Neuroscience 275 (2014) 365–373
GENIPIN IS ACTIVE VIA MODULATING MONOAMINERGIC TRANSMISSION AND LEVELS OF BRAIN-DERIVED NEUROTROPHIC FACTOR (BDNF) IN RAT MODEL OF DEPRESSION Q.-S. WANG, a,b J.-S. TIAN, a,c Y.-L. CUI a* AND S. GAO a
increased in genipin-treated rats compared to the CUMSexposed model group. Moreover, the levels of corticosterone in serum were decreased by genipin-treated compared to the CUMS-exposed model group. These results suggest that the possible mechanism of antidepressant-like effects on genipin, at least in one part, resulted from monoaminergic neurotransmitter system and the potential dysfunctional regulation of the post-receptor signaling pathway, which particularly affected the 5-HT1AR, 5-HT2AR and BDNF levels in the hippocampus. Ó 2014 IBRO. Published by Elsevier Ltd. All rights reserved.
a
Tianjin State Key Laboratory of Modern Chinese Medicine, Research Center of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin 300193, PR China b Institute of Medical Equipment, Academy of Military Medical Sciences, Tianjin 300161, PR China c
Modern Research Center for Traditional Chinese Medicine of Shanxi University, Taiyuan 030006, PR China
Abstract—Genipin, an important bioactive component from Gardenia jasminoides Eills, was demonstrated to possess antidepressant-like effects in a previous study. However, the molecular mechanism of antidepressant-like effects on genipin was not clear. The present study aimed to investigate the possible mechanism of antidepressant-like effects on genipin with a chronic unpredictable mild stress (CUMS)induced depression model in rats. In CUMS-induced depressive rats, bodyweight and 1% sucrose consumption decreased significantly compared with the normal control group. Furthermore, these changes could be significantly reversed by genipin application. The levels of 5-hydroxytryptamine (5-HT), norepinephrine (NE) in the hippocampus decreased and the level of 5-hydroxyindole acetic acid (5-HIAA) increased in the CUMS-induced depressive rats. However, pre-treatments with genipin significantly increased the levels of 5-HT, NE and decreased the level of 5-HIAA in the hippocampus. The concentration of cAMP in the hippocampus was increased by genipin compared to the CUMSexposed model group. The mRNA expressions of 5-hydroxytryptamine 1A receptor (5-HT1AR), cAMP response element binding protein (CREB) and brain-derived neurotrophic factor (BDNF) in rats were decreased exposed to CUMS, which were reversed by genipin-treated rats exposed to CUMS. Compared to the CUMS-exposed model group, the mRNA expression of 5-hydroxytryptamine 2A receptor (5-HT2AR) was decreased significantly by genipin-treated rats. The mRNA and protein expression of CREB, BDNF were
Key words: genipin, antidepressant, brain-derived neurotrophic factor, chronic unpredictable mild stress, serotonin.
INTRODUCTION Major depressive disorder is a chronic, recurring and potentially life-threatening illness that affects up to 17% of the population worldwide. The affective, behavioral and cognitive symptoms of depression are mainly manifested by either a dysphonic mood or a loss in pleasure or interest (Yoko et al., 2011). In recent decades, the number of patients with depression has dramatically increased and the discovery or development of novel antidepressants is urgently needed. Currently, the treatment for depression mainly consists of chemical drugs, including tricyclic antidepressants (TCAs), selective norepinephrine reuptake inhibitors (SSRIs), monoamine oxidase inhibitors (MAOIs), norepinephrine reuptake dual inhibitors (NARIs) and selective norepinephrine reuptake inhibitors (SNRIs). However, these drugs failed to work for 30% patients, and undesirable side effects were observed in clinical practice (Kennedy and Rizvi, 2009). Since the earliest days of humankind, herbal medicines have been the basis of health care worldwide. Even in developed countries, patients rely on medicinal plants and herbal medicines for primary care. In Germany, herbal medicines are fully recognized as medicines, whereas most herbal products in the U.S.A. are regarded as foods or food supplements. In China and other oriental countries, natural plants, such as Rehmannia glutinosa Libosch, Eucommia ulmoides Oliver, Scrophularia ningpoensis Hemsl and Gardenia jasminoides Eills are widely used as herbal medicines or medicinal supplements for many years (Ranalli et al., 2006).
*Corresponding author. Address: Research Center of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, No. 88 YuQuan Road, Nankai District, Tianjin 300193, PR China. Tel: +86-22-59596170. E-mail address: [email protected] (Y.-L. Cui). Indicates equal contribution. Abbreviations: 5-HT, 5-hydroxytryptamine; 5-HIAA, 5-hydroxyindole acetic acid; 5-HT1AR, 5-Hydroxytryptamine 1A receptor; 5-HT2AR, 5-Hydroxytryptamine 2A receptor; BDNF, brain-derived neurotrophic factor; CREB, cAMP response element binding protein; CUMS, chronic unpredictable mild stress; EDTA, ethylenediaminetetraacetic acid; FST, forced swimming test; NE, norepinephrine; TST, tail suspension test. http://dx.doi.org/10.1016/j.neuroscience.2014.06.032 0306-4522/Ó 2014 IBRO. Published by Elsevier Ltd. All rights reserved. 365
366
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
G. jasminoides Ellis is an evergreen shrub that is mostly distributed in the southern regions of China. The dried ripe fruit of this plant is known as Fructus Gardeniae (Chinese herbal name ‘‘Zhi-Zi’’) in Chinese Pharmacopoeia (Li et al., 2013), which was used for the treatment of deficient dysphoria, conjunctival congestion, hemorrhage, pathopyretic ulcer, swelling, sprain, pain and coronary artery disease (Gao and Zhu, 2013). Genipin, the aglycone of geniposide, is extracted from the fruit of G. jasminoides Ellis, and the chemical structure is shown in Fig. 1. Genipin has been shown to exhibit various bioactivities, such as neuroprotective, antiinflammatory, anti-tumor and choleretic effects (Koo et al., 2004; Lee et al., 2006; Ding et al., 2013). Moreover, our previous study reported the antidepressant-like effects of genipin in forced swimming test (FST) and tail suspension test (TST) in mice (Tian et al., 2010). In the present study, further investigation of the antidepressant effects and potential mechanisms of genipin in chronic unpredictable mild stress (CUMS) rats was performed. Alterations in monoaminergic systems are associated with the mechanisms of action underlying the favorable treatment of antidepressant drugs (Duman and Voleti, 2012; Zheng et al., 2013). Specifically, 5-Hydroxytryptamine (5-HT) has been considered as one of the major neurochemical systems in the brain which is dysregulated expression in affective disorders. The 5-hydroxytryptamine 1A receptor (5-HT1AR) and 5-hydroxytryptamine 2A receptor (5-HT2AR) are the two important receptors related to depression (Perez-Caceres et al., 2013). Brain-derived neurotrophic factor (BDNF) is a type of nerve growth factor related to the survival and maintenance of neuronal function. Changing of BDNF expression plays an essential role in the initiative recovery of depression (Haghighi et al., 2013). Furthermore, the mRNA expression of BDNF could be affected by antidepressants via the regeneration and promotion of damaged hippocampal neurons (Cortes-Mendoza et al., 2013). For example, Ginseng Total Saponins, the major bioactive component of Panax ginseng, exhibits an antidepressant-like effect in FST and CUMS models of depression
by the alteration of BDNF expression in rat hippocampi (Xu et al., 2006; Dang et al., 2009). In this study, the possible mechanism of antidepressant-like effects on genipin was investigated in the CUMS-induced depressive rats by determining the levels of monoamines and the mRNA expression of 5-HT1AR, 5-HT2AR and BDNF in the hippocampus.
EXPERIMENTAL PROCEDURES Drugs and reagents Genipin (98% purity) was purchased from WAKO (Osaka, Japan). Fluoxetine hydrochloride capsules (Eli Lilly and Company, Indianapolis, IN, USA) were prescribed from the first affiliated hospital of Tianjin University of Traditional Chinese Medicine. Parameter Cyclic AMP Assay Kit and DuoSet IC Phospho-CREB (S133) ELISA Kit were purchased from R & D Systems, Inc. (Minneapolis, MN, USA). ImProm-II Reverse Transcription System kit was bought from Promega Corporation (Madison, WI, USA). SYBR Green JumpStart Taq ReadyMix was bought from Sigma– Aldrich Co. (St Louis, MO, USA). UNIQ-10 column Trizol total RNA extraction kit was bought from Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). The FlexStation 3 microplate reader (Molecular Devices Co., Sunnyvale, CA, USA) and Prism 7500 Real-Time PCR System (Applied Biosystems Inc., Foster City, CA, USA) were used. All chemical agents were of ACS or analytical grade. Animals and drug administration Male Sprague Dawley rats, weighing 180–200 g (Beijing Vital Laboratory Animal Technology Company, Beijing), were used. The animals were maintained on a natural day–night cycle with ad libitum access to food and water. Ambient temperature and relative humidity were maintained at 24 ± 1 °C and 55 ± 5%, respectively. The rats were acclimatized for at least 1 week prior to the CUMS procedure. All of the experiments were performed between 9:00 a.m. to 3:00 p.m. In this study, the procedures were performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals. Genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) were resuspended in water and administered to the rats during the last seven days of the CUMS procedure. Saline was used as vehicle controls. CUMS procedure
Fig. 1. The chemical structure and biotransformation procedure of geniposide into genipin.
