig. 1). Like ORF104, the product of ORF86 and related genes did not show homology to any known peptide. As for ORF192, its product was homologous to the S. maltophilia conjugal transfer protein trbP and to the putative F pilin acetylation protein of X. campestris. Because the gene ORF192 has no analogs in the genomes of other filamentous phages and at the same time is partially homologous to a bacterial gene, we believe that this gene can be carried to the so-called ‘‘moron’’ genes that are present in the genome of some phages as ‘‘alien’’ (extra) genes [16]. Genomic organization of phiSMA7 The phage genome comprises 7069 bp containing 11 open reading frames, only one of which encodes a protein product homologous to that of phiSMA6. To investigate the origin of phiSMA7 and to identify related elements, we performed a search for homologous sequences in public databases. Unexpectedly, we found a closely related element in a recently submitted sequence of the whole genome of a clinical strain of S. maltophilia D457 (HE978556). We suggested that this element is actually a prophage and compared its genetic structure with that of phiSMA7 in detail. As a result, we determined that the size, molecular structure, number, and position of genes are very similar in both elements (Table 3). Both elements contained 11 open reading frames. The identity level of different genes varied from 78 % to 97 %. The highest identity at the nucleotide sequence level ([90 %) was found for genes encoding a phage replication protein, a Zot-like protein, and one of the putative capsid proteins. It

is noteworthy that highly homologous sequences for the two last-mentioned genes of phiSMA7 were detected only in the genome of D457. Highly homologous sequences for the replication and regulator genes of phiSMA7 were also found in the genome of the previously described S. maltophilia putative phage phiSHP2 [HM150760]. The only exceptional DNA regions of phiSMA7 having no visible homology to the genetic element found in the D457 genome were two rather short intervals between ORF76 and ORF368 and between the zot gene and ORF113, respectively (Table 3). Comparative analysis of S. maltophilia filamentous phage genomes We collected and generalized all available data on filamentous phages of stenotrophomonads, having included our data on phiSMA6 and phiSMA7 as well as data regarding the phiSHP2 map from GenBank (HM150760). Additionally, we showed complementation of the genome of phiSMA9 [30] by additional ORFs found within its sequence. For comparison we chose the filamentous phage VGJu of V. cholerae, which has a similar structure to S. maltophilia phages. We discovered that the genomes of all phages are constructed using a unified plan: all of them had a modular organization that included four modules (Fig. 1). A comparison of linear maps of all S. maltophilia phages makes it clear that the sizes and the positions of most of their ORFs are very similar. At the same time, their nucleotide sequences differ considerably from each other. The best example of sequence divergence of phage genomes are phiSMA6 and phiSMA7, which each possess only one ORF (ORF112 and ORF113, respectively) having a high identity level. Analysis of the genomes of most S. maltophilia phages reveals that they can be regarded as genetic mosaics. The mosaic structure is especially distinctly expressed in phage phiSMA6. Actually, genes encoding phage replication protein RstA and single-stranded DNA binding protein have a high level of similarity to those of a phage of S. maltophilia, phiSMA9; the gene ORF67, a part of ORF630, and a gene encoding a Zot protein possibly came from another phage related to the Cf1 phage of X. campestris, while genes encoding putative repressors and the neighboring gene ORF86 were found to be most similar to the corresponding genes of phage phiSHP2 (Fig. 2). Thus, it is possible to assume that the phiSMA6 genome resulted from a recombination between genomes of various filamentous phages. However, we did not manage to find complete counterparts in genomes of other known filamentous phages for any of the ORFs of phiSMA6. In particular, we could not

123

M. Petrova et al. Table 3 The comparative genetic structure of phiSMA7 and putative prophage found in strain D457 of S. maltophilia ORF

Putative function of the gene product

phiSMA7 position (size, bp)

D457 prophage position (size, bp)

attP (phiSMA7) attL (D457) ORF150 (part) Unidentified region ORF76 Unidentified region ORF368 ORF99

Regulator 1

1-14 (14) 1-383 (383) 384-524 (140) 525-755 (231) 756-1055 (300) 1056-2162 (1107) 2167-2466 (300)

2419745-2419759 2419745-2420012 2420129-2420260 2420261-2420482 2420483-2420650 2420651-2421757 2421764-2422066

