Veterinary Microbiology 168 (2014) 261–271

Contents lists available at ScienceDirect

Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic

Genomic characteristics of a novel reovirus from Muscovy duckling in China Tao Yun, Bin Yu, Zheng Ni, Weicheng Ye, Liu Chen, Jionggang Hua, Cun Zhang * Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China

A R T I C L E I N F O

A B S T R A C T

Article history: Received 4 July 2013 Received in revised form 23 October 2013 Accepted 4 November 2013

A new reovirus was isolated from a sick Muscovy duckling with hemorrhagic-necrotic lesions in the liver in Zhejiang, China in 2000 and was tentatively denoted a new type of Muscovy duck reovirus (N-MDRV ZJ00M). This reovirus was propagated in a chicken fibroblast cell line (DF-1) with obvious cytopathic effects. The reovirus’s genome was 23,419 bp in length with an approximately 50% G+C content and 10 dsRNA segments encoding 12 proteins. The length of the genomic segments was similar to those of avian reoviruses (ARVs), which range from 3959 nt (L1) to 1191 nt (S4) in size. All of the segments have the conserved terminal sequences 50 -GCUUUUU. . .UUCAUC-30 , and all of the genome segments, with the exception of S1, apparently encoded one single primary translation product. The genome analysis revealed that the S1 segment of N-MDRV is a tricistronic gene that encodes the overlapping ORFs for p10, p18, and sC. This finding is similar to that found for ARVs but distinct from that found for classical MDRV and GRV, which have a bicistronic S4 segment that encodes p10 and sC and do not encode p18. The amino acid (aa) alignments of the putative proteins encoded by the main ORF in each segment revealed a high similarity (14.1–100%) to the counterpart proteins encoded by other ARV species from the avian orthoreoviruses (e.g., ARV, classical MDRV and N-MDRV) in the Orthoreovirus genus, particularly with N-MDRV (94.6–100%). The phylogenetic analysis of the nucleotide sequences of all 10 genome segments revealed that N-MDRV ZJ00M is distinct from all other described reovirus species groups but is a separated from the ARV (including MDRV and GRV) species within orthoreovirus species group II and grouped into the classical MDRV and GRV genogroup with the N-MDRV isolates. The MDRV genogroup can be further divided into two genotype clusters. The morphological and pathological analyses and the genetic characterization of N-MDRV ZJ00M suggest that it belongs to genotype 2 (N-MDRV). In addition, the RT-PCR assays of DRV diseased duckling and gosling samples collected from different regions of China during 2000–2013 indicate that N-MDRV is currently the prevalent genotype in China. ß 2013 Elsevier B.V. All rights reserved.

Keywords: Novel Muscovy duck reovirus Sequence analysis Genotype RT-PCR assay

1. Introduction

* Corresponding author at: Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agricultural Sciences, 145 Shiqiao Road, Hangzhou 310021, China. Tel.: +86 571 8640 4182; fax: +86 571 8640 0836. E-mail addresses: [email protected], [email protected] (C. Zhang). 0378-1135/$ – see front matter ß 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetmic.2013.11.005

Avian reoviruses (ARVs) are members of the Orthoreovirus genus in the family Reoviridae. They are nonenveloped viruses that replicate in the cytoplasm of infected cells and contain a fragmented double-stranded RNA genome enclosed within a double protein capsid shell with a diameter of 70–80 nm. The genomic segments can be separated on the basis of their electrophoretic mobility into three size classes: large (L1–L3), medium (M1–M3),

262

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

and small (S1–S4) (Nick et al., 1975; Spandidos and Graham, 1976; Gouvea and Schnitzer, 1982; Benavente and Martı´nez-Costas, 2007). All avian reovirus (ARV) encoded proteins include at least 10 structural proteins (lA, lB, lC, mA, mB, sC, sA, and sB) and four nonstructural proteins (mNS, p10, p17, and sNS). Avian reoviruses have been associated with different diseases in a variety of domestic and wild birds, including chicken (Olson and Weiss, 1972), goose (Palya et al., 2003; Yun et al., 2012), turkey (Simmons et al., 1972), Muscovy duck (Gaudry et al., 1972), Pekin duck (Jones and Guneratne, 1984), pigeon (Vindevogel et al., 1982), quail (Ritter et al., 1986), psittacine birds (Conzo et al., 2001), and several other wild bird species (Heffels-Redmann et al., 1992; Kuntz-Simom et al., 2002). Birds are most susceptible at a young age (Rosenberger et al., 1989). Classical Muscovy duck reovirus (MDRV) is the etiological agent of a disease first described in South Africa in 1950 (Kaschula, 1950) and then isolated in France in 1972 (Gaudry et al., 1972). MDRV mainly infects ducklings between 2 and 4 weeks of age; their resulting morbidity is high, and their rate of mortality ranges from 10 to 50%. In addition, recovered Muscovy ducks are markedly stunted in growth. The disease is characterized by general weakness, diarrhea, serofibrinous pericarditis, swollen liver and spleen, and covered small white necrotic foci (Gaudry et al., 1972; Malkinson et al., 1981; Pascucci et al., 1984; Marius-Jestin et al., 1988). MDRV shares common properties with avian reovirus, such as syncytium formation in cell culture and inability to hamagglutinate (Malkinson et al., 1981). However, several notable differences exist between MDRV and ARV, including different antigenicity by cross-neutralization tests (Heffels-Redmann et al., 1992), host species differences (chicken and Muscovy duck), pathogenic properties (Marius-Jestin et al., 1988), protein profiles (HeffelsRedmann et al., 1992), electropherotypes, and genomic coding assignments (Kuntz-Simom et al., 2002). For example, the classical MDRV minor outer capsid protein sC is encoded by S4 (Kuntz-Simom et al., 2002) and not by S1, as is usually found in ARV. In China, classical MDRV infection has been reported since 1997 (Wu et al., 2001). The virus isolates share identical properties in pathology, culture, and genome (Kuntz-Simom et al., 2002; Zhang et al., 2007; Ba´nyai et al., 2005; Wang et al., 2013). Since 2002, a new infectious disease emerged among Muscovy ducks and geese in Southeast China. The disease is characterized mainly by hemorrhagic-necrotic lesions in the liver and spleen of the sick birds and is tentatively designated hemorrhagicnecrotic hepatitis (Liu et al., 2011). Recently, the causative agent of the disease was isolated and identified; its pathogenicity, growth properties, and genome sequences classify it as a novel duck reovirus (NDRV) (Chen et al., 2012; Yun et al., 2012; Ma et al., 2012; Wang et al., 2012). In this study, a novel duck reovirus strain, named NMDRV ZJ00M, was isolated from a diseased Muscovy duckling in Zhejiang province of China in 2000. Its whole genome was cloned, sequenced, and analyzed. The genome of N-MDRV ZJ00M exhibited distinct molecular characteristics compared with ARV and classical MDRV. The study