CUMS is an experimental procedure in which the rats are chronically exposed to variable unpredictable mild stressors to induce depression (Willner et al., 1987; Herrera et al., 2006). Prior to the start of the CUMS procedure, all of the rats were given 1% sucrose water for 24 h to avoid neophobia for sucrose consumption training. After completion of the training, the rats were randomly divided into six groups (12 rats per group). The rats were then exposed to the CUMS procedure for 3 weeks and treated with fluoxetine (7.5 mg/kg), genipin (25, 50 and 100 mg/kg) or saline (model group) in the last week
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
except for the control group. The CUMS procedure consisted of a variety of unpredictable mild stressors, including 5-min forced swimming in 4 °C cold water, 24-h food deprivation, 24-h water deprivation, 10-min hot environment (45 °C), 2-min tail pinch (1 cm from the beginning of the tail), foot shock (36 V, 10 s for each time, and 15 times for once) and 2-min oscillation. These stressors were randomly performed from 9:00 to 12:00 in the morning, and the body weight and sugar consumption of the rats were recorded. Open-field test The number of crossings and rearings was used to assess locomotor activity. This test was modified from a previously described method and performed between 8:00 a.m. to 12:00 a.m. in a quiet room (Mao et al., 2008). The open-field apparatus consisted of a square arena (100 cm 100 cm 50 cm) with a floor divided into 25 equal-sized squares with grids. Each rat was placed in the center of the apparatus and was observed for 5 min. The number of crossings and rearings made by the animal within the last 4 min was recorded. The apparatus was then cleaned using a detergent and dried following each test. Serum and hippocampus collection After the last drug administration and locomotor activity measurement, all of the rats were sacrificed following a 10-min anesthesia. Blood samples were immediately collected, and the serum was obtained by centrifugation at 3000g for 10 min. The bilateral hippocampi were quickly removed from the brain and put into labeled tubes. After a quick-freeze in liquid nitrogen for 15 min, the serum and hippocampi were stored in a freezer at 80 °C for further analyses. Determination of monoamines and its metabolites in the hippocampus A specific volume of ice-cold 0.1 M perchloric acid was added to the hippocampi-containing tubes. Hippocampi were then homogenized for 30 s and the homogenate was centrifuged at 13,000g for 20 min at 4 °C. Twenty microliters of the resultant supernatant was injected into the HPLC instrument. The HPLC-ECD conditions were as follows: Waters Symmetry C18 column (150 mm 3.9 mm, 5 lm); the mobile phase was 19% methanol, 3% acetonitrile and 78% phosphate buffer, where the buffer consisted of 0.1 M KH2PO4, 0.01 M OSA (Octanesulfonic acid), 0.1 mM EDTA (pH: 3.6). The column temperature was at 35 °C and the flow rate was 1.0 mL/min. The detector was set at a potential of +0.7 V using an Ag/AgCl reference electrode.
367
at 4 °C. The resultant supernatant was obtained, and the optical density (OD) value was recorded to measure the concentration of cAMP using a commercial ELISA kit (R&D Systems, Inc., Minneapolis, MN, USA). The assays were performed in duplicate, and the cAMP values were normalized to the level of total protein. Measurement of Phospho-CREB and BDNF protein levels in the hippocampus Hippocampi were homogenized in a cell lysis buffer solution according to the manufacturer0 s instructions from the ELISA kit. Moreover, the determination of total protein was performed using a BCA Protein Assay Kit (Thermo Scientific, Rockford, IL, USA). The results were determined using a FlexStation 3 microplate reader and the data were corrected with total protein concentrations to calculate the content of Phospho-CREB and BDNF protein. Furthermore, the relative concentration was expressed as per microgram of total protein in the tissue. Real-time RT-PCR assays for 5-HT1AR, 5-HT2AR, CREB and BDNF mRNA expression in the hippocampus The mRNA expression of 5-HT1AR, 5-HT2AR, CREB and BDNF were determined using Real-time RT-PCR. Total RNA was isolated using an UNIQ-10 column Trizol total RNA extraction kit according to the manufacturer0 s instructions. RNA (1 lg) was reverse transcribed using an ImProm-II Reverse Transcription System cDNA synthesis kit. The real-time RT-PCR oligonucleotide primers used were listed in Table 1. The reactions were setup as duplicates in a total volume of 25 lL, which consisted of 1 lL of each primer (0.3 lM final concentrations), 12.5 lL of SYBR Green JumpStart Taq ReadyMix, and 1 lL of template. The PCR cycle was performed as follows: 94 °C for 2 min, 40 cycles of 94 °C for 15 s, 60 °C for 1 min, and 72 °C for 1 min, and a melting curve analysis was performed at the end of each experiment to verify that a single product per primer pair was amplified. The samples were compared using the relative CT method. The fold increase or decrease was determined relative to a blank control after normalizing to a housekeeping gene using DDC 2 (Livak and Schmittgen, 2001; Gois and Schafer, T 2005). Determination of corticosterone levels in serum Serum corticosterone levels were measured using a Corticosterone EIA Kit (Cayman Chemical Company, Ann Arbor, MI, USA) according to the manufacturer0 s instructions. The sensitivity of the measurement was 45.3 pg/mL. The intra- and inter-assay coefficients of variations were 10% and 14%, respectively.
Measurement of cAMP concentration in the hippocampus
Statistical analysis
The frozen hippocampi were thawed at room temperature, then rinsed with physiological saline quickly and homogenized for 30 s in Cell Lysis Buffer. The homogenate was centrifuged at 13,000g for 5 min
Statistical analyses were performed with Origin 8.0 software (MicroCal, USA) and all results were expressed as means ± SEM. Statistically significant differences between groups was determined by a
368
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
Table 1. Real-time RT-PCR oligonucleotide primers Gene
Primer
Sequence(50 –30 )
PCR product (bp)
GAPDH (NM_017008.4) CREB (NM_134443.1) BDNF (NM_001270630.1) 5-HT1AR (NM_012585.1) 5-HT2AR (NM_017254.1)
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
AGACAGCCGCATCTTCTTGT TGATGGCAACAATGTCCACT ACCAGCAGAGTGGAGATGCT TACAGTGGGAGCAGATGACG AGCTGAGCGTGTGTGACAGT ACCCATGGGATTACACTTGG CCGCACGCTTCCGAATCC TGTCCGTTCAGGCTCTTCTTG AACGGTCCATCCACAGAG AACAGGAAGAACACGATGC
142
One-Way Analysis of Variance (ANOVA). The criterion for statistical significance was P < 0.01 or P < 0.05.
RESULTS Effects of genipin on body weight As shown in Fig. 2A, body weight was measured at the beginning of the experiment and at 7-day intervals thereafter. At the beginning of the experiment (Day 0), there were no significant differences in body weight among the six groups. During the stress sessions, the stressed groups did not gain weight as quickly as the
134 161 109 109
control group. After 2 weeks of drug treatment with exposure to the stressor, the body weight of the model group was significantly lower than that of the normal control group (P < 0.01). After treatment with genipin (25 and 50 mg/kg) or fluoxetine (7.5 mg/kg) in the last week, the body weights increased significantly compared to the model group (P < 0.05). The body weights had increased in the control group compared to CUMS-treated groups (P < 0.05). Effects of genipin on sucrose consumption The consumption of 1% sucrose was measured four times during the CUMS procedure (Fig. 2B). At the beginning of the experiment (Day 0), there was no significant difference among the six groups. After 2 weeks (Day 14), the sucrose consumption of stressed rats was significantly lower than that of the control group. The sucrose consumption of stressed rats treated for 1 week with genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) increased significantly (P < 0.01) compared to CUMS-treated groups. Effects of genipin on locomotor activity A 3-week period of CUMS exposure resulted in a significant reduction in the number of crossings and rearings compared to the control group. In addition, the 1-week treatment with genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) significantly increased the number of crossings and rearings compared to CUMStreated groups (P < 0.01 or P < 0.05) (Table 2). Effects of genipin on the levels of monoamines and its metabolites
Fig. 2. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on body weight (A) and 1% sucrose consumption (B). The values were expressed as the means ± SEM (n = 8). #P < 0.05, ##P < 0.01 compared vs. control; ⁄P < 0.05, ⁄⁄ P < 0.01 compared vs. model.
As shown in Table 3, the concentration of norepinephrine (NE) and 5-HT was reduced, while the level of 5-hydroxyindole acetic acid (5-HIAA) was increased significantly after the 3-week CUMS procedure compared to CUMS-treated groups (P < 0.05). The concentration of NE and 5-HT increased significantly after the administration of genipin (25, 50 and 100 mg/ kg) or fluoxetine (7.5 mg/kg). On the contrary, the concentration of 5-HIAA tended to decrease after the administration of genipin (25, 50 and 50 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups.
369
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373 Table 2. Effects of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on the number of crossings and rearings in the OFT Groups
Dose (mg/kg)
Number of crossings
Number of rearings
Control Model Fluoxetine Genipin
– –
55.8 ± 3.9 23.6 ± 5.0## 41.3 ± 5.1** 40.5 ± 3.7** 43.3 ± 6.7** 32.7 ± 4.5*
17.8 ± 2.8 6.2 ± 4.9## 15.8 ± 1.7* 13.5 ± 2.1* 15.3 ± 3.1** 11.6 ± 2.6*
7.5 25 50 100
The values were expressed as the means ± SEM (n = 8). ## P < 0.01 compared vs. control; * P < 0.05, ** P < 0.01 compared vs. model.