(14) (267) (131) (222)* (174) (1107) (303)

100 87 78 85 No significant homology 93 79

2470-2727 (258) 2959-3096 (138) 3106-3375 (270) 3561-4478 (918) 4492-4890 (399) 4895-6187 (1293) 6206-6649 (444) 6674-7015 (342) complement 7000-7069 (70) -

2422070-2422327 2422560-2422697 2422707-2422976 2423344-2424058 2424072-2424470 2424475-2425767 2425776-2426201 2426226-2426594 2426579-2426648 2426649-2426668

(258) (138) (270) (715) (399) (1293) (426) (369) (70) (20)

97 85 83 80 92 94 No significant homology 76 91 -

ORF85 ORF45 ORF89 ORF305 ORF32 ORF430 Unidentified region ORF113 ORF150 (part) attR (D457)

Unidentified Replication initiation factor Single-stranded DNA binding protein Capsid protein Capsid protein Capsid protein Capsid protein Capsid protein Zot-like protein Regulator 2 Regulator 1 -

Identity at the nucleotide sequence level, %

Genes of both elements having the same size are indicated in bold * Homologous sequences were found also in the corresponding gene of S. maltophilia phage phiSHP1 (87 % identity)  homologous sequences were found also in the corresponding genes of S. maltophilia phage phiSHP2 (75-93 % identity)

Distribution of phiSMA6- and phiSMA7- related phages in environmental bacteria

Fig. 2 Mosaic structure of phiSMA6. Different shading denotes sequences of different types. The location and polarity of the genes are shown by arrows

find homologous sequences for ORF103 and for parts of ORF630 and the zot and trbP genes (Fig. 2). Apparently, these genes originate from some filamentous phage of S. maltophilia, which has not yet been discovered. It is also interesting to note that in the X. campestris genome, we found a zot-like gene of a Cf1-related phage, a gene encoding a product similar to the conjugal transfer protein TrbP. A similar situation is observed in phiSMA6 phage, where the gene trbP (ORF192) is located adjacent to zot (Fig. 2). It is possible to assume, therefore, that the gene trbP moved from a bacterial genome to a phage genome as a result of recombination between the phage (or prophage) genome and the bacterial chromosome.

123

The collection of 17 S. maltophilia strains was tested for two parameters: (i) presence of filamentous phages related to phiSMA6 and phiSMA7 and (ii) sensitivity to these phages. For phage isolation, the method of phage induction with ciprofloxacin was used; sensitivity to phages was determined using a spot test (Materials and methods). As shown in the experiments, the studied strains differed among themselves on both criteria (Table 1). Among them were both sensitive and resistant strains, and also strains that formed a functionally active phage after induction. It should be noted that phage preparations originating from strains Khak94, Bor40, and Bor50 had the same host range as phiSMA6 originating from Khak84 (Table 1). For identification of the three newly isolated phages, RF DNA from the corresponding strains of bacteria was isolated and a restriction analysis was conducted using PstI and SmaI. It appeared that genomes of these three phages do not differ from phage phiSMA6 by the number and the size of fragments. Therefore it can be concluded that phages from strains Khak94, Bor40, and Bor50 are closely related to a phage phiSMA6. This conclusion was confirmed in experiments using Southern blot hybridization (see below).

