AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 8, Number 11, 1992 Mary Ann Liebert, Inc., Publishers
Genetic Variants of HIV-1 in Thailand McCUTCHAN,1 PATRICIA A. HEGERICH,1 TERRENCE P. BRENNAN,1 PHANUPHAK,2 PRICHA SINGHARAJ,3 ACHARA JUGSUDEE,3 PHILLIP W. BERMAN,4 ALANE M. GRAY,4 ARNOLD K. FOWLER,5 and DONALD S. BURKE6
FRANCINE E. PRAPHAN
ABSTRACT
Serosurveys conducted prior to 1988 indicated a very low level of HIV-1 infection in Thailand, even among high-risk groups. The Ministry of Health has reported a dramatic increase in HIV-1 infection during the last three years. The geographic and demographic distribution of the epidemic is broad, involving multiple provinces and risk groups. Foci of higher incidence and prevalence have been noted in the urban center of Bangkok and in the northern provinces of Chiang Mai and Chiang Rai. Here we report the results of genetic characterization of 16 HIV-1 isolates from Thailand using a combination of polymerase chain reaction (PCR) typing and DNA sequencing. The complete sequence of gpl60 (env) of five isolates, partial env sequence of six additional isolates, and the gag gene of two isolates were determined. Two highly distinct HIV-1 variants were found. One variant resembled those prevalent in North America and Europe; live of the isolates were of this type. The remaining eleven isolates were very similar to one another and represented a variant unlike any previously described. Phylogenetic tree analysis of complete env and gag genes placed the two variants on widely separated branches. Protein sequence comparisons indicate both general and specific features that distinguish the Northern Thailand variant both from the Bangkok variant and from virtually all previously sequenced HIV-1 isolates. A simple PCR test for distinguishing the two variants has been developed for use in epidemiologic surveys.
INTRODUCTION to 1986 THE prevalence of HIV infection in Thailand very low. A 1985 serosurvey of 600 individuals from high- and low-risk groups including prostitutes, intravenous drug users (IVDU), patients at sexually transmitted disease (STD) clinics, thalassemia patients, and blood donors found only three positive tests. ' In connection with opportunities for employment abroad, of many thousands of Thai citizens screened for HIV-1 infection in 1986, none were positive.2 Surveys among IVDU in Bangkok3"6 have indicated a dramatic increase in the incidence of HIV infection in the past three
Prior was
years. One study showed prevalence of HIV-1 infection among IVDU increasing from 16 to 44% in eight months during 1988. Other risk behaviors are also associated with HIV-1 infection in Thailand.6,7 A broad-based serosurvey conducted in 1989 showed significant HIV-1 prevalence in IVDU, prostitutes, prisoners, STD clinic attenders, and blood donors. Thirteen of the fourteen provinces included in the survey had HIV-1 prevalence of more than 1% in some groups, and in many provinces groups with more than 10% prevalence of infection were identified. By February 1990, almost 15,000 cases of HIV-1 infection had been documented in Thailand.2 Currently, HIV-1 infection is spreading rapidly in the general population. Accord-
'Henry M. Jackson Foundation Research Laboratory, 1500 E. Gude Drive, Rockville, MD 20850. of Medicine, Chulalongkorn University, Bangkok, Thailand. 2Faculty 3
Armed Forces Research Institute of Medical Sciences and the Royal Thai Army Institute of Pathology, 315/6 Thailand. 4Department of Immunobiology, Genentech, Inc., 460 Pt. San Bruno Blvd., South San Francisco, CA 94080. 5SRA Laboratories, Inc., 13 Taft Court, Rockville, MD 20850. 6Division of Retrovirology, Walter Reed Army Institute of Research, Washington, DC 20307.
1887
Rajvithi Road, Bangkok 10400,
McCUTCHAN ET AL.
1888
ing to a recent report,8 the HIV prevalence among Thai men aged 21 who are entering military service now ranges from 1.1%
in the central and northeastern sectors up to 10.3% in the upper northern provinces. Government and private agencies in Thailand are working to reduce the spread of HIV-1 infection through education and behavioral interventions.9"11 The genetic variability of HI V-1 is an important consideration in the development of antiviral vaccines and therapies. We have studied a panel of 16 HIV-1 isolates from Thailand obtained in 1990. The envelope glycoprotein (env) of HIV-1, which is among the most variable portions of the virus12-15 and is a primary target of the antiviral immune response,16"19 was the main focus of the analysis, but we also studied the more conserved gag polyprotein. Two highly distinct HIV-1 variants were found in Thailand. The possible implications of this broad diversity of virus genotype are discussed.