revealed that N-MDRV has existed in China at least since the 2000s and provided additional insights into the reassortment and evolutionary relationship within intraand interspecies of Orthoreovirus species groups II. 2. Materials and methods 2.1. Virus isolation and virological characterization Liver samples of the dead Muscovy duckling with hemorrhagic-necrotic lesions were collected from a duck farm in Zhejiang Province and processed for virus isolation using embryonated SPF chicken eggs. Briefly, the liver samples were homogenized in PBS (pH 7.2) containing antibiotics (10,000 units/ml penicillin and 10,000 mg/ml streptomycin) to obtain a 20% suspension (w/v). The suspension was centrifuged at 12,000  g for 10 min and then inoculated on the chorioallantoic membrane of 10day-old chicken embryos (0.2 ml/embryo). The embryonic viability was monitored daily for 7 days. For cell culture passage, the allantoic fluid was inoculated into chicken embryo fibroblast (DF-1) cells (1.0 ml of a 1:10 dilution in medium) and incubated at 37 8C for 1 h for virus adsorption. The inoculums were then removed, and fresh medium containing 1% FBS was added. The cells were incubated for an additional 48–72 h at 37 8C/5% CO2 and checked daily for cytopathic effects (CPE). The cells were freeze-thawed three times, the cellular debris was removed through low-speed centrifugation, and the supernatant fluid was stored at 70 8C for the following experiments. The isolated virus was cultured for at least three passages for amplification and sequencing. The virus titers were determined by plaque assay on DF-1 cells (Igarahi et al., 1981; Okuno et al., 1984). Briefly, monolayer cultures of DF-1 cells (1  105/well) grown in six-well plates were incubated with 10-fold serial dilutions of the virus for 1 h at 37 8C. The infected cells were then overlaid with 2 ml of DMEM containing 1.5% methyl cellulose and 2% fetal bovine serum and incubated at 37 8C under a 5% CO2 atmosphere for 72 h. The cells were fixed with 1 ml of 10% formaldehyde for 30 min, washed with PBS (pH 7.2), and stained with methylene blue tetrahydrate solution to visualize the plaques, and the visualized plaques were counted. The virions were purified by differential centrifugation. First, the virus suspension (crude extract) was centrifuged at 10,000  g for 30 min at 4 8C to remove the cellular debris. Second, the resultant supernatant was precipitated with 50% saturated ammonium sulfate at 4 8C. The precipitate was collected by centrifugation at 10,000  g for 20 min and suspended in a buffer consisting of 0.02 M Tris (pH 7.0), 0.001 M EDTA, and 0.15 M NaCl. This virus buffer was then ultracentrifuged for 3 h at 130,000  g in a Beckman SW70 rotor at 4 8C on a 40% sucrose cushion (W/ V, prepared with PBS), and the virus pellet was resuspended in 50–100 ml of cold DEPC H2O and stored at 80 8C until use. The viral morphology was determined through transmission electron microscopy as described previously (Hoshino et al., 2007). Briefly, the cells were fixed in 2.5% glutaraldehyde and 1% osmic acid for 2 h on ice, and

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

the cell pellets were dehydrated and embedded in Epon 812 (Nissin EM, Tokyo, Japan). Thin sections were cut, stained with uranyl acetate, and examined with a Hitachi model H-7000 transmission electron microscope. The purified virus particles were placed onto Formvarcarbon-coated copper grids, negatively stained with 2% phosphotungstic acid (PTA), 2% uranyl acetate (UA), or UAPTA double staining, and examined with an electron microscope. The dsRNA from the virus was extracted using the commercial TRI-Reagent (TaKaRa) according to the manufacturer’s instructions. It was then precipitated with 2 M LiCl to remove the ssRNA. The dsRNA was purified from the supernatant using a column from the Qiagen Gel Extraction kit. The extracted RNAs were maintained at 70 8C. The viral dsRNA were analyzed by SDS-PAGE on vertical slab gels (7.5% polyacrylamide gel) in Laemmli’s discontinuous buffer (Laemmli, 1970). The RNA segments were visualized by silver staining (Dolan et al., 1985). A method of full-length amplification of cDNA (FLAC), which was optimized and described by Maan et al. (2007) and Potgieter et al. (2009), was used to obtain the entire sequences of the genomic segments of N-MDRV. A hairpin anchor primer, FLAC loop (50 -p-GACCTCTGAGGATTCTAAAC TCCAGTTTAGAATCC. . .OH-30 ), which is similar to that described by Maan et al. (2007), was ligated to the viral dsRNA. The ligation reaction was performed by T4 RNA ligase (New England Bio Labs, UK). The ligated dsRNA was purified using agarose gel extraction columns following the manufacturer’s recommendations (TaKaRa). The first strand cDNA of the genome segments was synthesized using an M-MLV reverse transcription system (Promega, USA) according to the recommended protocols. The cDNA was used directly for PCR or stored at 20 8C. The amplification of the cDNA was performed using a 50 phosphorylated FLAC 2 primer (50 -CCGAATTCAGTTTAGAATCCTCAGAGGTC-30 ), which contains the restriction enzyme sites for EcoRI (underlined) to facilitate the cloning and subcloning of the amplified cDNA. To ensure that the nucleotide sequences did not contain PCR-based errors, three clones of each gene of DRV were sequenced. 3. Sequencing and sequence analysis The amplified cDNA products were separated on a 1% TAE agarose gel, and the individual segments were purified using an agarose gel extraction kit. The purified PCR products were cloned into T/A cloning vectors pMDT18Simple (TaKaRa). The positive clones were identified based on the size of the inserts. The terminal ends of the cDNA inserts were all sequenced with M13 universal primers using an ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction kit (version 2.0) on an ABI PRISM 3730 DNA sequencer (Perkin-Elmer Applied Biosystems). When necessary, custom primers were designed to obtain the complete sequence of both strands of each insert. The sequence analysis was performed using the Clustal W software program (Thompson et al., 1994) and MEGA 5.0 (Tamura et al., 2011). Phylogenetic trees based on the nucleotide sequences of all 10 genome segment were