Stenotrophomonas maltophilia phages phiSMA6 and phiSMA7

Because the quantity of phiSMA7 DNA in plasmid preparations is very low, the blot hybridization experiments were conducted using probes specific for phiSMA6 and phiSMA7 zot genes. Positive results with phiSMA7 probe were obtained for strains Bor40 and Khak84 (Fig. 3). Thus, phages phiSMA6 and phiSMA7 were both present simultaneously in these strains, while strains Khak94 and Bor50 contained only one bacteriophage, phiSMA6. Number of phage particles released into LB liquid medium All of the sensitive S. maltophilia strains that were found were subjected to a plaque assay with phiSMA6, but we could not observe any distinct plaques on bacterial lawns. However, we calculated the number of phage particles released into LB medium based on the absorbance of DNA to be about 2.0 9 104 phages/ml, produced usually during the exponential phase of bacterial growth. Upon induction with ciprofloxacin, the number of phages increased by 3-4 orders of magnitude and reached 107-108 phages/ml. Studies of the lysogenic properties of S. maltophilia filamentous phages Based on similarity in the organization of phages phiSMA6 and phiSMA7, and also on detection of a prophage closely related to phiSMA7 in an S. maltophilia chromosome, we assumed that phages phiSMA6 and phiSMA7 both possess the ability to integrate into the genome of S. maltophilia strains. To test this assumption, we conducted a comparative Southern blot analysis of total DNA and plasmid preparations (RF) from strain Khak84 of S. maltophilia and three additional S. maltophilia native strains that produced phage particles (Khak94, Bor40, and Bor50). Total DNA of strains Khak84, Khak94, Bor40, and Bor50 analyzed by Southern blotting with a phiSMA6-specific probe produced additional bands in comparison with plasmid DNA bands (Fig. 4a and b). Therefore, we suggest that native strains of S. maltophilia Khak84, Khak94, Bor40, and Bor50 contain both replicating and integrated phage DNA. Thus, it is possible to conclude the existence of a very high level of similarity of the corresponding phages. To obtain additional proof in favor of the integrative properties of phages isolated in our work, a search of sequences characteristic for att sites in DNA of phages and dif-like sequences in the chromosome of S. maltophilia strains necessary for the integration of phage DNA was performed [37–39]. First, we tried to identify a dif site, which is inherent in S. maltophilia. For this purpose we conducted a search of sequences similar to those of dif sites of other bacteria in completely sequenced genomes of four strains of S. maltophilia. As a result of this analysis we

Fig. 3 Identification of phiSMA6-like and phiSMA7-like phages in different S. maltophilia strains. zot genes of phiSMA6 a and phiSMA7 b were used as specific probes in Southern blot analysis of total DNA from the strains; lanes: 1, Khak84: 2, Khak94; 3, Bor50; 4, Bor40

defined the sequence of the S. maltophilia dif site and found it to be closely similar to that of X. campestris (Fig. 5). Subsequently, we analyzed DNA sequences of the D457 strain flanking the genome of a putative phiSMA7like prophage and compared them with corresponding DNA sequences of phiSMA7. It appeared that by contrast with phiSMA7, the regulator gene ORF148 of D457 prophage is divided into two parts that are present at opposite ends of the prophage (Table 3; Fig. 4a). The disruption of the regulator gene results from the location of an attP site in this gene and was described earlier in the section regarding DNA integration of other filamentous phages [4, 37]. In addition, we revealed on both ends of the putative prophage residing in the D457 genome a sequence similar to the attP sites of different filamentous phages (Table 4). Moreover, the sequence on the right prophage flank was identical to the dif-like sequence of S. maltophilia strains (excepting the first four nucleotide pairs) (Table 4). It should be noted that the entire dif-like sequence we revealed in the genome of the S. maltophilia strain R551-3 (CP001111), does not contain a prophage (Table 4). All these data support the conclusion that a phiSMA7-related phage has integrated into the dif site of the S. maltophilia D457 genome through the attP site. It seems very probable that phage phiSMA7, as a close relative of the prophage found in the chromosome of D457, also has the potential to integrate into the genome of S. maltophilia strains. It should be mentioned that we also found att-like sequences in the genome of phiSMA6 and in the DNA of three phages of S. maltophilia described previously. In all of these cases, they were located in the corresponding regulator genes near their ends (Table 4). In this regard, it cannot be

123

M. Petrova et al.

Fig. 5 Comparative structure of dif sites of different bacteria. Identical nucleotides in all species are shown by bold capital letters; identical nucleotides in S. maltophilia and X. campestris are underlined

Fig. 4 Integration of filamentous phages by site-specific recombination. a. Recombination between phage RF and the bacterial chromosome (schematic representation; not to scale). The replicative form (RF) of the phage is shown at the top, the bacterial chromosome in the middle, and the lysogen below. Recombinant att sites (attL and attR) and parts of a disrupted regulator gene (‘R and R’) are represented on the prophage flanks. Restriction sites for SmaI are shown by small arrows; the DNA fragment used as probe in Southern hybridization is shown by a thick line. b. Southern blot analysis of SmaI digested plasmid (lanes 1, 3, 5, 7) and total (lanes 2, 4, 6, 8) DNA from S. maltophilia strains Khak84 (1, 2), Khak94 (3, 4), Bor40 (5, 6), Bor50 (7,8); sizes of fragments are shown on the right

excluded that all known S. maltophilia phages possess the ability to integrate into a bacterial chromosome.