METHODS Virus isolation Virus isolates in this study were obtained from individuals whose HIV-1 infection was detected by screening ELISA and confirmed by Western blot. Whole blood samples were transported from Thailand for virus isolation and characterization. Peripheral blood mononuclear cells (PBMC) were Ficoll-separated and cocultivated with phytohemagglutinin (PHA) stimulated, donor PBMC in the presence of interleukin-1 (IL-2).20 Virus production was monitored by p24 antigen capture ELISA. Virus isolation was successful from 4 of 4 blood samples from Bangkok and from 13 of 16 samples from Northern Thailand.
Polymerase chain
reaction
Purified DNA from PBMC cocultures served as the template for PCR. Each DNA template was amplified 30 cycles in separate reactions with each of 24 primer pairs in the HIV-1 gag gene as described.21 PCR products were detected by Southern blot hybridization with a ""P-labeled probe common to all of the amplified segments. Radioactivity was quantitated with a Betagen blot analyzer. Reactions yielding product that was less than 5% of positive control reactions on the same blot were noted as examples of template/primer mispairing. DNA from uninfected PBMC was included in each PCR panel and was consistently
negative. Specific primer
combinations for distinguishing the two HIV-1 variants in Thailand were developed based on DNA sequence differences or similarities among the isolates. All sequences are given 5'-3'. Products of primer combinations ThaiOl (sense: AGAAGGCTTTCAGCCCAGAAGT; antisense: TTTGGTCCTTGTCTTATGTCCAGAATGC) and Thai02 (sense: ATGAGGAAGCTGCAGAATGGG; antisense: TTTGGTCCTTGTCTTATGTCCAGAATGC) in the HIV-1 gag gene were detected with probe SK19.22 Products from amplification with primer combination Thia03 (sense: GAACTAAGAGATAAGAAGCAGAAGGTCCAT; antisense: TCCTTCTGCTAGACTGCCATTTA) in the gpl20 gene were detected with the probe TTAAGCCAGTGGTATCAACTCAATTGCTG. Primer combination Thia04 (sense: GTCTGGTATAGTGCAACAGCA;
antisense: GGTGAGTATCCCTGCCTAAC) amplified ment of gp41; the products were detected with the
a
seg-
probe
AGCAATTTGCTGAGGGCTATAGAGGCGCAGCAGC.
Molecular
cloning
For isolates BK132, CM235, CM239, CM242, and CM243, DNA from PBMC cocultures was amplified 30 cycles with primers flanking the env gene of HIV-1. Restriction endonuclease cleavage sites (underlined) were added during amplification and nonhomologous nucleotides are shown in lower case. Primer sequences (5'-3') employed were cgctgaatccAGAGCAGAAGACAGTGGCAATG and tagcgtcgac CTTTCIAAGCCCTGTCT for isolates BK132 and CM243 and cgctgaattc ATGAGAGTGAAGGAGACA and tagcgtcgacGATTCTTCTAGGTATGTGG for isolates CM235, CM239, and CM242, respectively. Cloning was in pBluescript II KS and bacterial colonies were screened with 32P-labeled env probe SK70.22 The majority of the clones obtained were full length as evaluated by restriction analysis of plasmid DNA. For isolates CM241 and CM244, nested PCR was used to amplify and clone the gpl20 portion of env starting with DNA from PBMC cocultures. Primers gggaattcggatccAGAGCAGAAGACAACAGTGGCAATGA and ccagatcttcgaaat CGGGTATCACGAACCACGACGAGG were employed for 25 PCR cycles. Second round (25 cycles) primers were gggaattcggatccGGGGTACCTGTRTGGAARGAAGCA and ccagatcttcgaatACGAGGRTTCTTGGGTTCCTTGT. The PCR product was blunted with T4 DNA polymerase, digested with restriction endonuclease Kpnl (underlined), purified on low-melt agarose (Seaplaque) and cloned into M13mpl9 digested with Kpnl and Hindi. These clones encode all of gpl20 except the first 12 amino acids of the mature glycoprotein. For some isolates, PCR was used to amplify a 450 bp segment encompassing the V3 loop portion oï env. Primers for amplification of this segment were sense: ctaggaattcTACAATGTACAGATGGAATTAGGCCAGTAG and antisense: gtacgaattcTTTAATTGTGGAGGGGAATTTTTCT. The probe used for
screening was AACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAG. The HIV-1 gag gene was PCR amplified and cloned from isolates BK132 and CM243. The primers used were gatcgaattcGACTAGCGGAGGCTAGAAG and tcgagaattcAGGGGTCGTTGCCAAAGA; probe SK19 was used for screening.