263

constructed using the maximum likelihood method (Tamura et al., 2011) with 1000 bootstrap iterations. The nucleotide sequence data reported in this study have been deposited in the GenBank database and have been assigned accession numbers for each gene of NDRV. 4. RT-PCR assays of diseased duckling and gosling samples Diseased ducklings/goslings with hemorrhagic-necrotic symptoms and white necrotic foci were collected from different farms in Zhejiang, Fujian, and Jiangsu provinces during 2000–2013. The total RNA from the liver or spleen of the diseased birds was extracted according to the manufacturer’s protocol and used as templates for RT-PCR. Specific primers for the Sigma C gene were designed and synthesized according to the S1/S4 segments of N-MDRV ZJ00M and classical MDRV (AY580259). (N-MDRV: sC-F: 50 -ACGATGGATCGCAACGAGGTG-30 , sC-R: 50 -GATGAATAGCTCTTCTCATCGC-30 ; classical MDRV: sC-F: 50 CCTGGAACGAATACCACCTTCA-30 , sC-R: 50 -CAAATGGTCGCAATGGAGAAGC-30 ). The RT-PCR products were purified and sequenced, and their lengths were 1001 bp (N-MDRV) and 826 bp (classical MDRV), respectively. 5. Results and discussion 5.1. Virus culture, electron microscopy, and SDS-PAGE analysis Seven days after chorioallantoic membrane inoculation of the liver homogenate, all of the six SPF chicken embryos had died. The embryo allantoic fluid collected from the first passage caused 100% mortality of the chicken or duck embryos in the subsequent passages. Both embryos exhibited edema with severe subcutaneous hemorrhage and multiple necrotic foci in the liver and spleen. The inoculation of monolayers of DF-1 cells resulted in the development of CPE, usually after 3–5 blind passages. Focal CPE appeared with the cells rounding up and floating free from the surface of the flask 72 h post infection (Fig. 1A). Fusion of the infected cells and formation of syncytium, which is characteristic of ARVs, was not observed in any of the TC systems. No hemagglutination activity was detected in the allantoic fluid and cell culture supernatants. The viral titer determined at three days post-infection was 106.5 TCID50/ml. The electron microscopy observations revealed that the virus displayed a spherical shape and possessed two capsid layers. In addition, the virus was 75 nm in diameter and thus similar in size to known ARVs, which range from 70 to 90 nm in size. The boundary between the outer capsid and the inner core is evident, as shown by a prominent white ring in the negatively stained electron micrograph (Fig. 1B). The N-MDRV ZJ00M genomes were purified and analyzed by SDS-PAGE. As shown in Fig. 1C, the genome segments were separated into 10 distinct bands, with segments 1 and 2 co-migrating. The comparison of the genomes of N-MDRV ZJ00M, classical MDRV, and ARVS1133 showed that all of the segments of each segment group (large, L; medium, M; small, S) display some

264

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

Fig. 1. Cytopathic effect, electron micrograph, and genome electrophoresis of N-MDRV. (A) Cytopathic effect (CPE) induced by N-MDRV in DF-1cell lines (10  20). (B) Electron micrograph of the purified isolate negatively stained with 2% phosphotungstic acid. Note the double capsid structure. The scale bar represents 50 nm. (C) Comparison of the electrophoretic mobility of N-MDRV, classical MDRV and ARV genome segments. Purified genomic dsRNA segments of ARV-S1133 (lane 1), classical MDRV (lane 2) and N-MDRV ZJ00M (lane 3) were analyzed by 7.5% PAGE and visualized by silver staining. The locations of the large (L), medium (M) and small (S) size class segments are indicated, along with the numbering scheme of the S class genome segments.

difference in their electrophoretic mobility (Fig. 1C). The NMDRV ZJ00M, classical MDRV, and ARV L and M genes migrated to similar positions in the gel, and major differences were clearly evident in the mobility of the S segments. The analysis of the N-MDRV ZJ00M segment revealed that the S1 gene position migrates more closely to the M segments than to the other S genes, whereas the four classical MDRV S genes migrated together, and the other S genes (S2–S4) positions are similar to the genes of ARVS1133. 6. The genome of N-MDRV ZJ00M The complete sequences of segments 1–10 of N-MDRV ZJ00M were obtained and have been deposited in GenBank under accession numbers KF154110 to KF154119. The complete genome sequence of N-MDRV ZJ00M was determined to consist of 23,419 bp divided in 10 segments that range in size from 1191 bp to 3959 bp. The average

G+C content for each segment was 50.13% and varied only by 1.35% between the different segments (Table 1). Reovirus segments normally encode a single open reading frame (ORF) that spans almost the entire length of the segment. However, there have been several cases where reovirus segments encode more than one ORF (Bodelo´n et al., 2001; Mattion et al., 1991; Suzuki et al., 1996). Based on predicted ORF start and stop codons, each DRV segment was examined to determine its open reading frames (ORFs). With the exception of the S1 genome segments, which contain three ORFs, the other segments contained only one ORF. The ORFs of the S1 genome have a partially overlapping gene arrangement and consist of the p10, p18, and sC ORFs arranged from 50 to 30 on the S1 genome segment plus strand (mRNA) (Table 2). Each N-MDRV ZJ00M segment sequence was used as a query in BLASTp searches of the non-redundant protein database. Several ARV and classical MDRV proteins showed the highest amino acid identity to the putative

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

265

Table 1 Characteristics of genome segments and predicted functions of proteins in novel Muscovy duck reovirus (N-MDRV). Genome segment

0

0

ORF coordinates

Segment length (bp)

GC%

5 UTR (bp)

3 UTR (bp)

L1

3959

49.79

21

56

L2

3830

48.93

14

L3 M1

3907 2284

48.61 49.30

M2 M3

2158 1996

S1

S2 S3 S4 a

Predicted functiona

Protein

Gene

Coding potential

Protein size (aa)

MV (KDa)

Isoelectric point (PI)