Discussion The bacteriophages phiSMA6 and phiSMA7, studied in this work, are similar in their general genomic organization to the previously described filamentous S. maltophilia phages. However, in the detailed analysis of their genetic structure it becomes obvious that both of these phages differ considerably from the known phages of S. maltophilia. The genomic sequence of phiSMA6 reveals a highly mosaic structure. Its ORFs have their counterparts in genomes of at least four other filamentous phages: phiSHP1, phiSHP2, and phiSMA9 of S. maltophilia and a filamentous phage related to phage Cf1, which was found in the chromosome of X. campestris ps. vesicatoria (AM039952)

123

(Fig. 2). It was also shown that one of the phiSMA6 putative structural genes, ORF630, encoding a minor coat protein, is extremely large and itself can be regarded as a mosaic (see Fig. 2). The 50 end of this gene had a high level of identity to a structural gene of a prophage existing in the X. campestris ps. vesicatoria chromosome, while its 30 end was homologous to the corresponding structural gene of S. maltophilia phage phiSHP1. We also found that ORF630 itself contains a gene, ORF76, encoding a major coat protein. Thus, the coding sequence of ORF76 was fully embedded into the 50 part of ORF630 in a different reading frame. It should be noted that while overlapping genes in bacterial genomes are rare, they occur more frequently in genomes of phages. In particular, fully overlapping genes transcribed in different reading frames were revealed in the Staphylococcus aureus bacteriophage 187 [40]. Investigators described an unusual lysis system for this virus, which is comprised of a very small putative holin (Hol187), whose coding sequence was fully embedded into the genetic module containing the enzymatically active domain of the large endolysin gene ply187. It is interesting that in both cases, the phenomenon of overlapping genes transcribed in different frames were an exception to the general rule: in all other related phages, two corresponding genes were separated from each other and embedded in the genome in a row with each other [4, 29, 30, 40, 41]. Unlike other filamentous phages of S. maltophilia, phiSMA6 contains in its genome an extra gene, possibly a moron gene related to the bacterial gene trbP encoding a mating pair formation protein. Thus, the genome of phiSMA6 represents a complex of genes coming from various sources. Most likely, the formation of the mosaic genetic structure of phage phiSMA6 occurred with the participation of an extensive horizontal transfer of genetic material and different recombination events between genomes of various phages. For instance, the high level of identity with phiSHP2 of ORF112 and ORF148 becomes apparent at 82 bp after the end of ORF112. It should be noted that for the formation of a recombinant phage such as phiSMA6, a simultaneous presence in bacterial cells of at least of two various filamentous phages

Stenotrophomonas maltophilia phages phiSMA6 and phiSMA7 Table 4 Comparative sequences of the S. maltophilia dif-like site and putative attP sites located in regulator genes of different filamentous phages of S. maltophilia Phage