DNA
sequencing For sequencing of isolates BK132, CM235, CM239, CM242, and CM243, plasmid DNA from positive clones was purified using column chromatography (Quiagen Corp.) and quantitated by optical density at 260 nm. PCR cycle sequencing reactions using fluorescent primers or terminators (Applied Biosystems) were performed according to the manufacturer's procedures. Sequence data was collected with an Applied Biosystems 373A DNA sequencer. For isolates CM241 and CM244, single stranded templates of M13mpl9 clones were prepared by standard techniques and sequenced with a Sequenase Sequencing Kit (USB Corp.). With minor exceptions, all of the sequence were confirmed by sequencing both strands of the DNA. Sequence data were analyzed using DNAstar software on Mac-
data
intosh computers.
DNA SEQUENCING AND PCR TYPING OF HIV-1 ISOLATES FROM THAILAND
1889
RESULTS HIV-1 Isolate
Virus isolates The HIV-1 isolates included in this study were obtained from two geographic regions of Thailand and from individuals with different risk behaviors. Four isolates were obtained in Bangkok in January 1990 from individuals whose most likely route of HIV infection was intravenous exposure; three were injecting drug users while the fourth had apparently a transfusion prior to the implementation of routine HIV-1 screening for blood donors. Twelve isolates were from a Northern Province in Thailand. These were obtained in December, 1990 from young men who were randomly selected for national service and who had tested HIV-1 positive. Individuals in this second group reported sexual contact with prostitutes as their main risk factor for HIV-1 infection. Virus isolates from Bangkok were designated BK129BK132, inclusive, and those from Northern Thailand were designated CM235-CM246, inclusive.
PCR
* i¿ i¿ *
S
Northern Thailand
_Variant_ Bangkok Variant
xxxxxxxxxxx xxxxx
[ ][ ji ][ ][ ][ ][ j[ ]
[X
I [ Primer Pair
[ :i x ][ II ][ ][ i
]
] ][ [ [ I [ II
it ][ 1
[IMIIXI
[I I I ][ ][ ][ ][ X )[ ][ ][ ][
typing of isolates
We have developed a rapid procedure for genetic comparison of isolates by PCR21 and have used this procedure for identification and characterization of divergent HIV-1 isolates from many worldwide locales.23,24 Sixteen HIV-1 isolates from Thailand were characterized by PCR typing. Twenty-four primer pairs in the gag gene were used in separate reactions to amplify DNA from virus cultures. PCR products were detected by hybridization with 32P-labeled probes and quantitated. Individual reactions with product yields falling below a previously established cutoff, which indicates mispairing of a specific primer with the template DNA, were noted for each isolate. The results of the 384 individual PCR amplifications are shown in Figure 1. Five of the isolates exhibited a pattern similar to that observed for most North American isolates23 in that template DNA from the cultures could be amplified with at least 21 of the 24 primer combinations used. The remaining 11 isolates showed numerous instances of decreased PCR product indicative of template/primer mispairing. Primer pairs 5, 7, 11, 18, 20, 23, and 24 were largely unable to amplify these samples, and other primer combinations showed a sporadic pattern of failure. Primer combinations 4, 8, 9, 10, 16, and 19 consistently amplified these same isolates, establishing that adequate HIV-1 DNA was present in all the samples. These results indicate that HIV-1 variants found in Thailand were not homogeneous, but formed two divergent groups. They have been termed Northern Thailand variant ( 11 isolates) and Bangkok variant (5 isolates) pending a broader epidemiological surveillance of strains.