Table 3. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on monoamine neurotransmitters in rats Groups
Dose (mg/kg)
Control Model Fluoxetine Genipin
– – 7.5 25 50 100
Hippocampus (ng/g) NE
5-HT
5-HIAA
414.79 ± 101.81 243.22 ± 51.84## 479.41 ± 194.27** 402.89 ± 91.96** 370.72 ± 111.66* 512.62 ± 77.42**
142.31 ± 32.68 89.73 ± 25.16# 131.10 ± 40.91* 120.43 ± 39.62* 155.31 ± 36.30** 171.33 ± 30.34**
288.35 ± 71.91 456.11 ± 83.11## 111.84 ± 37.04** 307.24 ± 85.02** 332.95 ± 67.71** 379.15 ± 66.06*
Values were expressed as the means ± SEM (n = 8). # P < 0.05, ## P < 0.01 compared vs. control; * P < 0.05, ** P < 0.01 compared vs. model.
Effects of genipin on the mRNA expression of 5-HT1AR and 5-HT2AR The mRNA expression of 5-HT1AR and 5-HT2AR in the hippocampus are shown in Fig. 3. There was a significant decrease in 5-HT1AR and an increase in 5-HT2AR expression in the CUMS group compared to control group (P < 0.05). The mRNA expression of 5-HT1AR was increased and the expression of 5-HT2AR was inhibited significantly after the administration of genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups (P < 0.01 or P < 0.05). Effects of genipin on cAMP concentration Cyclic AMP is one key second messenger in several signal transduction pathways. In this study, the concentration of cAMP in the hippocampi was determined. As shown in Fig. 4, the cAMP concentration in CUMS-treated groups was significantly decreased compared to the control group. However, the concentration of cAMP increased significantly by genipin (100 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups (P < 0.01 or P < 0.05). Effects of genipin on Phospho-CREB protein and CREB mRNA expression Phospho-CREB protein and CREB mRNA expression were examined, and the results are shown in Fig. 5. The level of Phospho-CREB protein was downregulated in CUMS-treated groups. Although the levels
of Phospho-CREB protein were up-regulated when slightly treated with genipin or fluoxetine, there was no significance compared to CUMS-treated groups (P > 0.05). In addition, CREB mRNA expression was decreased in CUMS-treated groups. Moreover, the mRNA expression of CREB was increased significantly when treated with genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups (P < 0.01 or P < 0.05). Effects of genipin on BDNF protein and mRNA expression The mRNA and protein expression of BDNF in the hippocampus are shown in Fig. 6. The mRNA expression of BDNF decreased significantly in CUMS-treated groups compared to the control group (P < 0.05). Genipin (25 mg/kg) could up-regulate the mRNA expression of BDNF significantly compared to CUMS-treated groups (P < 0.01). The protein expression of BDNF protein was also investigated and the result showed that the protein expression of BDNF was increased significantly treating with genipin (25 mg/kg) compared to CUMS-treated groups. The protein expression of BDNF was increased significantly by genipin compared to CUMS-treated groups, which was coincidence with the mRNA expression of BDNF. Effects of genipin on corticosterone levels Fig 7 shows that plasma corticosterone levels in the CUMS-exposed model group were significantly higher
370
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
Fig. 3. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on 5-HT1AR (A) and 5-HT2AR mRNA expression (B). Values were expressed as the means ± SEM (n = 8). #P < 0.05, ##P < 0.01 compared vs. control; ⁄P < 0.05, ⁄⁄ P < 0.01 compared vs. model.
Fig. 5. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on CREB mRNA (A) and CREB protein expression (B). Values were expressed as the means ± SEM (n = 8). #P < 0.05 compared vs. control; ⁄P < 0.05 compared vs. model.
than those in the control group (P < 0.05). However, plasma corticosterone levels decreased significantly (P < 0.05) when the rats were treated with genipin (25 mg/kg) or fluoxetine (7.5 mg/kg).
DISCUSSION
Fig. 4. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on cAMP content. Values were expressed as the means ± SEM (n = 8). #P < 0.05 compared vs. control; ⁄P < 0.05 compared vs. model.
In addition to the FST and TST, the CUMS model was also playing an important role in the scientific screening and evaluation of antidepressants in animal models of depression (Willner, 1984). In the present study, CUMSinduced depression model was used to investigate the possible mechanism of antidepressant-like effects on genipin. Depressive disorder is associated with disturbances of brain monoamine neurotransmitters. Monoamines and their metabolite levels would change significantly in CUMS-induced depression model. The hippocampus plays important roles in learning and memory and has been considered as the subject of numerous studies for investigating the pathophysiology of depression (Bianchi et al., 2009). In CUMS-induced depression model, genipin could increase the concentration of NE and 5-HT in rat hippocampi. 5-HT1AR is currently the best-characterized
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
Fig. 6. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on BDNF mRNA (A) and BDNF protein expression (B). Values were expressed as the means ± SEM (n = 8). #P < 0.05 or ##P < 0.01 compared vs. control; ⁄P < 0.05 or ⁄⁄P < 0.01 compared vs. model.
Fig. 7. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on serum corticosterone levels. Values were expressed as the means ± SEM (n = 8). #P < 0.05 or ## P < 0.01 compared vs. control; ⁄P < 0.05 or ⁄⁄P < 0.01 compared vs. model.
371
receptor subtype of 5-HT receptor subtypes, and it was demonstrated that its affinity with 5-HT, which has higher expression compared to other receptors (Gao et al., 2013). Moreover, 5-HT1AR also showed a reduction in immobility in the FST in knockout mice (Hensler, 2003), indicating that 5-HT1AR might be associated with the pathogenesis of depression. Furthermore, 5-HT2AR represents another subtype receptor which gained considerable interest, and the tendency was the opposite of the 5-HT1A receptor. The results showed that the 5-HT1AR mRNA expression was down-regulated, and the level of 5-HT2AR mRNA expression was up-regulated in CUMStreated groups. Genipin could reverse the mRNA expression of 5-HT1AR and 5-HT2AR at a dose of 25 mg/kg. This indicates that the central monoaminergic neurotransmitter system might be implicated in the antidepressant-like effects of genipin. Although the mRNA expression of 5-HT1AR was upregulated and the mRNA expression of 5-HT2AR was down-regulated by genipin, there was no dosedependent behavior. It might be related to the intestinal absorption mechanisms of genipin involved of P-glycoprotein (Pgp). Pgp is an ATP-dependent efflux pump and Pgp ATPase activity plays an important role in the mechanisms of Pgp inhibition. Verapamil, a known substrate of Pgp, could stimulate Pgp ATPase activity. Genipin alone could stimulate the basal Pgp ATPase activity and inhibited the verapamil-stimulated Pgp ATPase activity. Our previous study showed that genipin was a substrate of Pgp and competitively interacted at the drug-binding site of Pgp, which might be the reason for its low bioavailability (Zhang et al., 2011). The efflux of genipin by Pgp was not saturated as the lower bioavailability at 100 mg/kg than that at 50 or 25 mg/kg. The high bioavailability of genipin was mainly controlled by passive diffusion at low dose (25 mg/kg), and the low bioavailability was mainly affected by Pgp efflux function at high dose (100 mg/kg). Therefore, the regulation of Pgp might be the reason that the higher dose (100 mg/kg) of genipin was not more effective than that of the lower dose (25 mg/kg). BDNF, known as the regulator of neuronal survival, fast synaptic transmission and activity-dependent synaptic plasticity (Chuang et al., 2011), is one of the best-characterized functional growth factors in the field of neuroscience. The expression levels of frontal and hippocampal BDNF are up-regulated by sub-chronic lamotrigine treatment in both naive and stressed animals (Li et al., 2010). BDNF protein expression could be elevated by ginsenoside Rb3 (Rb3) at the tested doses in a chronic mild stress model (Cui et al., 2012). Moreover, it was reported that levels of BDNF decreased in the hippocampus in some patients with depression, but this was not observed in depressed patients treated with antidepressants (Chen et al., 2001). Thus, BDNF is one of major candidate targets for the treatment of antidepressant response. In the present study, the mRNA and protein expression of BDNF was increased significantly by genipin in the CUMS-induced depression model. These findings suggest that genipin might generate
372
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
antidepressant-like effects via increasing the BDNF level in the hippocampus. CREB is a transcription activator that has a critical role in both stress (Hatalski and Baram, 1997) and antidepressant-induced transcriptional regulation (Conti et al., 2002). There are relevant literature studies showing that CREB was altered in response to antidepressant treatments (Blendy, 2006). It was reported that the activities of the CREB in the hippocampus and prefrontal cortex in rats could disrupt depressive-like behaviors after receiving chronic forced swim stress. Furthermore, the reduction of CREB activity in both regions and the depressive-like behaviors exhibited in stressed rats could be reversed by fluoxetine treatment (Qi et al., 2008). In our present study, the protein expression of Phospho-CREB was not changed significantly by genipin, but the mRNA expression of CREB was up-regulated by genipin in the CUMS-induced depression model. In addition, glucocorticoid (cortisol in humansor corticosterone in rodents) release is governed by the HPA axis. The release of glucocorticoids such as cortisol, increased by the hyperactivity of the HPA axis, could damage hippocampal neurons and produce cognitive impairment in depressed patients. (Kulkarni and Dhir, 2009). It has been reported that the levels of corticosterone were elevated in chronic mild stress rats (Grippo et al., 2005). The present study found that the plasma corticosterone levels decreased significantly when the rats were treated with genipin (25 mg/kg). Therefore, the regulation of the plasma corticosterone levels in rats achieved by genipin treatment may help to elucidate the role of the HPA axis in the antidepressantlike effects of genipin.