Putative gene regulator

Position of attP in relation to the 30 end of the gene

Sequence

phiSHP2

ORF150

70-84

AACATAATATACATA

HM150760

phiSMA6

ORF148

69-88

AACATAATATACAGAATGCG

HG315669

phiSMA7 phiSMA9

ORF150 ORF1

70-84 114-131

AACATAATATACATA ATATACATTATGCGAAAT

HG007973 AM040673

phiSHP1

ORF10

90-106

TATACATTATGCGAAAT

EF489910

phiSMA7-like prophage

attL attR

2419746-2419760 2426649-2426672

AACATAATATACATA AACATAATATACATTATGCGAAAT

HE79855

is necessary and that this situation should be repeated several times. The phage phiSMA7 differed even more from other described filamentous phages of S. maltophilia than did phiSMA6 (among themselves, phages phiSMA6 and phiSMA7 also differ very strongly). At the same time, an almost identical copy of the phiSMA7 genome was discovered in the completely sequenced genome of the clinical strain D457 of S. maltophilia. This genetic element had the same size and the same genetic organization as phage phiSMA7. The level of identity of the corresponding ORFs reached 97 %. We assume that the phage phiSMA7 and a putative prophage are closely related genetic elements having a common origin. It is interesting that while phiSMA7 was found in the environmental S. maltophilia strain, its close relative was found in clinical strain D457. One of the filamentous phages described previously, phiSMA9, was also isolated from clinical S. maltophilia strain c5 [30]; another such phage is phiSHP1, from the P2 environmental strain of S. maltophilia [29]. On the basis of these results, it is possible to conclude that filamentous phages are spread among environmental as well as clinical strains of S. maltophilia. At the same time, it is obvious that only a few of them have been identified and described so far. Most lysogenic filamentous phages are characterized by their ability to integrate into the bacterial genome with the help of a site-specific recombination system mediated by two tyrosine recombinases, XerC and XerD [38]. In accordance with this model, integration occurs by recombination between the attP site of the phage and the attB sequence inside the dif site of the host chromosome [4, 38]. As a result of our analysis, we determined the sequence of the host attachment site (attB) for S. maltophilia and concluded that it is most similar (24/28 bp) to the attB site of X. campestris [42]. In the genomes of all described phages of S. maltophilia, we identified sequences closely related to the attB site of the S. maltophilia chromosome. All of them

AC

were located within a gene regulator near its 50 end, as has been described for attP sites of other filamentous phages [4]. The DNA nucleotide sequences of attP of various phages contained at least 15 nucleotides in common with the corresponding sequences of attB; at the same time, the borders of these sequences differed in the different phages (Table 4). In the analysis of the genome of Stenotrophomonas maltophilia strain D457, we also obtained data supporting the subdivision of a gene regulator containing an attP site into two parts located on the flanks of the prophage, in accordance with a classical scheme (Table 3). In addition, in Southern blot analysis (this work), we demonstrated the presence of genomes of phiSMA6 and its close relatives in the bacterial host chromosome (Fig. 3b). Thus, we conclude that phiSMA6 and phiSMA7 phages are characterized by the ability to form stable lysogens. It is also possible to draw a preliminary conclusion that all known filamentous phages of S. maltophilia possess such properties. Interestingly, on checking the collection of environmental strains of S. maltophilia, we found phiSMA6-like phages only in strains isolated from aquatic sources. These sources were the hot spring at Hakusa and the pond at Borok, which are a considerable distance from each other. We did not find similar phages in bacteria isolated from soil samples, nor in strains isolated from permafrost. It is necessary to continue this research to define whether the presence of a prophage in the S. maltophilia genome can confer adaptive qualities and increase their fitness to changed environmental conditions. Acknowlegements We are grateful to I.A. Khmel (Institute of Molecular Genetics RAN, Laboratory of Regulation of Expression of Genes of Microorganisms) for kindly providing the 10 strains of Stenotrophomonas maltophilia. We also thank N.A. Khachikian for expert technical assistance. This work was partially supported by state contract #8129 from the Ministry of Education and Science of the Russian Federation and by the Russian Academy of Sciences Presidium Program ‘‘Molecular and Cellular Biology’’ (grant to A. Kulbachinsky).