Comparison of gag polyprotein genes To determine the phylogenetic relationships of the two vari-
1.5 Kb DNA segment encoding the gag polyprotein was Northern Thailand variant CM243 and Bangkok variant BK132 (Fig. 1) were selected for analysis. The gag genes recovered from both isolates were found to be complete and free of alterations that would interrupt coding regions. The sequences were aligned and compared with each of the previously reported HIV-1 gag genes25 (Table 1). The Bangkok variant was more similar to those from North America than to ants,
SSSSSSSSS5S
uuuuuuuuuuu cocaoaoau
a
sequenced.
[xxxxx xx xxx ]«[][: [XXX ][][]!][][ xx :í:mi: FIG. 1.
PCR typing of HIV-1 isolates from Thailand. FicollPBMC from HIV-1+ individuals were cocultivated with donor PBMC. DNA from the cultures was isolated, purified, and used an template in PCR reactions at 10 u,g/ml. Amplification in individual reactions with each of 24 primer pairs in the HIV-1 gag gene was performed as described previously.21 Product from each reaction was separated in 1% agarose gels and detected by Southern blot hybridization with a 32P-labeled probe. Radioactivity was quantitated with a Betagen blot analyzer. Reactions exhibiting 5% or less product than control, positive reactions were scored as "mispaired," according to previously established criteria. Filled squares designate mispaired primer/template combinations.
separated
those from other locales. The Northern Thailand variant was not highly related to any previously sequenced isolate. Its best homology was 86.2% with a Ugandan isolate. The Bangkok and Northern Thailand variants were the least related among sequenced isolates, showing homology in gag of 73.8%. Much of the DNA sequence diversity between the two gag genes resulted in protein alterations. The protein sequences showed 71.8% homology (data not shown). The most divergent pair of HIV-1 isolates in the current database, HIV-1U455 from Uganda and HIV-1MN from North America, have a gag protein similarity index of 80.8%. There was relative conservation of the p24 protein but extensive divergence in the carboxy terminal portion of pl7, in p7, and in p6. These results indicate that the two HIV-1 variants from Thailand are highly divergent, exceeding previously reported variability in the HIV-1 gag gene.
Analysis of the envelope glycoprotein The envelope glycoprotein (env) of HIV-1 is among the most variable portions of the virus and is a primary target of the antiviral immune response. Evaluation of the potential impact of
1890
McCUTCHAN ET AL.
1 3
tu
23
-3
Genetic Variants of HIV-1 in Thailand McCUTCHAN,1 PATRICIA A. HEGERICH,1 TERRENCE P. BRENNAN,1 PHANUPHAK,2 PRICHA SINGHARAJ,3 ACHARA JUGSUDEE,3 PHILLIP W. BERMAN,4 ALANE M. GRAY,4 ARNOLD K. FOWLER,5 and DONALD S. BURKE6
FRANCINE E. PRAPHAN
ABSTRACT
Serosurveys conducted prior to 1988 indicated a very low level of HIV-1 infection in Thailand, even among high-risk groups. The Ministry of Health has reported a dramatic increase in HIV-1 infection during the last three years. The geographic and demographic distribution of the epidemic is broad, involving multiple provinces and risk groups. Foci of higher incidence and prevalence have been noted in the urban center of Bangkok and in the northern provinces of Chiang Mai and Chiang Rai. Here we report the results of genetic characterization of 16 HIV-1 isolates from Thailand using a combination of polymerase chain reaction (PCR) typing and DNA sequencing. The complete sequence of gpl60 (env) of five isolates, partial env sequence of six additional isolates, and the gag gene of two isolates were determined. Two highly distinct HIV-1 variants were found. One variant resembled those prevalent in North America and Europe; live of the isolates were of this type. The remaining eleven isolates were very similar to one another and represented a variant unlike any previously described. Phylogenetic tree analysis of complete env and gag genes placed the two variants on widely separated branches. Protein sequence comparisons indicate both general and specific features that distinguish the Northern Thailand variant both from the Bangkok variant and from virtually all previously sequenced HIV-1 isolates. A simple PCR test for distinguishing the two variants has been developed for use in epidemiologic surveys.