CONCLUSION In conclusion, the possible mechanism of antidepressantlike effects on genipin was interacted with the serotonergic (5-HT1A and 5-HT2A receptors) and monoaminergic neurotransmitter system as well as the elevation of 5-HT and NA levels in the rat brain. Moreover, the regulation of BDNF by genipin played a role in a possible mechanism of antidepressant-like effects. Acknowledgments—This work was supported by the National Natural Science Foundation of China (Nos. 81173469 and 81102833), the Program of Science and Technology of Shanxi Province (No. 2012021031-2) and the Specialized Research Fund for the Doctoral Program of Higher Education (No. 20131210110008).
REFERENCES Bianchi M, Fone KC, Shah AJ, Atkins AR, Dawson LA, Heidbreder CA, Hagen JJ, Marsden CA (2009) Chronic fluoxetine differentially modulates the hippocampal microtubular and serotonergic system in grouped and isolation reared rats. Eur Neuropsychopharmacol 19:778–790. Blendy JA (2006) The role of CREB in depression and antidepressant treatment. Biol Psychiatry 59:1144–1150.
Chen B, Dowlatshahi D, MacQueen GM, Wang JF, Young LT (2001) Increased hippocampal BDNF immunoreactivity in subjects treated with antidepressant medication. Biol Psychiatry 50:260–265. Chuang CY, Shi YC, You HP, Lo YH, Pan TM (2011) Antidepressant effect of GABA-rich monascus-fermented product on forced swimming rat mode. J Agric Food Chem 59:3027–3034. Conti AC, Cryan JF, Dalvi A, Lucki I, Blendy JA (2002) CAMP response element-binding protein is essential for the upregulation of brain-derived neurotrophic factor transcription, but not the behavioural or endocrine responses to antidepressant drugs. J Neurosci 22:3236–3268. Cortes-Mendoza J, de Leon-Guerrero SD, Pedraza-Alva G, PerezMartinez (2013) Shaping synaptic plasticity: the role of activitymediated epigenetic regulation on gene transcription. Int J Dev Neurosci 31:359–369. Cui J, Jiang L, Xiang H (2012) Ginsenoside Rb3 exerts antidepressant-like effects in several animal models. J Psychopharmacol 26:697–713. Dang HX, Chen Y, Liu XM (2009) Antidepressant effects of ginseng total saponins in the forced swimming test and chronic mild stress models of depression. Prog Neuro-Psychoph 33:1417–1424. Ding Y, Hou JW, Zhang Y, Zhang LY, Zhang T, Chen Y, Cai ZZ, Yang L (2013) Metabolism of genipin in rat and identification of metabolites by using Ultraperformance Liquid Chromatography/ Quadrupole Time-of-Flight Tandem Mass Spectrometry. Evid Based Complement Altern Med 2013:957030. Duman RS, Voleti B (2012) Signaling pathways underlying the pathophysiology and treatment of depression: novel mechanisms for rapid-acting agents. Trends Neurosci 35:47–56. Gao L, Zhu BY (2013) The accumulation of crocin and geniposide and transcripts of phytoene synthase during maturation of Gardenia jasminoides fruit. Evid Based Complement Altern Med 2013:686351. Gao S, Cui YL, Yu CQ, Wang QS, Zhang Y (2013) Tetrandrine exerts antidepressant-like effects in animal models: role of brain-derived neurotrophic factor. Behav Brain Res 238:79–85. Gois DS, Schafer MK (2005) Homeostatic scaling of vesicular glutamate and GABA transporter expression in rat neocortical circuits. J Neurosci 25:7121–7133. Grippo AJ, Francis J, Beltz TG, Felder RB, Johnson AK (2005) Neuroendocrine and cytokine profile of chronic mild stressinduced anhedonia. Physiol Behav 84:697–706. Haghighi M, Salehi I, Erfani P, Jahangard L, Bajoghli H, HolsboerTrachsler E, Brand S (2013) Additional ECT increases BDNFlevels in patients suffering from major depressive disorders compared to patients treated with citalopram only. J Psychiatr Res 47:908–915. Hatalski CG, Baram TZ (1997) Stress-induced transcriptional regulation in the developing rat brain involves increased cyclic adenosine 3,5-monophosphateregulatory element binding activity. Mol Endocrinol 11:2016–2024. Hensler JG (2003) Regulation of 5-HT1A receptor functions in brain following agonist or antidepressant administration. Life Sci 72:1665–1682. Herrera MR, Mora S, Viana GS (2006) Antidepressant and anxiolytic effects of hydroalcoholic extract from Salvia elegans. J Ethnopharmacol 107:53–58. Kennedy SH, Rizvi SJ (2009) Emerging drugs for major depressive disorder. Expert Opin Emerg Drugs 14:439–453. Koo HJ, Song YS, Kim HJ, Lee YH, Hong SM, Kim SJ, Kim BC, Jin C, Lim CJ, Park EH (2004) Antiinflammatory effects of genipin, an active principle of gardenia. Eur J Pharmacol 495:201–208. Kulkarni SK, Dhir A (2009) Current investigational drugs for major depression. Expert Opin Investig Drugs 18:767–788. Lee SJ, Oh PS, Ko JH, Lim K, Lim KT (2006) Glycoprotein isolated from Gardenia jasminoides Ellis has a scavenging activity against oxygen radicals and inhibits the oxygen radical-induced protein kinase C alpha and nuclear factor-kappa B in NIH/3T3 cells. Environ Toxicol Pharmacol 21:8–21.
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373 Li N, He X, Qi X, Zhang Y, He S (2010) The mood stabilizer lamotrigine produces antidepressant behavioral effects in rats: role of brain-derived neurotrophic factor. J Psychopharmacol 24:1772–1778. Li HB, Yu Y, Wang ZZ, Dai Y, Gao H, Xiao W, Yao XS (2013) Iridoid and bis-iridoid glucosides from the fruit of Gardenia jasminoides. Fitoterapia 88:7–11. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T) (-Delta Delta C) method. Methods 25:402–408. Mao QQ, Ip SP, Tsai SH, Che CT (2008) Antidepressant-like effect of peony glycosides in mice. J Ethnopharnacol 119:272–275. Perez-Caceres D, Ciudad-Roberts A, Rodrigo MT, Pubill D, Camins A, Camarasa J, Escubedo E, Pallas M (2013) Depression-like behavior is dependent on age in male SAMP8 mice. Biogerontology 14:165–176. Qi X, Lin W, Li J, Li H, Wang D, Sun M (2008) Fluoxetine increases the activity of the ERK-CREB signal system and alleviates the depressive-like behavior in rats exposed to chronic forced swim stress. Neurobiol Dis 31:278–285. Ranalli A, Contento S, Lucera L, Moira DF, Donato M, Vittoria DF (2006) Factors affecting the contents of iridoid oleuropein in olive leaves (Olea europaea L.). J Agric Food Chem 54:434–440.
373
Tian JS, Cui YL, Hu LM, Gao S, Chi W, Dong TJ, Liu LP (2010) Antidepressant-like effect of genipin in mice. Neurosci Lett 479:236–239. Willner P (1984) The validity of animal models of depression. Psychopharmacology (Berl) 83(1):1–16. Willner P, Towell A, Sampson D, Sophokleous S, Muscat R (1987) Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacology 93:358–364. Xu Y, Ku B, Tie L, Yao H, Jiang W, Ma X, Li X (2006) Curcumin reverses the effects of chronic stress on behavior, the HPA axis, BDNF expression and phosphorylation of CREB. Brain Res 11:56–64. Yoko FH, Atsumi N, Ikeda T, Morishita K, Liu WT, Ibi D, Alkamd T, Nabeshima T, Yamada K (2011) The hydrophobic dipeptide LeuIle inhibits immobility induced by repeated forced swimming via the induction of BDNF. Behav Brain Res 220:271–280. Zhang Y, Meng FC, Cui YL, Song YF (2011) Enhancing effect of hydroxypropyl-b-cyclodextrin on the intestinal absorption process of genipin. J Agric Food Chem 59:10919–10926. Zheng M, Fan Y, Shi D, Liu C (2013) Antidepressant-like effect of flavonoids extracted from apocynum venetum leaves on brain monoamine levels and dopaminergic system. J Ethnopharmacol 147:108–113.