22–3902

lA

1293

142.2

6.307

36

15–3793

lB

1259

139.9

8.042

12 12

37 73

13–3870 13–2211

lC mA

1285 732

142.0 82.1

5.059 8.297

50.97 52.05

29 24

98 64

30–2060 25–1932

mB mNS

675 635

73.1 70.7

5.106 6.303

1568

49.59

19

32

273–761

P10

97

10.2

6.554

1324 1202 1191

42.86 51.33 52.04 49.42 51.39

58 68 64

571–1536 20–313 16–1268 31–1134 24–1127

P18 sC sA sB sNS

162 321 416 367 367

18.3 34.1 46.1 41.4 40.1

8.283 5.995 8.544 6.630 6.825

15 30 23

Inner core protein, core–shell scaffold Inner core protein, putative transcriptase (RdRp) Turrets, capping enzyme Inner core, putative transcriptase co-factor Outer capsid protein, penetration Nonstructural protein, formation of viral factories and protein recruitment Nonstructural protein, permeabilising/fusogenic Nonstructural protein, unknown Outer capsid, cell attachment Inner core protein, dsRNA binding Outer capsid protein, unknown Nonstructural protein, ssRNA binding

Protein coding assignments and functions proposed by Benavente and Martı´nez-Costas (2007).

N-MDRV ZJ00M orthologs, including ORFs L1, L2, L3, M1, M2, M3, S1a, S1b, S2, S3, and S4. Therefore, the putative protein functions of the respective ORFs were proposed based on their homology to their ARV counterparts (Table 1). 7. Non-coding regions of N-MDRV ZJ00M genome segments As shown in Table 1, the 50 - and 30 -non-coding regions (NCRs) of the segments were short, averaging 20 nt and 59 nt, respectively. Conserved terminal nucleotide sequences have been considered as a feature in reovirus classification. The comparison of the genome sequences of DRV showed that all of the segments contained conserved terminal sequences. As is typical of the family Reoviridae (Mertens and Sangar, 1985; Kudo et al., 1991; Isogai et al., 1998a), the terminal sequences of N-MDRV ZJ00M positive-sense RNAs were conserved among the segments. All 10 N-MDRV ZJ00M segments shared the 50 -GCUUUUU motif at the 50 NCR and the 50 -UCAUC motif at the 30 -NCR. The 50 -NCRs and 30 -NCRs contained motifs that were highly conserved compared to the ARVs. The conserved nucleotides 50 -GCUUUUU-30 were present at the 50 ends in all of the positive strands of each segment, and 50 -UAU/CUCAUC-30 was present at the 30 ends. These were very similar to that found in group II of the Orthoreovirus genus, which includes ARV (50 GCUUUUU-30 at the 50 end and 50 -UAUUCAUC-30 at 30 end) and classical MDRV (50 -GCUUUUU-30 at the 50 end and 50 -UAU/CUCAUC-30 at the 30 end; Table 3). Conserved terminal sequences can be used in genome assembly and packaging as ‘‘sorting’’ signals (Xu et al., 1989). Moreover, the first and last nucleotides of each segment in all orthoreoviruses were complementary (G-C). Potential imperfect inverted repeats were also predicted in the sequences adjacent to each termini of the N-MDRV ZJ00M

positive-sense strand (Table 4). It has been reported that complementary sequences in the 50 - and 30 -NCR may facilitate viral replication by circularizing the RNA transcript (Patton, 2001). Orthoreovirus genome segments characteristically have non-coding regions at the 50 and 30 ends of each coding strand. In N-MDRV, these nucleotide sequences are not conserved between the 10 genome segments, and the regions at the 50 end are consistently smaller in length (12– 30 nucleotides) compared to those at the 30 end (32–98 nucleotides). These features have previously been reported for the genome segments of the MRV, ARV, NBV, and BRV species (Duncan, 1999). 8. Comparison with other orthoreovirus species Orthoreoviruses share a wide range of nucleotide (nt) and amino acid (aa) sequence identities. The extent of similarity has served as a basis for the classification of orthoreoviruses into different groups (I–V) (Mertens et al., 2000). The nt and aa sequence identities are greater than 75% and 85% between homologous orthoreovirus genes, which results in the strains being classified into the same species group. In contrast, if the nt and aa identities are less than 60% and 65%, respectively, the strains belong to distinct species group (Mertens et al., 2000). The genes and proteins of N-MDRV ZJ00M were compared with their homologs from other orthoreovirus species (Table 2). The results showed that N-MDRV ZJ00M has a higher similarity (nt, 31.4–99.7%; aa, 14.1–100%) with the avian orthoreoviruses (ARV, classical MDRV and N-MDRV etc.) in Orthoreovirus genus, particularly with NMDRV (nt, 86.8–99.6%; aa, 94.6–100%). For ZJ00M and ARVs (ARV and classical MDRV), the sequence comparisons of the 10 genome segments showed that the sequence divergences of the outer capsid protein (mB, sB, and sC)encoding genes were significantly higher than those of

266

Table 2 Percent sequence identities of genome segments and proteins between N-MDRV and orthoreovirus species. Orthoreovirus