INTRODUCTION to 1986 THE prevalence of HIV infection in Thailand very low. A 1985 serosurvey of 600 individuals from high- and low-risk groups including prostitutes, intravenous drug users (IVDU), patients at sexually transmitted disease (STD) clinics, thalassemia patients, and blood donors found only three positive tests. ' In connection with opportunities for employment abroad, of many thousands of Thai citizens screened for HIV-1 infection in 1986, none were positive.2 Surveys among IVDU in Bangkok3"6 have indicated a dramatic increase in the incidence of HIV infection in the past three
Prior was
years. One study showed prevalence of HIV-1 infection among IVDU increasing from 16 to 44% in eight months during 1988. Other risk behaviors are also associated with HIV-1 infection in Thailand.6,7 A broad-based serosurvey conducted in 1989 showed significant HIV-1 prevalence in IVDU, prostitutes, prisoners, STD clinic attenders, and blood donors. Thirteen of the fourteen provinces included in the survey had HIV-1 prevalence of more than 1% in some groups, and in many provinces groups with more than 10% prevalence of infection were identified. By February 1990, almost 15,000 cases of HIV-1 infection had been documented in Thailand.2 Currently, HIV-1 infection is spreading rapidly in the general population. Accord-
'Henry M. Jackson Foundation Research Laboratory, 1500 E. Gude Drive, Rockville, MD 20850. of Medicine, Chulalongkorn University, Bangkok, Thailand. 2Faculty 3
Armed Forces Research Institute of Medical Sciences and the Royal Thai Army Institute of Pathology, 315/6 Thailand. 4Department of Immunobiology, Genentech, Inc., 460 Pt. San Bruno Blvd., South San Francisco, CA 94080. 5SRA Laboratories, Inc., 13 Taft Court, Rockville, MD 20850. 6Division of Retrovirology, Walter Reed Army Institute of Research, Washington, DC 20307.
1887
Rajvithi Road, Bangkok 10400,
McCUTCHAN ET AL.
1888
ing to a recent report,8 the HIV prevalence among Thai men aged 21 who are entering military service now ranges from 1.1%
in the central and northeastern sectors up to 10.3% in the upper northern provinces. Government and private agencies in Thailand are working to reduce the spread of HIV-1 infection through education and behavioral interventions.9"11 The genetic variability of HI V-1 is an important consideration in the development of antiviral vaccines and therapies. We have studied a panel of 16 HIV-1 isolates from Thailand obtained in 1990. The envelope glycoprotein (env) of HIV-1, which is among the most variable portions of the virus12-15 and is a primary target of the antiviral immune response,16"19 was the main focus of the analysis, but we also studied the more conserved gag polyprotein. Two highly distinct HIV-1 variants were found in Thailand. The possible implications of this broad diversity of virus genotype are discussed.
METHODS Virus isolation Virus isolates in this study were obtained from individuals whose HIV-1 infection was detected by screening ELISA and confirmed by Western blot. Whole blood samples were transported from Thailand for virus isolation and characterization. Peripheral blood mononuclear cells (PBMC) were Ficoll-separated and cocultivated with phytohemagglutinin (PHA) stimulated, donor PBMC in the presence of interleukin-1 (IL-2).20 Virus production was monitored by p24 antigen capture ELISA. Virus isolation was successful from 4 of 4 blood samples from Bangkok and from 13 of 16 samples from Northern Thailand.
Polymerase chain
reaction
Purified DNA from PBMC cocultures served as the template for PCR. Each DNA template was amplified 30 cycles in separate reactions with each of 24 primer pairs in the HIV-1 gag gene as described.21 PCR products were detected by Southern blot hybridization with a ""P-labeled probe common to all of the amplified segments. Radioactivity was quantitated with a Betagen blot analyzer. Reactions yielding product that was less than 5% of positive control reactions on the same blot were noted as examples of template/primer mispairing. DNA from uninfected PBMC was included in each PCR panel and was consistently
negative. Specific primer
combinations for distinguishing the two HIV-1 variants in Thailand were developed based on DNA sequence differences or similarities among the isolates. All sequences are given 5'-3'. Products of primer combinations ThaiOl (sense: AGAAGGCTTTCAGCCCAGAAGT; antisense: TTTGGTCCTTGTCTTATGTCCAGAATGC) and Thai02 (sense: ATGAGGAAGCTGCAGAATGGG; antisense: TTTGGTCCTTGTCTTATGTCCAGAATGC) in the HIV-1 gag gene were detected with probe SK19.22 Products from amplification with primer combination Thia03 (sense: GAACTAAGAGATAAGAAGCAGAAGGTCCAT; antisense: TCCTTCTGCTAGACTGCCATTTA) in the gpl20 gene were detected with the probe TTAAGCCAGTGGTATCAACTCAATTGCTG. Primer combination Thia04 (sense: GTCTGGTATAGTGCAACAGCA;
antisense: GGTGAGTATCCCTGCCTAAC) amplified ment of gp41; the products were detected with the
a
seg-
probe
AGCAATTTGCTGAGGGCTATAGAGGCGCAGCAGC.