(Accepted 17 June 2014) (Available online 24 June 2014)
GENIPIN IS ACTIVE VIA MODULATING MONOAMINERGIC TRANSMISSION AND LEVELS OF BRAIN-DERIVED NEUROTROPHIC FACTOR (BDNF) IN RAT MODEL OF DEPRESSION Q.-S. WANG, a,b J.-S. TIAN, a,c Y.-L. CUI a* AND S. GAO a
increased in genipin-treated rats compared to the CUMSexposed model group. Moreover, the levels of corticosterone in serum were decreased by genipin-treated compared to the CUMS-exposed model group. These results suggest that the possible mechanism of antidepressant-like effects on genipin, at least in one part, resulted from monoaminergic neurotransmitter system and the potential dysfunctional regulation of the post-receptor signaling pathway, which particularly affected the 5-HT1AR, 5-HT2AR and BDNF levels in the hippocampus. Ó 2014 IBRO. Published by Elsevier Ltd. All rights reserved.
a
Tianjin State Key Laboratory of Modern Chinese Medicine, Research Center of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin 300193, PR China b Institute of Medical Equipment, Academy of Military Medical Sciences, Tianjin 300161, PR China c
Modern Research Center for Traditional Chinese Medicine of Shanxi University, Taiyuan 030006, PR China
Abstract—Genipin, an important bioactive component from Gardenia jasminoides Eills, was demonstrated to possess antidepressant-like effects in a previous study. However, the molecular mechanism of antidepressant-like effects on genipin was not clear. The present study aimed to investigate the possible mechanism of antidepressant-like effects on genipin with a chronic unpredictable mild stress (CUMS)induced depression model in rats. In CUMS-induced depressive rats, bodyweight and 1% sucrose consumption decreased significantly compared with the normal control group. Furthermore, these changes could be significantly reversed by genipin application. The levels of 5-hydroxytryptamine (5-HT), norepinephrine (NE) in the hippocampus decreased and the level of 5-hydroxyindole acetic acid (5-HIAA) increased in the CUMS-induced depressive rats. However, pre-treatments with genipin significantly increased the levels of 5-HT, NE and decreased the level of 5-HIAA in the hippocampus. The concentration of cAMP in the hippocampus was increased by genipin compared to the CUMSexposed model group. The mRNA expressions of 5-hydroxytryptamine 1A receptor (5-HT1AR), cAMP response element binding protein (CREB) and brain-derived neurotrophic factor (BDNF) in rats were decreased exposed to CUMS, which were reversed by genipin-treated rats exposed to CUMS. Compared to the CUMS-exposed model group, the mRNA expression of 5-hydroxytryptamine 2A receptor (5-HT2AR) was decreased significantly by genipin-treated rats. The mRNA and protein expression of CREB, BDNF were
Key words: genipin, antidepressant, brain-derived neurotrophic factor, chronic unpredictable mild stress, serotonin.
INTRODUCTION Major depressive disorder is a chronic, recurring and potentially life-threatening illness that affects up to 17% of the population worldwide. The affective, behavioral and cognitive symptoms of depression are mainly manifested by either a dysphonic mood or a loss in pleasure or interest (Yoko et al., 2011). In recent decades, the number of patients with depression has dramatically increased and the discovery or development of novel antidepressants is urgently needed. Currently, the treatment for depression mainly consists of chemical drugs, including tricyclic antidepressants (TCAs), selective norepinephrine reuptake inhibitors (SSRIs), monoamine oxidase inhibitors (MAOIs), norepinephrine reuptake dual inhibitors (NARIs) and selective norepinephrine reuptake inhibitors (SNRIs). However, these drugs failed to work for 30% patients, and undesirable side effects were observed in clinical practice (Kennedy and Rizvi, 2009). Since the earliest days of humankind, herbal medicines have been the basis of health care worldwide. Even in developed countries, patients rely on medicinal plants and herbal medicines for primary care. In Germany, herbal medicines are fully recognized as medicines, whereas most herbal products in the U.S.A. are regarded as foods or food supplements. In China and other oriental countries, natural plants, such as Rehmannia glutinosa Libosch, Eucommia ulmoides Oliver, Scrophularia ningpoensis Hemsl and Gardenia jasminoides Eills are widely used as herbal medicines or medicinal supplements for many years (Ranalli et al., 2006).
*Corresponding author. Address: Research Center of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, No. 88 YuQuan Road, Nankai District, Tianjin 300193, PR China. Tel: +86-22-59596170. E-mail address: [email protected] (Y.-L. Cui). Indicates equal contribution. Abbreviations: 5-HT, 5-hydroxytryptamine; 5-HIAA, 5-hydroxyindole acetic acid; 5-HT1AR, 5-Hydroxytryptamine 1A receptor; 5-HT2AR, 5-Hydroxytryptamine 2A receptor; BDNF, brain-derived neurotrophic factor; CREB, cAMP response element binding protein; CUMS, chronic unpredictable mild stress; EDTA, ethylenediaminetetraacetic acid; FST, forced swimming test; NE, norepinephrine; TST, tail suspension test. http://dx.doi.org/10.1016/j.neuroscience.2014.06.032 0306-4522/Ó 2014 IBRO. Published by Elsevier Ltd. All rights reserved. 365
366
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
G. jasminoides Ellis is an evergreen shrub that is mostly distributed in the southern regions of China. The dried ripe fruit of this plant is known as Fructus Gardeniae (Chinese herbal name ‘‘Zhi-Zi’’) in Chinese Pharmacopoeia (Li et al., 2013), which was used for the treatment of deficient dysphoria, conjunctival congestion, hemorrhage, pathopyretic ulcer, swelling, sprain, pain and coronary artery disease (Gao and Zhu, 2013). Genipin, the aglycone of geniposide, is extracted from the fruit of G. jasminoides Ellis, and the chemical structure is shown in Fig. 1. Genipin has been shown to exhibit various bioactivities, such as neuroprotective, antiinflammatory, anti-tumor and choleretic effects (Koo et al., 2004; Lee et al., 2006; Ding et al., 2013). Moreover, our previous study reported the antidepressant-like effects of genipin in forced swimming test (FST) and tail suspension test (TST) in mice (Tian et al., 2010). In the present study, further investigation of the antidepressant effects and potential mechanisms of genipin in chronic unpredictable mild stress (CUMS) rats was performed. Alterations in monoaminergic systems are associated with the mechanisms of action underlying the favorable treatment of antidepressant drugs (Duman and Voleti, 2012; Zheng et al., 2013). Specifically, 5-Hydroxytryptamine (5-HT) has been considered as one of the major neurochemical systems in the brain which is dysregulated expression in affective disorders. The 5-hydroxytryptamine 1A receptor (5-HT1AR) and 5-hydroxytryptamine 2A receptor (5-HT2AR) are the two important receptors related to depression (Perez-Caceres et al., 2013). Brain-derived neurotrophic factor (BDNF) is a type of nerve growth factor related to the survival and maintenance of neuronal function. Changing of BDNF expression plays an essential role in the initiative recovery of depression (Haghighi et al., 2013). Furthermore, the mRNA expression of BDNF could be affected by antidepressants via the regeneration and promotion of damaged hippocampal neurons (Cortes-Mendoza et al., 2013). For example, Ginseng Total Saponins, the major bioactive component of Panax ginseng, exhibits an antidepressant-like effect in FST and CUMS models of depression
by the alteration of BDNF expression in rat hippocampi (Xu et al., 2006; Dang et al., 2009). In this study, the possible mechanism of antidepressant-like effects on genipin was investigated in the CUMS-induced depressive rats by determining the levels of monoamines and the mRNA expression of 5-HT1AR, 5-HT2AR and BDNF in the hippocampus.
EXPERIMENTAL PROCEDURES Drugs and reagents Genipin (98% purity) was purchased from WAKO (Osaka, Japan). Fluoxetine hydrochloride capsules (Eli Lilly and Company, Indianapolis, IN, USA) were prescribed from the first affiliated hospital of Tianjin University of Traditional Chinese Medicine. Parameter Cyclic AMP Assay Kit and DuoSet IC Phospho-CREB (S133) ELISA Kit were purchased from R & D Systems, Inc. (Minneapolis, MN, USA). ImProm-II Reverse Transcription System kit was bought from Promega Corporation (Madison, WI, USA). SYBR Green JumpStart Taq ReadyMix was bought from Sigma– Aldrich Co. (St Louis, MO, USA). UNIQ-10 column Trizol total RNA extraction kit was bought from Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). The FlexStation 3 microplate reader (Molecular Devices Co., Sunnyvale, CA, USA) and Prism 7500 Real-Time PCR System (Applied Biosystems Inc., Foster City, CA, USA) were used. All chemical agents were of ACS or analytical grade. Animals and drug administration Male Sprague Dawley rats, weighing 180–200 g (Beijing Vital Laboratory Animal Technology Company, Beijing), were used. The animals were maintained on a natural day–night cycle with ad libitum access to food and water. Ambient temperature and relative humidity were maintained at 24 ± 1 °C and 55 ± 5%, respectively. The rats were acclimatized for at least 1 week prior to the CUMS procedure. All of the experiments were performed between 9:00 a.m. to 3:00 p.m. In this study, the procedures were performed in accordance with the NIH Guide for the Care and Use of Laboratory Animals. Genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) were resuspended in water and administered to the rats during the last seven days of the CUMS procedure. Saline was used as vehicle controls. CUMS procedure
Fig. 1. The chemical structure and biotransformation procedure of geniposide into genipin.