lA

lB

lC

mA

mB

mNS

sA

sB

p10a

sC/s1

p18/NSPa

sNS

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

nt

aa

138 176 S1133

77.0 77.6 77.6

94.7 94.6 94.7

77.2 75.8 75.7

91.3 91.5 91.2

70.1 70.1 70.3

79.4 79.3 79.5

73.6 73.6 73.6

86.3 86.2 86.2

77.4 76.8 76.7

90.4 89.0 89.8

71.5 71.7 71.8

80.2 79.8 80.3

77.5 77.5 77.1

91.8 91.3 90.4

59.6 60.1 59.8

68.1 69.2 68.9

38.8 38.4 38.3

28.5 29.7 29.4

46.9 47.6 48.3

34.0 33.0 33.0

31.8 31.4 31.6

14.1 14.1 14.1

78.1 77.9 78.0

90.7 90.5 89.4

MDRV

815–12 S14

85.8 NA

97.4 NA

87.9 NA

98.0 NA

79.7 NA

93.0 NA

95.6 81.2

96.9 94.4

67.3 67.4

75.6 76.3

85.9 86.2

94.2 94.2

87.5 87.6

98.1 98.1

61.1 61.7

68.7 69.2

52.9 53.1

41.6 42.0

35.9 NA

7.9 NA

NE NE

NE NE

84.6 85.1

97.0 97.3

N-MDRV

03G 091 J18

86.8 97.8 97.1

98.0 99.2 99.6

98.2 97.5 88.0

97.5 99.7 99.0

96.8 97.6 98.4

98.6 99.1 99.3

96.4 99.1 97.5

97.0 99.0 98.5

87.9 98.5 97.9

96.1 99.0 99.0

94.8 99.4 99.4

96.4 99.1 99.2

88.8 89.0 99.6

97.6 98.3 100.0

94.7 97.5 97.7

94.6 97.5 96.2

97.4 97.9 97.4

97.5 98.4 97.2

98.3 98.6 98.0

100.0 100.0 100.0

96.7 98.4 97.3

95.7 100.0 96.9

94.3 99.4 93.8

97.8 100.0 97.0

53.4

50.9

54.2

51.2

40.7

26.1

44.1

33.8

50.0

46.3

39.2

21.9

45.2

34.6

25.1

21.2

NA

NA

35.5

14.3

30.6

4.9

45.0

35.6

BRoV BRV

54.4

51.6

52.9

50.2

40.6

25.8

44.5

32.2

47.0

38.5

36.9

21.6

40.0

28.7

24.7

19.7

NA

NA

35.2

10.1

27.4

7.7

41.7

27.4

NBV

66.2

72.6

64.7

70.9

47.5

40.5

52.1

46.9

64.2

68.5

48.5

39.1

58.7

59.6

32.0

32.9

32.7

23.3

43.1

31.9

31.9

16.2

54.1

51.0

Pulau

66.7

73.6

58.1

71.0

47.9

40.6

52.8

47.2

63.0

68.5

48.5

38.9

56.8

59.1

32.5

31.8

32.2

18.9

44.4

30.9

32.5

15.8

54.1

51.0

RRV

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

NA

28.2

26.3

30.8

17.8

32.8

12.8

NE

NE

NA

NA

50.6 49.4 50.6

43.8 44.1 43.8

54.2 54.9 54.2

53.7 54.0 53.5

41.8 40.6 41.0

27.8 27.4 27.5

43.5 43.5 43.2

27.3 27.4 27.0

51.4 51.6 51.4

45.5 45.3 45.5

42.3 43.1 42.7

22.7 23.2 22.1

41.9 42.0 42.7

28.2 28.2 28.2

24.2 22.5 22.2

17.7 17.7 17.5

31.7 31.7 32.6

17.1 15.9 15.9

NE NE NE

NE NE NE

43.9 39.5 33.7

11.9 7.1 6.7

42.7 43.1 42.7

23.8 23.8 23.5

MRV

MRV1 MRV2 MRV3

aa: amino acid sequence. nt: nucleotide sequence. NA: sequence not available. NE: no equivalent sequence. a Nucleotide sequence of the polycistronic genome segment: the S1 genome segments of MRV, ARV, NBV and RRV species, the S4 genome segment of classical MDRV and BRV (and BroV) species.

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

ARV

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271 Table 3 Conserved terminal nucleotide sequences on dsRNA genome segments of the six recognized orthoreovirus species groups and N-MDRV are listed. Orthoreovirus species group

Conserved terminal nucleotide sequences

I. Mammalian orthoreovirus (MRV) II. Avian orthoreovirus (ARV) Moscovy reovirus (MDRV) Novel duck reovirus (N-MDRV) III. Nelson bay virus (NBV) IV. Baboon orthoreovirus (BRV) V. Reptilian orthoreovirus (RRV) VI. Broome virus (BroV)

50 -GCUA. . .UCAUC-30 50 -GCUUUUU. . .UAUUCAUC-30 50 -GCUUUUU. . .UAU/CUCAUC-30 50 -GCUUUUU. . .UAU/CUCAUC-30 50 -GCUUUA. . .UCAUC-30 50 -GUAAA. . .UCAUC-30 50 -GUUAUUUU. . .UCAUC-30 50 -GUCAA. . .UCAUC-30

other genes. In addition, the tricistronic genome segment S1, which encodes sC, displayed the greatest level of sequence divergence among the L-, M-, and S-class genome segments. This is likely due to the selective pressures exerted on the reovirion outer capsid, particularly the cell attachment protein (sC). The overall identity values between N-MDRV ZJ00M and other orthoreovirus homologous proteins ranged from 6.7% to 73.6% (Table 2). Based

267

on the level of sequence identity between the genome segments and encoded proteins of N-MDRV ZJ00M and other orthoreovirus species, N-MDRV ZJ00M was assigned to the avian orthoreoviruses species in the genus Orthoreovirus. Furthermore, segment sequence analysis and alignment revealed that the functional domains, conserved amino acid residues, and sequence motifs of N-MDRV ZJ00M in the l-, m-, and s-class proteins are almost identical with those previously identified in the homologous proteins of ARV and classical MDRV (Liu et al., 2003; Noad et al., 2006; Su et al., 2006; Xu and Coombs, 2008; Kuntz-Simom et al., 2002; Ba´nyai et al., 2005; Zhang et al., 2007; Wang et al., 2013), which suggests that the functional domains, conserved amino acid residues, and sequence motifs are conserved in the genome segments of ARV, classical MDRV, and N-MDRV. 9. Phylogenetic analysis The evolutionary relationships of N-MDRV ZJ00M with the Orthoreovirus genus members, particularly ARV and

Table 4 Conserved terminal sequences and imperfect inverted repeats (shaded areas) located at both termini nucleotide sequences of N-MDRV genome segments.

N-MDRV terminal sequences

RNA segment

5' end

3' end Inverted repeats

L1

GCUUUUUCUCCGAACG

L2

GCUUUUUCCUCACCAUGC

L3

GCUUUUUCACCC

M1

GCUUUUUCUCGAC

GUCUUGAGAUAUUCAUC

M2

GCUUUUUGAGUGCUAA

UUGGCACGUUAUUCAUC

M3

GCUUUUUGAGUCC

GGACUCGGUUACUCAUC

S1

GCUUUUUCUUCUC

GAGAAGAGCUAUUCAUC

S2

GCUUUUUCUCCCACG

S3

GCUUUUUGAGUCC

GGACUCGCCUAUUCAUC

S4

GCUUUUUGAGUCC

GGACUCUUAUUCAUC

Consensus

GCUUUUU

CGUUGGAGGUUAUUCAUC

GCAUGGCUCGAGGAAUUACUCAUC

GGGUGUUACUCAUC

CGUGGGUGUAUUCAUC

UCAU C

268

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

Fig. 2. Phylogenetic trees built based on nucleotide sequences of the homologous L, M and S genome segments of Orthoreovirus species, using maximum likelihood method in the mega 5 program (Tamura et al., 2011). Bootstrap values of 1000 replications are shown at the notes. All trees are plotted to the same scale. The bar indicates genetic distance. (^) Strain determined in this study.