123

M. Petrova et al.

References 1. Marvin DA, Hohn B (1969) Filamentous bacterial viruses. Bacteriol Rev 33(2):172–209 2. Tseng YH, Lo MC, Lin KC, Pan CC, Chang RY (1990) Characterization of filamentous bacteriophage phi Lf from Xanthomonas campestris pv. campestris. J Gen Virol 71:1881–1884 3. Lin NT, You BY, Huang CY, Kuo CW, Wen FS, Yang JS, Tseng YH (1994) Characterization of two novel filamentous phages of Xanthomonas. J Gen Virol 75(Pt 9):2543–2547 4. Campos J, Martınez E, Suzarte E, Rodrıguez BL, Marrero K, Silva Y, Ledo0 n T, del Sol R, Fando R (2003) VGJU, a novel filamentous phage of Vibrio cholerae, integrates into the same chromosomal site as CTXU. J Bacteriol 185:5685–5696 5. Campos J, Martı´nez E, Izquierdo Y, Fando R (2010) VEJ{phi}, a novel filamentous phage of Vibrio cholerae able to transduce the cholera toxin genes. Microbiology 156:108–115 6. Chopin MC, Rouault A, Ehrlich SD, Gautier M (2002) Filamentous phage active on the gram-positive bacterium Propionibacterium freudenreichii. J Bacteriol 184:2030–2033 7. Overman SA, Bondre P, Maiti NC, Thomas GJ Jr (2005) Structural characterization of the filamentous bacteriophage PH75 from Thermus thermophilus by Raman and UV-resonance Raman spectroscopy. Biochemistry 44:3091–3100 8. Piekarowicz A, Majchrzak M, Kłyz A, Adamczyk-Popławska M (2006) Analysis of the filamentous bacteriophage genomes integrated into Neisseria gonorrhoeae FA1090 chromosome. Pol J Microbiol 55:251–260 9. Kawasaki T, Nagata S, Fujiwara A, Satsuma H, Fujie M, Usami S, Yamada T (2007) Genomic characterization of the filamentous integrative bacteriophages {phi}RSS1 and {phi}RSM1, which infect Ralstonia solanacearum. J Bacteriol 189:5792–5802 10. Wang F, Wang F, Li Q, Xiao X (2007) A novel filamentous phage from the deep-sea bacterium Shewanella piezotolerans WP3 is induced at low temperature. J Bacteriol 189:7151–7153 11. Rice SA, Tan CH, Mikkelsen PJ, Kung V, Woo J, Tay M, Hauser A, McDougald D, Webb JS, Kjelleberg S (2009) The biofilm life cycle and virulence of Pseudomonas aeruginosa are dependent on a filamentous prophage. ISME J 3:271–282 12. Addy HS, Askora A, Kawasaki T, Fujie M, Yamada T (2012) The filamentous phage /RSS1 enhances virulence of phytopathogenic Ralstonia solanacearum on tomato. Phytopathology 102:244–251 13. Webb JS, Lau M, Kjelleberg S (2004) Bacteriophage and phenotypic variation in Pseudomonas aeruginosa biofilm development. J Bacteriol 186:8066–8073 14. Simpson AJ, Reinach FC, Arruda P, Abreu FA, Acencio M, Alvarenga R, Alves LM, Araya JE, Baia GS, Baptista CS, Barros MH, Bonaccorsi ED et al (2000) The genome sequence of the plant pathogen Xylella fastidiosa. The Xylella fastidiosa consortium of the organization for nucleotide sequencing and analysis. Nature 406:151–157 15. Gonzalez MD, Lichtensteiger CA, Caughlan R, Vimr ER (2002) Conserved filamentous prophage in Escherichia coli O18:K1:H7 and Yersinia pestis biovar orientalis. J Bacteriol 184:6050–6055 16. Bru¨ssow H, Canchaya C, Hardt WD (2004) Phages and the evolution of bacterial pathogens from genomic rearrangements to lysogenic conversion. Microbiol Mol Biol Rev 68:560–602 17. Derbise A, Chenal-Francisque V, Pouillot F, Fayolle C, Pre´vost MC, Me´digue C, Hinnebusch BJ, Carniel E (2007) A horizontally acquired filamentous phage contributes to the pathogenicity of the plague bacillus. Mol Microbiol 63:1145–1157 18. Chouikha I, Charrier L, Filali S, Derbise A, Carniel E (2010) Insights into the infective properties of YpfU, the Yersinia pestis filamentous phage. Virology 407:43–52