Molecular
cloning
For isolates BK132, CM235, CM239, CM242, and CM243, DNA from PBMC cocultures was amplified 30 cycles with primers flanking the env gene of HIV-1. Restriction endonuclease cleavage sites (underlined) were added during amplification and nonhomologous nucleotides are shown in lower case. Primer sequences (5'-3') employed were cgctgaatccAGAGCAGAAGACAGTGGCAATG and tagcgtcgac CTTTCIAAGCCCTGTCT for isolates BK132 and CM243 and cgctgaattc ATGAGAGTGAAGGAGACA and tagcgtcgacGATTCTTCTAGGTATGTGG for isolates CM235, CM239, and CM242, respectively. Cloning was in pBluescript II KS and bacterial colonies were screened with 32P-labeled env probe SK70.22 The majority of the clones obtained were full length as evaluated by restriction analysis of plasmid DNA. For isolates CM241 and CM244, nested PCR was used to amplify and clone the gpl20 portion of env starting with DNA from PBMC cocultures. Primers gggaattcggatccAGAGCAGAAGACAACAGTGGCAATGA and ccagatcttcgaaat CGGGTATCACGAACCACGACGAGG were employed for 25 PCR cycles. Second round (25 cycles) primers were gggaattcggatccGGGGTACCTGTRTGGAARGAAGCA and ccagatcttcgaatACGAGGRTTCTTGGGTTCCTTGT. The PCR product was blunted with T4 DNA polymerase, digested with restriction endonuclease Kpnl (underlined), purified on low-melt agarose (Seaplaque) and cloned into M13mpl9 digested with Kpnl and Hindi. These clones encode all of gpl20 except the first 12 amino acids of the mature glycoprotein. For some isolates, PCR was used to amplify a 450 bp segment encompassing the V3 loop portion oï env. Primers for amplification of this segment were sense: ctaggaattcTACAATGTACAGATGGAATTAGGCCAGTAG and antisense: gtacgaattcTTTAATTGTGGAGGGGAATTTTTCT. The probe used for
screening was AACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAG. The HIV-1 gag gene was PCR amplified and cloned from isolates BK132 and CM243. The primers used were gatcgaattcGACTAGCGGAGGCTAGAAG and tcgagaattcAGGGGTCGTTGCCAAAGA; probe SK19 was used for screening.
DNA
sequencing For sequencing of isolates BK132, CM235, CM239, CM242, and CM243, plasmid DNA from positive clones was purified using column chromatography (Quiagen Corp.) and quantitated by optical density at 260 nm. PCR cycle sequencing reactions using fluorescent primers or terminators (Applied Biosystems) were performed according to the manufacturer's procedures. Sequence data was collected with an Applied Biosystems 373A DNA sequencer. For isolates CM241 and CM244, single stranded templates of M13mpl9 clones were prepared by standard techniques and sequenced with a Sequenase Sequencing Kit (USB Corp.). With minor exceptions, all of the sequence were confirmed by sequencing both strands of the DNA. Sequence data were analyzed using DNAstar software on Mac-
data
intosh computers.
DNA SEQUENCING AND PCR TYPING OF HIV-1 ISOLATES FROM THAILAND
1889
RESULTS HIV-1 Isolate
Virus isolates The HIV-1 isolates included in this study were obtained from two geographic regions of Thailand and from individuals with different risk behaviors. Four isolates were obtained in Bangkok in January 1990 from individuals whose most likely route of HIV infection was intravenous exposure; three were injecting drug users while the fourth had apparently a transfusion prior to the implementation of routine HIV-1 screening for blood donors. Twelve isolates were from a Northern Province in Thailand. These were obtained in December, 1990 from young men who were randomly selected for national service and who had tested HIV-1 positive. Individuals in this second group reported sexual contact with prostitutes as their main risk factor for HIV-1 infection. Virus isolates from Bangkok were designated BK129BK132, inclusive, and those from Northern Thailand were designated CM235-CM246, inclusive.