CUMS is an experimental procedure in which the rats are chronically exposed to variable unpredictable mild stressors to induce depression (Willner et al., 1987; Herrera et al., 2006). Prior to the start of the CUMS procedure, all of the rats were given 1% sucrose water for 24 h to avoid neophobia for sucrose consumption training. After completion of the training, the rats were randomly divided into six groups (12 rats per group). The rats were then exposed to the CUMS procedure for 3 weeks and treated with fluoxetine (7.5 mg/kg), genipin (25, 50 and 100 mg/kg) or saline (model group) in the last week
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
except for the control group. The CUMS procedure consisted of a variety of unpredictable mild stressors, including 5-min forced swimming in 4 °C cold water, 24-h food deprivation, 24-h water deprivation, 10-min hot environment (45 °C), 2-min tail pinch (1 cm from the beginning of the tail), foot shock (36 V, 10 s for each time, and 15 times for once) and 2-min oscillation. These stressors were randomly performed from 9:00 to 12:00 in the morning, and the body weight and sugar consumption of the rats were recorded. Open-field test The number of crossings and rearings was used to assess locomotor activity. This test was modified from a previously described method and performed between 8:00 a.m. to 12:00 a.m. in a quiet room (Mao et al., 2008). The open-field apparatus consisted of a square arena (100 cm 100 cm 50 cm) with a floor divided into 25 equal-sized squares with grids. Each rat was placed in the center of the apparatus and was observed for 5 min. The number of crossings and rearings made by the animal within the last 4 min was recorded. The apparatus was then cleaned using a detergent and dried following each test. Serum and hippocampus collection After the last drug administration and locomotor activity measurement, all of the rats were sacrificed following a 10-min anesthesia. Blood samples were immediately collected, and the serum was obtained by centrifugation at 3000g for 10 min. The bilateral hippocampi were quickly removed from the brain and put into labeled tubes. After a quick-freeze in liquid nitrogen for 15 min, the serum and hippocampi were stored in a freezer at 80 °C for further analyses. Determination of monoamines and its metabolites in the hippocampus A specific volume of ice-cold 0.1 M perchloric acid was added to the hippocampi-containing tubes. Hippocampi were then homogenized for 30 s and the homogenate was centrifuged at 13,000g for 20 min at 4 °C. Twenty microliters of the resultant supernatant was injected into the HPLC instrument. The HPLC-ECD conditions were as follows: Waters Symmetry C18 column (150 mm 3.9 mm, 5 lm); the mobile phase was 19% methanol, 3% acetonitrile and 78% phosphate buffer, where the buffer consisted of 0.1 M KH2PO4, 0.01 M OSA (Octanesulfonic acid), 0.1 mM EDTA (pH: 3.6). The column temperature was at 35 °C and the flow rate was 1.0 mL/min. The detector was set at a potential of +0.7 V using an Ag/AgCl reference electrode.
367
at 4 °C. The resultant supernatant was obtained, and the optical density (OD) value was recorded to measure the concentration of cAMP using a commercial ELISA kit (R&D Systems, Inc., Minneapolis, MN, USA). The assays were performed in duplicate, and the cAMP values were normalized to the level of total protein. Measurement of Phospho-CREB and BDNF protein levels in the hippocampus Hippocampi were homogenized in a cell lysis buffer solution according to the manufacturer0 s instructions from the ELISA kit. Moreover, the determination of total protein was performed using a BCA Protein Assay Kit (Thermo Scientific, Rockford, IL, USA). The results were determined using a FlexStation 3 microplate reader and the data were corrected with total protein concentrations to calculate the content of Phospho-CREB and BDNF protein. Furthermore, the relative concentration was expressed as per microgram of total protein in the tissue. Real-time RT-PCR assays for 5-HT1AR, 5-HT2AR, CREB and BDNF mRNA expression in the hippocampus The mRNA expression of 5-HT1AR, 5-HT2AR, CREB and BDNF were determined using Real-time RT-PCR. Total RNA was isolated using an UNIQ-10 column Trizol total RNA extraction kit according to the manufacturer0 s instructions. RNA (1 lg) was reverse transcribed using an ImProm-II Reverse Transcription System cDNA synthesis kit. The real-time RT-PCR oligonucleotide primers used were listed in Table 1. The reactions were setup as duplicates in a total volume of 25 lL, which consisted of 1 lL of each primer (0.3 lM final concentrations), 12.5 lL of SYBR Green JumpStart Taq ReadyMix, and 1 lL of template. The PCR cycle was performed as follows: 94 °C for 2 min, 40 cycles of 94 °C for 15 s, 60 °C for 1 min, and 72 °C for 1 min, and a melting curve analysis was performed at the end of each experiment to verify that a single product per primer pair was amplified. The samples were compared using the relative CT method. The fold increase or decrease was determined relative to a blank control after normalizing to a housekeeping gene using DDC 2 (Livak and Schmittgen, 2001; Gois and Schafer, T 2005). Determination of corticosterone levels in serum Serum corticosterone levels were measured using a Corticosterone EIA Kit (Cayman Chemical Company, Ann Arbor, MI, USA) according to the manufacturer0 s instructions. The sensitivity of the measurement was 45.3 pg/mL. The intra- and inter-assay coefficients of variations were 10% and 14%, respectively.
Measurement of cAMP concentration in the hippocampus
Statistical analysis
The frozen hippocampi were thawed at room temperature, then rinsed with physiological saline quickly and homogenized for 30 s in Cell Lysis Buffer. The homogenate was centrifuged at 13,000g for 5 min
Statistical analyses were performed with Origin 8.0 software (MicroCal, USA) and all results were expressed as means ± SEM. Statistically significant differences between groups was determined by a
368
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
Table 1. Real-time RT-PCR oligonucleotide primers Gene
Primer
Sequence(50 –30 )
PCR product (bp)
GAPDH (NM_017008.4) CREB (NM_134443.1) BDNF (NM_001270630.1) 5-HT1AR (NM_012585.1) 5-HT2AR (NM_017254.1)
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
AGACAGCCGCATCTTCTTGT TGATGGCAACAATGTCCACT ACCAGCAGAGTGGAGATGCT TACAGTGGGAGCAGATGACG AGCTGAGCGTGTGTGACAGT ACCCATGGGATTACACTTGG CCGCACGCTTCCGAATCC TGTCCGTTCAGGCTCTTCTTG AACGGTCCATCCACAGAG AACAGGAAGAACACGATGC
142
One-Way Analysis of Variance (ANOVA). The criterion for statistical significance was P < 0.01 or P < 0.05.
RESULTS Effects of genipin on body weight As shown in Fig. 2A, body weight was measured at the beginning of the experiment and at 7-day intervals thereafter. At the beginning of the experiment (Day 0), there were no significant differences in body weight among the six groups. During the stress sessions, the stressed groups did not gain weight as quickly as the
134 161 109 109
control group. After 2 weeks of drug treatment with exposure to the stressor, the body weight of the model group was significantly lower than that of the normal control group (P < 0.01). After treatment with genipin (25 and 50 mg/kg) or fluoxetine (7.5 mg/kg) in the last week, the body weights increased significantly compared to the model group (P < 0.05). The body weights had increased in the control group compared to CUMS-treated groups (P < 0.05). Effects of genipin on sucrose consumption The consumption of 1% sucrose was measured four times during the CUMS procedure (Fig. 2B). At the beginning of the experiment (Day 0), there was no significant difference among the six groups. After 2 weeks (Day 14), the sucrose consumption of stressed rats was significantly lower than that of the control group. The sucrose consumption of stressed rats treated for 1 week with genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) increased significantly (P < 0.01) compared to CUMS-treated groups. Effects of genipin on locomotor activity A 3-week period of CUMS exposure resulted in a significant reduction in the number of crossings and rearings compared to the control group. In addition, the 1-week treatment with genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) significantly increased the number of crossings and rearings compared to CUMStreated groups (P < 0.01 or P < 0.05) (Table 2). Effects of genipin on the levels of monoamines and its metabolites
Fig. 2. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on body weight (A) and 1% sucrose consumption (B). The values were expressed as the means ± SEM (n = 8). #P < 0.05, ##P < 0.01 compared vs. control; ⁄P < 0.05, ⁄⁄ P < 0.01 compared vs. model.
As shown in Table 3, the concentration of norepinephrine (NE) and 5-HT was reduced, while the level of 5-hydroxyindole acetic acid (5-HIAA) was increased significantly after the 3-week CUMS procedure compared to CUMS-treated groups (P < 0.05). The concentration of NE and 5-HT increased significantly after the administration of genipin (25, 50 and 100 mg/ kg) or fluoxetine (7.5 mg/kg). On the contrary, the concentration of 5-HIAA tended to decrease after the administration of genipin (25, 50 and 50 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups.
369
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373 Table 2. Effects of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on the number of crossings and rearings in the OFT Groups
Dose (mg/kg)
Number of crossings
Number of rearings
Control Model Fluoxetine Genipin
– –
55.8 ± 3.9 23.6 ± 5.0## 41.3 ± 5.1** 40.5 ± 3.7** 43.3 ± 6.7** 32.7 ± 4.5*
17.8 ± 2.8 6.2 ± 4.9## 15.8 ± 1.7* 13.5 ± 2.1* 15.3 ± 3.1** 11.6 ± 2.6*
7.5 25 50 100
The values were expressed as the means ± SEM (n = 8). ## P < 0.01 compared vs. control; * P < 0.05, ** P < 0.01 compared vs. model.