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

classical MDRV, were determined by phylogenetic analysis. Phylogenetic trees were constructed using the maximum likelihood method with bootstrapping based on the nucleotide sequences of all 10 genome segments (Fig. 2). In all of the phylogenetic trees, each case yielded similar results: the N-MDRV ZJ00M is distinct from all other described reovirus species groups but still classified into the previously defined Orthoreovirus species group II with the other ARVs (including DRV and GRV) and further grouped into the classical MDRV and GRV genogroup (Fig. 2). The phylogenetic trees constructed using the nucleotide sequences of the segments encoding the three outer capsid proteins (mB, sB, and sC) showed that ZJ00M was classified into the cluster containing N-MDRV (091, J18, TH11, and NP03 strains) and N-GRV (03G strain), which are the Chinese reovirus strains that emerged in recent years, and classical MDRV and GRV (including the 815–12, S14, 89026, 89330, and D14/99 strains) constitute another cluster within the MDRV genogroup. According to the criteria used for the genotype classification of ARV (Liu et al., 2003; Su et al., 2006), the MDRV genogroup could be further divided into two different genotypes. The classical MDRV and GRV belong to genotype 1, and N-MDRV is grouped into genotype 2. In addition, the results of the phylogenetic analysis based on the nucleotide sequences of lC and sNS was identical to those obtained from the phylogenetic analysis based on the three outer capsid proteins: the MDRV genogroup can be divided into two genotypes.

269

Viral RdRp is an important gene for the phylogenetic analysis of Reoviridae, and phylogenetic analysis based on the gene sequence of RdRp has been used to confirm the evolutionary status of various species (Attoui et al., 2006; Mohd Jaafar et al., 2008; Stenger et al., 2009; Allyn et al., 2012). In phylogenetic trees based on the nucleotide sequences of RdRp, lA, mA, and mNS, the N-GRV 03G isolate was more closely related to the classical MDRV 815–12 isolate than to other N-MDRV isolates. Based on the topological heterogeneity observed among the phylogenetic trees, we hypothesize that a genetic reassortment of the L, M, and S segments likely occurred within Orthoreovirus species group II. 10. RT-PCR samples of different years and regions Total RNA was extracted from diseased duckling or gosling samples and used as templates for RT-PCR. Specific amplification bands (N-MDRV, 1001 bp; classical DRV, 826 bp) were obtained from all of the samples. The nucleotide sequence alignments of the amplification products showed that 80.8% of the samples (23/26) displayed high nucleotide sequence similarities to the sC (S1) sequence of N-MDRV (97.3–99.7%). Only three samples (white necrotic foci in the liver and spleen) were detected by specific primers of classical MDRV, and the amplification products shared 96.1–97.8% identities with the sC (S4) nucleotide sequence of classical MDRV (AY580259). The phylogenetic tree constructed based on

Table 5 The detection of N-MDRV and classical MDRV in the clinical samples by RT-PCR during 2000–2013. Samples

Pathotype

Districts

Date collected

Breeds

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

WNF WNF WNF HNL HNL HNL HNL WNF HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL HNL

Zhejiang Zhejiang Zhejiang Zhejiang Zhejiang Zhejiang Zhejiang Zhejiang Zhejiang Zhejiang Fujian Beijing Zhejiang Zhejiang Jiangsu Zhejiang Zhejiang Jiangsu Zhejiang Jiangsu Zhejiang Zhejiang Jiangsu Zhejiang Zhejiang Zhejiang

2000 2000 2000 2000 2003 2005 2005 2006 2006 2008 2008 2009 2009 2010 2010 2010 2011 2011 2011 2012 2012 2012 2012 2012 2013 2013

Muscovy duckling Muscovy duckling Muscovy duckling Muscovy duckling Gosling Muscovy duckling Muscovy duckling Muscovy duckling Wild duckling Muscovy duckling Muscovy duckling Peking duckling Wild duckling Muscovy duckling Muscovy duckling Gosling Muscovy duckling Muscovy duckling Muscovy duckling Muscovy duckling Muscovy duckling Muscovy duckling Muscovy duckling Muscovy duckling Muscovy duckling Shaoxing duckling

Positive rate% (positive numbers/total numbers) WNF: white necrotic foci; HNL: hemorrhagic-necrotic lesions. ‘‘+’’: positive; ‘‘’’: negative.

Results N-MDRV

Classical MDRV

   + + + + + + + + + + + + + + + + + + + + + + +

+ + +                   

80.8%(23/26)

19.2%(3/26)

  

270

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271

the segment encoding sC (Fig. 2) also revealed that the No. 4-26 samples were grouped in the N-MDRV cluster, and the No. 1-3 samples were classified into the classical MDRV genotype. This finding suggests that N-MDRV has existed in China since 2000 and is a currently popular genotype in southeastern China. In addition, different duck breeds and geese, including Muscovy duck, Peking duck, Shaoxing duck, and domesticated wild duck, are affected by N-MDRV (Table 5). 11. Conclusions In summary, N-MDRV exhibits a number of different properties and pathogenicity compared with ARVs (classical MDRV and GRV). These differences mainly include the following: N-MDRV causes disease in different duck breeds that is mainly characterized by hemorrhagic-necrotic lesions in the liver and spleen; N-MDRV does not cause syncytium formation in cell culture; the S1 segment of NMDRV is a tricistronic gene that encodes the overlapping ORFs for p10, p18, and sC. Phylogenetic analysis indicates that N-MDRV is distinct from all other described reovirus species groups (I–IV) but is still classified into the orthoreovirus species group II with the other ARV and classical MDRV and is grouped into the MDRV genogroup. In addition, the MDRV genogroup can be further divided into two genotype clusters. Furthermore, the RT-PCR assays of samples from different regions and years suggests that N-MDRV has existed since 2000 and is currently a widely prevalent genotype in southeastern China. Acknowledgments This work was supported by grants from the Special Fund for Agro-scientific Research in the Public Interest (201003012), Public Welfare Technology Research Project of Zhejiang Province (2012C22074), the Zhejiang Natural Sciences Foundation (LY13C180002), Three Rurals and Six Parties Project of Zhejiang Province and the Scientific and Technological Innovation Team of Zhejiang Province. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.vetmic.2013.11.005. References Allyn, S., Mark, S.S., Drake, C.S., 2012. Reovirus genomes from plantfeeding insects represent a newly discovered lineage within the family Reoviridae. Virus Res. 163, 503–511. Attoui, H., Jaafar, F.M., Belhouchet, M., de Micco, P., de Lamballerie, X., Brussaard, C.P., 2006. Micromonas pusilla reovirus: a new member of the family Reoviridae assigned to a novel proposed genus (Mimoreovirus). J. Gen. Virol. 87, 1375–1383. Ba´nyai, K., Palya, V., Benko, M., Bene, J., Havasi, V., Melegh, B., Szucs, G., 2005. The goose reovirus genome segment encoding the minor outer capsid protein, sigma1/sigmaC, is bicistronic and shares structural similarities with its counterpart in Muscovy duck reovirus. Virus Gene 31, 285–291. Benavente, J., Martı´nez-Costas, J., 2007. Avian reovirus: structure and biology. Virus Res. 123, 105–119.