PCR
* i¿ i¿ *
S
Northern Thailand
_Variant_ Bangkok Variant
xxxxxxxxxxx xxxxx
[ ][ ji ][ ][ ][ ][ j[ ]
[X
I [ Primer Pair
[ :i x ][ II ][ ][ i
]
] ][ [ [ I [ II
it ][ 1
[IMIIXI
[I I I ][ ][ ][ ][ X )[ ][ ][ ][
typing of isolates
We have developed a rapid procedure for genetic comparison of isolates by PCR21 and have used this procedure for identification and characterization of divergent HIV-1 isolates from many worldwide locales.23,24 Sixteen HIV-1 isolates from Thailand were characterized by PCR typing. Twenty-four primer pairs in the gag gene were used in separate reactions to amplify DNA from virus cultures. PCR products were detected by hybridization with 32P-labeled probes and quantitated. Individual reactions with product yields falling below a previously established cutoff, which indicates mispairing of a specific primer with the template DNA, were noted for each isolate. The results of the 384 individual PCR amplifications are shown in Figure 1. Five of the isolates exhibited a pattern similar to that observed for most North American isolates23 in that template DNA from the cultures could be amplified with at least 21 of the 24 primer combinations used. The remaining 11 isolates showed numerous instances of decreased PCR product indicative of template/primer mispairing. Primer pairs 5, 7, 11, 18, 20, 23, and 24 were largely unable to amplify these samples, and other primer combinations showed a sporadic pattern of failure. Primer combinations 4, 8, 9, 10, 16, and 19 consistently amplified these same isolates, establishing that adequate HIV-1 DNA was present in all the samples. These results indicate that HIV-1 variants found in Thailand were not homogeneous, but formed two divergent groups. They have been termed Northern Thailand variant ( 11 isolates) and Bangkok variant (5 isolates) pending a broader epidemiological surveillance of strains.
Comparison of gag polyprotein genes To determine the phylogenetic relationships of the two vari-
1.5 Kb DNA segment encoding the gag polyprotein was Northern Thailand variant CM243 and Bangkok variant BK132 (Fig. 1) were selected for analysis. The gag genes recovered from both isolates were found to be complete and free of alterations that would interrupt coding regions. The sequences were aligned and compared with each of the previously reported HIV-1 gag genes25 (Table 1). The Bangkok variant was more similar to those from North America than to ants,
SSSSSSSSS5S
uuuuuuuuuuu cocaoaoau
a
sequenced.
[xxxxx xx xxx ]«[][: [XXX ][][]!][][ xx :í:mi: FIG. 1.
PCR typing of HIV-1 isolates from Thailand. FicollPBMC from HIV-1+ individuals were cocultivated with donor PBMC. DNA from the cultures was isolated, purified, and used an template in PCR reactions at 10 u,g/ml. Amplification in individual reactions with each of 24 primer pairs in the HIV-1 gag gene was performed as described previously.21 Product from each reaction was separated in 1% agarose gels and detected by Southern blot hybridization with a 32P-labeled probe. Radioactivity was quantitated with a Betagen blot analyzer. Reactions exhibiting 5% or less product than control, positive reactions were scored as "mispaired," according to previously established criteria. Filled squares designate mispaired primer/template combinations.
separated
those from other locales. The Northern Thailand variant was not highly related to any previously sequenced isolate. Its best homology was 86.2% with a Ugandan isolate. The Bangkok and Northern Thailand variants were the least related among sequenced isolates, showing homology in gag of 73.8%. Much of the DNA sequence diversity between the two gag genes resulted in protein alterations. The protein sequences showed 71.8% homology (data not shown). The most divergent pair of HIV-1 isolates in the current database, HIV-1U455 from Uganda and HIV-1MN from North America, have a gag protein similarity index of 80.8%. There was relative conservation of the p24 protein but extensive divergence in the carboxy terminal portion of pl7, in p7, and in p6. These results indicate that the two HIV-1 variants from Thailand are highly divergent, exceeding previously reported variability in the HIV-1 gag gene.
Analysis of the envelope glycoprotein The envelope glycoprotein (env) of HIV-1 is among the most variable portions of the virus and is a primary target of the antiviral immune response. Evaluation of the potential impact of
1890
McCUTCHAN ET AL.
1 3
tu
23
-3