Table 3. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on monoamine neurotransmitters in rats Groups
Dose (mg/kg)
Control Model Fluoxetine Genipin
– – 7.5 25 50 100
Hippocampus (ng/g) NE
5-HT
5-HIAA
414.79 ± 101.81 243.22 ± 51.84## 479.41 ± 194.27** 402.89 ± 91.96** 370.72 ± 111.66* 512.62 ± 77.42**
142.31 ± 32.68 89.73 ± 25.16# 131.10 ± 40.91* 120.43 ± 39.62* 155.31 ± 36.30** 171.33 ± 30.34**
288.35 ± 71.91 456.11 ± 83.11## 111.84 ± 37.04** 307.24 ± 85.02** 332.95 ± 67.71** 379.15 ± 66.06*
Values were expressed as the means ± SEM (n = 8). # P < 0.05, ## P < 0.01 compared vs. control; * P < 0.05, ** P < 0.01 compared vs. model.
Effects of genipin on the mRNA expression of 5-HT1AR and 5-HT2AR The mRNA expression of 5-HT1AR and 5-HT2AR in the hippocampus are shown in Fig. 3. There was a significant decrease in 5-HT1AR and an increase in 5-HT2AR expression in the CUMS group compared to control group (P < 0.05). The mRNA expression of 5-HT1AR was increased and the expression of 5-HT2AR was inhibited significantly after the administration of genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups (P < 0.01 or P < 0.05). Effects of genipin on cAMP concentration Cyclic AMP is one key second messenger in several signal transduction pathways. In this study, the concentration of cAMP in the hippocampi was determined. As shown in Fig. 4, the cAMP concentration in CUMS-treated groups was significantly decreased compared to the control group. However, the concentration of cAMP increased significantly by genipin (100 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups (P < 0.01 or P < 0.05). Effects of genipin on Phospho-CREB protein and CREB mRNA expression Phospho-CREB protein and CREB mRNA expression were examined, and the results are shown in Fig. 5. The level of Phospho-CREB protein was downregulated in CUMS-treated groups. Although the levels
of Phospho-CREB protein were up-regulated when slightly treated with genipin or fluoxetine, there was no significance compared to CUMS-treated groups (P > 0.05). In addition, CREB mRNA expression was decreased in CUMS-treated groups. Moreover, the mRNA expression of CREB was increased significantly when treated with genipin (25, 50 and 100 mg/kg) or fluoxetine (7.5 mg/kg) compared to CUMS-treated groups (P < 0.01 or P < 0.05). Effects of genipin on BDNF protein and mRNA expression The mRNA and protein expression of BDNF in the hippocampus are shown in Fig. 6. The mRNA expression of BDNF decreased significantly in CUMS-treated groups compared to the control group (P < 0.05). Genipin (25 mg/kg) could up-regulate the mRNA expression of BDNF significantly compared to CUMS-treated groups (P < 0.01). The protein expression of BDNF protein was also investigated and the result showed that the protein expression of BDNF was increased significantly treating with genipin (25 mg/kg) compared to CUMS-treated groups. The protein expression of BDNF was increased significantly by genipin compared to CUMS-treated groups, which was coincidence with the mRNA expression of BDNF. Effects of genipin on corticosterone levels Fig 7 shows that plasma corticosterone levels in the CUMS-exposed model group were significantly higher
370
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
Fig. 3. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on 5-HT1AR (A) and 5-HT2AR mRNA expression (B). Values were expressed as the means ± SEM (n = 8). #P < 0.05, ##P < 0.01 compared vs. control; ⁄P < 0.05, ⁄⁄ P < 0.01 compared vs. model.
Fig. 5. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on CREB mRNA (A) and CREB protein expression (B). Values were expressed as the means ± SEM (n = 8). #P < 0.05 compared vs. control; ⁄P < 0.05 compared vs. model.
than those in the control group (P < 0.05). However, plasma corticosterone levels decreased significantly (P < 0.05) when the rats were treated with genipin (25 mg/kg) or fluoxetine (7.5 mg/kg).
DISCUSSION
Fig. 4. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on cAMP content. Values were expressed as the means ± SEM (n = 8). #P < 0.05 compared vs. control; ⁄P < 0.05 compared vs. model.
In addition to the FST and TST, the CUMS model was also playing an important role in the scientific screening and evaluation of antidepressants in animal models of depression (Willner, 1984). In the present study, CUMSinduced depression model was used to investigate the possible mechanism of antidepressant-like effects on genipin. Depressive disorder is associated with disturbances of brain monoamine neurotransmitters. Monoamines and their metabolite levels would change significantly in CUMS-induced depression model. The hippocampus plays important roles in learning and memory and has been considered as the subject of numerous studies for investigating the pathophysiology of depression (Bianchi et al., 2009). In CUMS-induced depression model, genipin could increase the concentration of NE and 5-HT in rat hippocampi. 5-HT1AR is currently the best-characterized
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
Fig. 6. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on BDNF mRNA (A) and BDNF protein expression (B). Values were expressed as the means ± SEM (n = 8). #P < 0.05 or ##P < 0.01 compared vs. control; ⁄P < 0.05 or ⁄⁄P < 0.01 compared vs. model.
Fig. 7. Effects of 1-week treatment of fluoxetine (7.5 mg/kg) or genipin (25, 50, 100 mg/kg) on serum corticosterone levels. Values were expressed as the means ± SEM (n = 8). #P < 0.05 or ## P < 0.01 compared vs. control; ⁄P < 0.05 or ⁄⁄P < 0.01 compared vs. model.
371
receptor subtype of 5-HT receptor subtypes, and it was demonstrated that its affinity with 5-HT, which has higher expression compared to other receptors (Gao et al., 2013). Moreover, 5-HT1AR also showed a reduction in immobility in the FST in knockout mice (Hensler, 2003), indicating that 5-HT1AR might be associated with the pathogenesis of depression. Furthermore, 5-HT2AR represents another subtype receptor which gained considerable interest, and the tendency was the opposite of the 5-HT1A receptor. The results showed that the 5-HT1AR mRNA expression was down-regulated, and the level of 5-HT2AR mRNA expression was up-regulated in CUMStreated groups. Genipin could reverse the mRNA expression of 5-HT1AR and 5-HT2AR at a dose of 25 mg/kg. This indicates that the central monoaminergic neurotransmitter system might be implicated in the antidepressant-like effects of genipin. Although the mRNA expression of 5-HT1AR was upregulated and the mRNA expression of 5-HT2AR was down-regulated by genipin, there was no dosedependent behavior. It might be related to the intestinal absorption mechanisms of genipin involved of P-glycoprotein (Pgp). Pgp is an ATP-dependent efflux pump and Pgp ATPase activity plays an important role in the mechanisms of Pgp inhibition. Verapamil, a known substrate of Pgp, could stimulate Pgp ATPase activity. Genipin alone could stimulate the basal Pgp ATPase activity and inhibited the verapamil-stimulated Pgp ATPase activity. Our previous study showed that genipin was a substrate of Pgp and competitively interacted at the drug-binding site of Pgp, which might be the reason for its low bioavailability (Zhang et al., 2011). The efflux of genipin by Pgp was not saturated as the lower bioavailability at 100 mg/kg than that at 50 or 25 mg/kg. The high bioavailability of genipin was mainly controlled by passive diffusion at low dose (25 mg/kg), and the low bioavailability was mainly affected by Pgp efflux function at high dose (100 mg/kg). Therefore, the regulation of Pgp might be the reason that the higher dose (100 mg/kg) of genipin was not more effective than that of the lower dose (25 mg/kg). BDNF, known as the regulator of neuronal survival, fast synaptic transmission and activity-dependent synaptic plasticity (Chuang et al., 2011), is one of the best-characterized functional growth factors in the field of neuroscience. The expression levels of frontal and hippocampal BDNF are up-regulated by sub-chronic lamotrigine treatment in both naive and stressed animals (Li et al., 2010). BDNF protein expression could be elevated by ginsenoside Rb3 (Rb3) at the tested doses in a chronic mild stress model (Cui et al., 2012). Moreover, it was reported that levels of BDNF decreased in the hippocampus in some patients with depression, but this was not observed in depressed patients treated with antidepressants (Chen et al., 2001). Thus, BDNF is one of major candidate targets for the treatment of antidepressant response. In the present study, the mRNA and protein expression of BDNF was increased significantly by genipin in the CUMS-induced depression model. These findings suggest that genipin might generate
372
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373
antidepressant-like effects via increasing the BDNF level in the hippocampus. CREB is a transcription activator that has a critical role in both stress (Hatalski and Baram, 1997) and antidepressant-induced transcriptional regulation (Conti et al., 2002). There are relevant literature studies showing that CREB was altered in response to antidepressant treatments (Blendy, 2006). It was reported that the activities of the CREB in the hippocampus and prefrontal cortex in rats could disrupt depressive-like behaviors after receiving chronic forced swim stress. Furthermore, the reduction of CREB activity in both regions and the depressive-like behaviors exhibited in stressed rats could be reversed by fluoxetine treatment (Qi et al., 2008). In our present study, the protein expression of Phospho-CREB was not changed significantly by genipin, but the mRNA expression of CREB was up-regulated by genipin in the CUMS-induced depression model. In addition, glucocorticoid (cortisol in humansor corticosterone in rodents) release is governed by the HPA axis. The release of glucocorticoids such as cortisol, increased by the hyperactivity of the HPA axis, could damage hippocampal neurons and produce cognitive impairment in depressed patients. (Kulkarni and Dhir, 2009). It has been reported that the levels of corticosterone were elevated in chronic mild stress rats (Grippo et al., 2005). The present study found that the plasma corticosterone levels decreased significantly when the rats were treated with genipin (25 mg/kg). Therefore, the regulation of the plasma corticosterone levels in rats achieved by genipin treatment may help to elucidate the role of the HPA axis in the antidepressantlike effects of genipin.