Bodelo´n, G., Labrada, J., Martı´nez-Costas, J., Benavente, J., 2001. The avian reovirus segment S1 is a functionally tricistronic gene that expresses on structural and two nonstructural proteins in the infected cell. Virology 290, 181–191. Chen, Z.Y., Zhu, Y.Q., Li, C.F., Liu, G.Q., 2012. Outbreak-associated novel duck reovirus, China, 2011. Emerg. Infect. Dis. 18, 1209–1211. Conzo, G., Magnino, S., Sironi, G., Lavazza, A., Vigo, P.G., Fioretti, A., Kaleta, E.F., 2001. Reovirus infection in two species of Psittaciformes recently imported into Italy. Avian Pathol. 30, 43–47. Dolan, K.T., Twist, E.M., Horton-Slight, P., Forrer, C., Bell, L.M., Plotkin, S.A., Clarh, H.F., 1985. Epidemiology of rotavirus electropherotypes determined by a simplified diagnostic technique with RNA analysis. J. Clin. Microbiol. 21, 753–758. Duncan, R., 1999. Extensive sequence divergence and phylogenetic relationships between the fusogenic and nonfusogenic orthoreoviruses: a species proposal. Virology 260, 316–328. Gaudry, D., Charles, J., Tektoff, J., 1972. A new disease expressing itself by a viral pericarditis in Barbary ducks. C. R. Acad. Sci. 274, 2916–2929. Gouvea, V.S., Schnitzer, T.J., 1982. Polymorphism of the migration of double-stranded RNA genome segments of avian reoviruses. J. Virol. 43, 465–471. Heffels-Redmann, U., Mu¨ller, H., Kaleta, E.F., 1992. Structural and biological characteristics of reoviruses isolated from Muscovy ducks (Cairina moschata). Avian Pathol. 21, 481–491. Hoshino, K., Isawa, H., Tsuda, Y., Yano, K., Sasaki, T., Yuda, M., Takasaki, T., Kobayashi, M., Sawabe, K., 2007. Genetic characterization of a new insect flavivirus isolated from Culex pipiens mosquito in Japan. Virology 359, 405–414. Igarahi, A., Buei, K., Ueba, N., Yoshida, M., Ito, S., Nakamura, H., Sasao, F., Fukai, K., 1981. Isolation of viruses from female Culex tritaeniorhynchus in Aedes albopictus cell cultures. Am. J. Trop. Med. Hyg. 30, 449–460. Isogai, M., Uyeda, I., Lindsten, K., 1998a. Taxonomic characteristics of Fijiviruses based on nucleotide sequences of the Oat sterile dwarf virus genome. J. Gen. Virol. 79, 1479–1485. Jones, R.C., Guneratne, J.R.M., 1984. The pathogenicity of some reoviruses with particular reference to tenosynovitis. Avian Pathol. 13, 173–189. Kaschula, V.R., 1950. A new virus disease of the Muscovy duck (Cairina moschata (Linn)) present in Natal. J. S. Afr. Vet. Med. Assoc. 21, 18–26. Kudo, H., Uyeda, I., Shikata, E., 1991. Viruses in the phytoreovirus genus of the Reoviridae family have the same conserved terminal sequences. J. Gen. Virol. 72, 2857–2866. Kuntz-Simom, G., Le Gall-Recule´, G., de Boisse´son, C., Jestin, V., 2002. Muscovy duck reovirus sC protein is atypically encoded by the smallest genome segment. J. Gen. Virol. 83, 1189–1200. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Liu, H.J., Lee, L.H., Hsu, H.W., Kuo, L.C., Liao, M.H., 2003. Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages. Virology 314, 336–349. Liu, Q., Zhang, G., Huang, Y., Ren, G., Chen, L., Gao, J., Zhang, D., Han, B., Su, W., Zhao, J., Hu, X., Su, J., 2011. Isolation and characterization of a reovirus causing spleen necrosis in Pekin ducklings. Vet. Microbiol. 148, 200–206. Ma, G.M., Wang, D., Shi, J.J., Jiang, T.T., Yuan, Y., Zhang, D.B., 2012. Complete genomic sequence of a reovirus isolate from Pekin ducklings in China. J. Virol. 86, 13137. Maan, S., Rao, S., Maan, N.S., Anthony, S.J., Attoui, H., Samuel, A.R., Mertens, P.P., 2007. Rapid cDNA synthesis and sequencing techniques for the genetic study of bluetongue and other dsRNA viruses. J. Virol. Methods 143, 132–139. Malkinson, M., Perk, K., Weisman, Y., 1981. Reovirus infection of young Muscovy ducks (Cairina moschata). Avian Pathol. 10, 433–440. Marius-Jestin, V., Lagadic, M., Le Menec, Y., Bennejean, G., 1988. Histological data associated with Muscovy duck reovirus infection. Vet. Rec. 123, 32–33. Mattion, N.M., Mitchell, D.B., Both, G.W., Estes, M.K., 1991. Expression of rotavirus proteins encoded by alternative open reading frames of genome segment 11. Virology 181, 295–304. Mertens, P.P., Arella, M., Attoui, H., Belloncik, S., Bergoin, M., Boccardo, G., Booth, T.F., Chiu, W., Diprose, J.M., et al., 2000. Reoviridae. In: Van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E., Estes, M.K., Lemon, S., McGeoch, D., Wickner, R.B., Mayo, M.A., Pringle, C.R., Maniloff, J. (Eds.), Virus Taxonomy: Seventh Report of the International Committee on Taxonomy of Viruses. Elsevier/Academic Press, pp. 395–435. Mertens, P.P.C., Sangar, D.V., 1985. Analysis of the terminal sequences of the genome segments of four orbiviruses. Virology 140, 55–67.