123

19. Faruque SM, Mekalanos JJ (2012) Phage-bacterial interaction in the evolution of toxigenic Vibrio cholerae. Virulence 3:556–565 20. Waldor MK, Mekalanos JJ (1996) Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 272(5270): 1910–1914 21. Kehoe JW, Kay BK (2005) Filamentous phage display in the new millennium. Chem Rev 105:4056–4072 22. Hemminga MA, Vos WL, Nazarov PV, Koehorst RB, Wolfs CJ, Spruijt RB, Stopar D (2010) Viruses: incredible nanomachines. New advances with filamentous phages. Eur Biophys J 39:541–550 23. Pande J, Szewczyk MM, Grover AK (2010) Phage display: concept, innovations, applications and future. Biotechnol Adv 28:849–858 24. Rakonjac J, Bennett NJ, Spagnuolo J, Gagic D, Russel M (2011) Filamentous bacteriophage biology, phage display and nanotechnology applications. Curr Issues Mol Biol 13:51–76 25. Muder RR, Harris AP, Muller S, Edmond M, Chow JW, Papadakis K, Wagener MW, Bodey GP, Steckelberg JM (1996) Bacteremia due to Stenotrophomonas (Xanthomonas) maltophilia: a prospective, multicenter study of 91 episodes. Clin Infect Dis 22(3):508–512 26. Denton M, Todd NJ, Kerr KG, Hawkey PM, Littlewood JM (1998) Molecular epidemiology of Stenotrophomonas maltophilia isolated from clinical specimens from patients with cystic fibrosis and associated environmental samples. J Clin Microbiol 36:1953–1958 27. Hauben L, Vauterin L, Moore ER, Hoste B, Swings J (1999) Genomic diversity of the genus Stenotrophomonas. Int J Syst Bacteriol 49:1749–1760 28. Crossman LC, Gould VC, Dow JM, Vernikos GS, Okazaki A, Sebaihia M, Saunders D, Arrowsmith C, Carver T, Peters N, Adlem E, Kerhornou A, Lord A, Murphy L, Seeger K, Squares R, Rutter S, Quail MA, Rajandream MA, Harris D, Churcher C, Bentley SD, Parkhill J, Thomson NR, Avison MB (2008) The complete genome, comparative and functional analysis of Stenotrophomonas maltophilia reveals an organism heavily shielded by drug resistance determinants. Genome Biol 9:R74 29. Liu J, Liu Q, Shen P, Huang YP (2012) Isolation and characterization of a novel filamentous phage from Stenotrophomonas maltophilia. Arch Virol 157:1643–1650 30. Hagemann M, Hasse D, Berg G (2006) Detection of a phage genome carrying a zonula occludens like toxin gene (zot) in clinical isolates of Stenotrophomonas maltophilia. Arch Microbiol 185:449–458 31. Karaolis DK, Somara S, Maneval DR Jr, Johnson JA, Kaper JB (1999) A bacteriophage encoding a pathogenicity island, a typeIV pilus and a phage receptor in cholera bacteria. Nature 399(6734):375–379 32. Sambrook J, Russel DW (2001) Molecular Cloning: A Laboratory Manual, Volume 1, 2, 3. Cold Spring Harbour, Cold Spring Harbour Laboratory Press, New York 33. Faruque SM, Asadulghani, Kamruzzaman M, Nandi RK, Ghosh AN, Nair GB, Mekalanos JJ, Sack DA (2002) RS1 element of Vibrio cholerae can propagate horizontally as a filamentous phage exploiting the morphogenesis genes of CTXphi. Infect Immun 70(1):163–170 34. Marvin DA (1998) Filamentous phage structure, infection and assembly. Curr Opin Struct Biol 8:150–158 Review 35. Frangione B, Nakashima Y, Konigsberg W, Wiseman RL (1978) The amino acid sequence of the major coat protein subunit of the filamentous virus Xf. FEBS Letters 96:381–384 36. Di Pierro M, Lu R, Uzzau S, Wang W, Margaretten K, Pazzani C, Maimone F, Fasano A (2001) Zonula occludens toxin structurefunction analysis. Identification of the fragment biologically active on tight junctions and of the zonulin receptor binding domain. J. Biol. Chem 276:19160–19165

Stenotrophomonas maltophilia phages phiSMA6 and phiSMA7 37. Iida T, Makino K, Nasu H, Yokoyama K, Tagomori K, Hattori A, Okuno T, Shinagawa H, Honda T (2002) Filamentous bacteriophages of vibrios are integrated into the dif-like site of the host chromosome. J Bacteriol 184:4933–4935 38. Huber KE, Waldor MK (2002) Filamentous phage integration requires the host recombinases XerC and XerD. Nature 417: 656–659 39. Askora A, Abdel-Haliem ME, Yamada T (2012) Site-specific recombination systems in filamentous phages. Mol Genet Genomics. 287:525–530

40. Loessner MJ, Gaeng S, Scherer S (1999) Evidence for a holinlike protein gene fully embedded out of frame in the endolysin gene of Staphylococcus aureus bacteriophage 187. J Bacteriol 181:4452–4460 41. Rasched I, Oberer E (1986) Ff coliphages: Structural and functional relationships. Microbiol. Rev 50:401–427 42. Yen MR, Lin NT, Hung CH, Choy KT, Weng SF, Tseng YH (2002) oriC region and replication termination site, dif, of the Xanthomonas campestris pv. campestris 17 chromosome. Appl Environ Microbiol 68:2924–2933

123