CONCLUSION In conclusion, the possible mechanism of antidepressantlike effects on genipin was interacted with the serotonergic (5-HT1A and 5-HT2A receptors) and monoaminergic neurotransmitter system as well as the elevation of 5-HT and NA levels in the rat brain. Moreover, the regulation of BDNF by genipin played a role in a possible mechanism of antidepressant-like effects. Acknowledgments—This work was supported by the National Natural Science Foundation of China (Nos. 81173469 and 81102833), the Program of Science and Technology of Shanxi Province (No. 2012021031-2) and the Specialized Research Fund for the Doctoral Program of Higher Education (No. 20131210110008).
REFERENCES Bianchi M, Fone KC, Shah AJ, Atkins AR, Dawson LA, Heidbreder CA, Hagen JJ, Marsden CA (2009) Chronic fluoxetine differentially modulates the hippocampal microtubular and serotonergic system in grouped and isolation reared rats. Eur Neuropsychopharmacol 19:778–790. Blendy JA (2006) The role of CREB in depression and antidepressant treatment. Biol Psychiatry 59:1144–1150.
Chen B, Dowlatshahi D, MacQueen GM, Wang JF, Young LT (2001) Increased hippocampal BDNF immunoreactivity in subjects treated with antidepressant medication. Biol Psychiatry 50:260–265. Chuang CY, Shi YC, You HP, Lo YH, Pan TM (2011) Antidepressant effect of GABA-rich monascus-fermented product on forced swimming rat mode. J Agric Food Chem 59:3027–3034. Conti AC, Cryan JF, Dalvi A, Lucki I, Blendy JA (2002) CAMP response element-binding protein is essential for the upregulation of brain-derived neurotrophic factor transcription, but not the behavioural or endocrine responses to antidepressant drugs. J Neurosci 22:3236–3268. Cortes-Mendoza J, de Leon-Guerrero SD, Pedraza-Alva G, PerezMartinez (2013) Shaping synaptic plasticity: the role of activitymediated epigenetic regulation on gene transcription. Int J Dev Neurosci 31:359–369. Cui J, Jiang L, Xiang H (2012) Ginsenoside Rb3 exerts antidepressant-like effects in several animal models. J Psychopharmacol 26:697–713. Dang HX, Chen Y, Liu XM (2009) Antidepressant effects of ginseng total saponins in the forced swimming test and chronic mild stress models of depression. Prog Neuro-Psychoph 33:1417–1424. Ding Y, Hou JW, Zhang Y, Zhang LY, Zhang T, Chen Y, Cai ZZ, Yang L (2013) Metabolism of genipin in rat and identification of metabolites by using Ultraperformance Liquid Chromatography/ Quadrupole Time-of-Flight Tandem Mass Spectrometry. Evid Based Complement Altern Med 2013:957030. Duman RS, Voleti B (2012) Signaling pathways underlying the pathophysiology and treatment of depression: novel mechanisms for rapid-acting agents. Trends Neurosci 35:47–56. Gao L, Zhu BY (2013) The accumulation of crocin and geniposide and transcripts of phytoene synthase during maturation of Gardenia jasminoides fruit. Evid Based Complement Altern Med 2013:686351. Gao S, Cui YL, Yu CQ, Wang QS, Zhang Y (2013) Tetrandrine exerts antidepressant-like effects in animal models: role of brain-derived neurotrophic factor. Behav Brain Res 238:79–85. Gois DS, Schafer MK (2005) Homeostatic scaling of vesicular glutamate and GABA transporter expression in rat neocortical circuits. J Neurosci 25:7121–7133. Grippo AJ, Francis J, Beltz TG, Felder RB, Johnson AK (2005) Neuroendocrine and cytokine profile of chronic mild stressinduced anhedonia. Physiol Behav 84:697–706. Haghighi M, Salehi I, Erfani P, Jahangard L, Bajoghli H, HolsboerTrachsler E, Brand S (2013) Additional ECT increases BDNFlevels in patients suffering from major depressive disorders compared to patients treated with citalopram only. J Psychiatr Res 47:908–915. Hatalski CG, Baram TZ (1997) Stress-induced transcriptional regulation in the developing rat brain involves increased cyclic adenosine 3,5-monophosphateregulatory element binding activity. Mol Endocrinol 11:2016–2024. Hensler JG (2003) Regulation of 5-HT1A receptor functions in brain following agonist or antidepressant administration. Life Sci 72:1665–1682. Herrera MR, Mora S, Viana GS (2006) Antidepressant and anxiolytic effects of hydroalcoholic extract from Salvia elegans. J Ethnopharmacol 107:53–58. Kennedy SH, Rizvi SJ (2009) Emerging drugs for major depressive disorder. Expert Opin Emerg Drugs 14:439–453. Koo HJ, Song YS, Kim HJ, Lee YH, Hong SM, Kim SJ, Kim BC, Jin C, Lim CJ, Park EH (2004) Antiinflammatory effects of genipin, an active principle of gardenia. Eur J Pharmacol 495:201–208. Kulkarni SK, Dhir A (2009) Current investigational drugs for major depression. Expert Opin Investig Drugs 18:767–788. Lee SJ, Oh PS, Ko JH, Lim K, Lim KT (2006) Glycoprotein isolated from Gardenia jasminoides Ellis has a scavenging activity against oxygen radicals and inhibits the oxygen radical-induced protein kinase C alpha and nuclear factor-kappa B in NIH/3T3 cells. Environ Toxicol Pharmacol 21:8–21.
Q.-S. Wang et al. / Neuroscience 275 (2014) 365–373 Li N, He X, Qi X, Zhang Y, He S (2010) The mood stabilizer lamotrigine produces antidepressant behavioral effects in rats: role of brain-derived neurotrophic factor. J Psychopharmacol 24:1772–1778. Li HB, Yu Y, Wang ZZ, Dai Y, Gao H, Xiao W, Yao XS (2013) Iridoid and bis-iridoid glucosides from the fruit of Gardenia jasminoides. Fitoterapia 88:7–11. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T) (-Delta Delta C) method. Methods 25:402–408. Mao QQ, Ip SP, Tsai SH, Che CT (2008) Antidepressant-like effect of peony glycosides in mice. J Ethnopharnacol 119:272–275. Perez-Caceres D, Ciudad-Roberts A, Rodrigo MT, Pubill D, Camins A, Camarasa J, Escubedo E, Pallas M (2013) Depression-like behavior is dependent on age in male SAMP8 mice. Biogerontology 14:165–176. Qi X, Lin W, Li J, Li H, Wang D, Sun M (2008) Fluoxetine increases the activity of the ERK-CREB signal system and alleviates the depressive-like behavior in rats exposed to chronic forced swim stress. Neurobiol Dis 31:278–285. Ranalli A, Contento S, Lucera L, Moira DF, Donato M, Vittoria DF (2006) Factors affecting the contents of iridoid oleuropein in olive leaves (Olea europaea L.). J Agric Food Chem 54:434–440.
373
Tian JS, Cui YL, Hu LM, Gao S, Chi W, Dong TJ, Liu LP (2010) Antidepressant-like effect of genipin in mice. Neurosci Lett 479:236–239. Willner P (1984) The validity of animal models of depression. Psychopharmacology (Berl) 83(1):1–16. Willner P, Towell A, Sampson D, Sophokleous S, Muscat R (1987) Reduction of sucrose preference by chronic unpredictable mild stress, and its restoration by a tricyclic antidepressant. Psychopharmacology 93:358–364. Xu Y, Ku B, Tie L, Yao H, Jiang W, Ma X, Li X (2006) Curcumin reverses the effects of chronic stress on behavior, the HPA axis, BDNF expression and phosphorylation of CREB. Brain Res 11:56–64. Yoko FH, Atsumi N, Ikeda T, Morishita K, Liu WT, Ibi D, Alkamd T, Nabeshima T, Yamada K (2011) The hydrophobic dipeptide LeuIle inhibits immobility induced by repeated forced swimming via the induction of BDNF. Behav Brain Res 220:271–280. Zhang Y, Meng FC, Cui YL, Song YF (2011) Enhancing effect of hydroxypropyl-b-cyclodextrin on the intestinal absorption process of genipin. J Agric Food Chem 59:10919–10926. Zheng M, Fan Y, Shi D, Liu C (2013) Antidepressant-like effect of flavonoids extracted from apocynum venetum leaves on brain monoamine levels and dopaminergic system. J Ethnopharmacol 147:108–113.
(Accepted 17 June 2014) (Available online 24 June 2014)