T. Yun et al. / Veterinary Microbiology 168 (2014) 261–271 Mohd Jaafar, F., Goodwin, A.E., Belhouchet, M., Merry, G., Fang, Q., Cantaloube, J.F., Biagini, P., de Micco, P., Mertens, P.P., Attoui, H., 2008. Complete characterization of the American grass carp reovirus genome (genus Aquareovirus: family Reoviridae) reveals an evolutionary link between aquareoviruses and coltiviruses. Virology 373, 310–321. Nick, H., Cursiefen, D., Becht, H., 1975. Structural and growth characteristics of two avian reoviruses. Arch. Virol. 48, 261–269. Noad, L., Shou, J., Coombs, K.M., Duncan, R., 2006. Sequences of avian reovirus M1, M2 and M3 genes and predicted structure/function of the encoded m proteins. Virus Res. 116, 45–57. Okuno, Y., Igarashi, A., Fukunaga, T., Tadano, M., Fukai, K., 1984. Electron microscopic observation of a newly isolated flavivirus-like virus from field-caught mosquitoes. J. Gen. Virol. 65, 803–807. Olson, N.O., Weiss, R., 1972. Similarity between arthritis virus and Fahey Crawley virus. Avian Dis. 16, 535–540. Palya, V., Gla´vits, R., Dobos-Kova´cs, M., Ivanics, E., Nagy, E., Ba´nyai, K., Reuter, G., Szu¨cs, G., Da´n, A., Benko¨, M., 2003. Reovirus identified as cause of disease in young geese. Avian Pathol. 32, 129–138. Pascucci, S., Gelmetti, D., Giovanetti, L., 1984. Reovirus infection of Muscovy ducks (Cairina moschata). Clin. Vet. 107, 148–151. Patton, J.T., 2001. Rotavirus RNA replication and gene expression. Novartis Found. Symp. 238, 64–77. Potgieter, A.A., Page, N.A., Liebenberg, J., Wright, I.M., Landt, O., Dijk, A.A., 2009. Improved strategies for sequence-independent amplification and sequencing of viral double-stranded RNA genomes. J. Gen. Virol. 90, 1423–1432. Ritter, G.D., Ley, D.H., Levy, M., Guy, J., Barnes, H.J., 1986. Intestinal cryptosporidiosis and reovirus isolation from bobwhite quail (Colinus virginianus) with enteritis. Avian Dis. 30, 603–608. Rosenberger, J.K., Sterner, F.J., Botts, S., Lee, K.P., Margolin, A., 1989. In vitro and in vivo characterization of avian reoviruses I. Pathogenicity and antigenic relatedness of several avian reovirus isolates. Avian Dis. 33, 535–544. Simmons, D.G., Colwell, W.M., Muse, K.E., Brewer, C.E., 1972. Isolation and characterization of an enteric reovirus causing high mortality in turkey poults. Avian Dis. 16, 1094–1102. Spandidos, D.A., Graham, A.F., 1976. Physical and chemical characterization of an avian reovirus. J. Virol. 19, 968–976. Stenger, D.C., Sisterson, M.S., Krugner, R., Backus, E.A., Hunter, W.B., 2009. A new Phytoreovirus infecting the glassy-winged sharpshooter (Homalodisca vitripennis). Virology 386, 469–477.

271

Su, Y.P., Su, B.S., Shien, J.H., Liu, H.J., Lee, L.H., 2006. The sequence and phylogenetic analysis of avian reovirus genome segments M1 M2, and M3 encoding the minor core protein mA, the major outer capsid protein mB, and the nonstructural protein mNS. J. Virol. Methods 133, 46–157. Suzuki, N., Sugawara, M., Nuss, D.L., Matsuura, Y., 1996. Polycistronic trior bicistronic phytoreoviral segments translatable in both plant and insect cells. J. Virol. 70, 8155–8159. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Vindevogel, H., Meulemans, G., Pastoret, P.P., Schwers, A., CalbergBacq, C., 1982. Reovirus infection in the pigeon. Ann. Rech. Ve´t. 13, 149–152. Wang, D., Shi, J.J., Yuan, Y., Zheng, L.S., Zhang, D.B., 2013. Complete sequence of a reovirus associated with necrotic focus formation in the liver and spleen of Muscovy ducklings. Vet. Microbiol. 166, 109–122. Wang, D., Xu, F., Ma, G.M., Zhang, C., Huang, Y., Li, H.R., Zhang, D.B., 2012. Complete genomic sequence of a new Muscovy duck-origin reovirus from China. J. Virol. 86, 12445. Wu, B., Chen, J., Yao, J., 2001. Pathogenicity of Muscovy duck reovirus isolate B3. Chin. J. Prev. Vet. Med. 23, 422–426. Xu, Z.K., Anzola, J.V., Nalin, C.M., Nuss, D.L., 1989. The 30 -terminal sequence of a wound tumor virus transcript can influence conformational and functional properties associated with the 50 -terminus. Virology 170, 511–522. Xu, W., Coombs, K.M., 2008. Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNAdependent RNA polymerase protein. Virol. J. 5, 153. http:// dx.doi.org/10.1186/1743-422X-5-153. Yun, T., Ye, W.C., Ni, Z., Chen, L., Yu, B., Hua, J., Zhang, Y., Zhang, C., 2012. A Complete genomic sequence of goose-origin reovirus from China. J. Virol. 86, 10257. Zhang, Y., Guo, D.C., Geng, H.W., Liu, M., Hu, Q.L., Wang, J.W., Tong, G.Z., Kong, X.G., Liu, N.H., Liu, C.G., 2007. Characterization of M-class genome segments of Muscovy duck reovirus S14. Virus Res. 125, 42–53.