Reproductive Sciences http://rsx.sagepub.com/
Genetic Polymorphisms in Pakistani Women With Polycystic Ovary Syndrome Irfana Liaqat, Nusrat Jahan, Graciela Krikun and Hugh S. Taylor Reproductive Sciences published online 6 August 2014 DOI: 10.1177/1933719114542015 The online version of this article can be found at: http://rsx.sagepub.com/content/early/2014/08/04/1933719114542015
Published by: http://www.sagepublications.com
On behalf of:
Society for Gynecologic Investigation
Additional services and information for Reproductive Sciences can be found at: Email Alerts: http://rsx.sagepub.com/cgi/alerts Subscriptions: http://rsx.sagepub.com/subscriptions Reprints: http://www.sagepub.com/journalsReprints.nav Permissions: http://www.sagepub.com/journalsPermissions.nav
>> OnlineFirst Version of Record - Aug 6, 2014 What is This?
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
Original Article
Genetic Polymorphisms in Pakistani Women With Polycystic Ovary Syndrome
Reproductive Sciences 1-11 ª The Author(s) 2014 Reprints and permission: sagepub.com/journalsPermissions.nav DOI: 10.1177/1933719114542015 rs.sagepub.com
Irfana Liaqat1,2, Nusrat Jahan, PhD1, Graciela Krikun, PhD2, and Hugh S. Taylor, PhD2
Abstract Polycystic ovary syndrome (PCOS) is the major cause of anovulatory infertility. Although the genetic basis of PCOS is not well understood, it is a common metabolic and endocrine disorder. This study investigates the possible genomic variants associated with PCOS in Pakistani women from the Punjab region. DNA samples from 96 patients with genetically unrelated PCOS and 96 controls were analyzed by direct sequencing to determine the polymorphisms of different loci on follicle-stimulating hormone receptor (fshr), follicle-stimulating hormone b (fshrb), luteinizing hormone chorionic gonadotropin (lhcgr), luteinizing hormone b (lhb), estrogen receptor a (esr1), and estrogen receptor b (esr2) genes. Significant associations were observed within the genotype frequencies, allele frequencies, and multi-single-nucleotide polymorphism (SNP) haplotype analysis of most polymorphisms studied. This study identified new SNPs at positions 605þ52 Del/T in lhcgr genes occurring in this particular subpopulation. The strong r2 value suggests that polymorphisms in the fshr and esr1 genes were in linkage disequilibrium. Our study provides evidence of statistically significant associations between susceptibility to PCOS in Pakistani women and the gene polymorphisms mentioned earlier. This suggests that the susceptible loci for PCOS lie within or very close to the chromosomal regions spanning these genes. Keywords polycystic ovarian syndrome (PCOS), single-nucleotide polymorphisms (SNPs)
Introduction Polycystic ovary syndrome (PCOS) is the most common ovarian disorder and is associated with obesity, anovulation, hyperandrogenism, hirsutism, and infertility that affect 6% to 10% of reproductive-age women worldwide1 and accounts for 70% of cases of anovulatory infertility.2 The syndrome was first described by Stein and Leventhal in 1935.3 The etiology of PCOS is still not clear. Some genetic and hormonal factors have been implicated for the pathogenesis of PCOS including altered ovarian synthesis of steroids, hyperinsulinemia, aberrant folliculogenesis, abnormal secretion of gonadotropin, and neuroendocrine abnormalities.1 Among different criteria for the diagnosis of PCOS, the most widely used are the Rotterdam criteria (2004). These include any form of hyperandrogenemia, either clinical (hirsutism and acne) or endocrine (high level of androgens), oligomenorrhea, and the determination of polycystic ovaries by ultrasound examination. The diagnosis can be made if 2 of 3 criteria are met.4 The fact that there are 3 major criteria makes PCOS a heterogeneous disease. The search for PCOS-susceptible genes has been focused mainly on polymorphisms of genes encoding sex hormones and regulatory proteins like follicle-stimulating hormone b (FSHB), follicle-stimulating hormone receptor (FSHR), estrogen receptor a (ESR1), and estrogen receptor b (ESR2).5-8
Various genetic markers have been implicated in the predisposition to PCOS; however, no single variant has conclusively and repeatedly been associated with the syndrome.9 Follicle-stimulating hormone (FSH) is a pituitary glycoprotein that plays an important role during folliculogenesis by promoting the proliferation and differentiation of granulosa cells and maturation and development of follicles.10 The effect of FSH is mediated by binding to a specific FSHR that is situated on the granulosa cells of the ovary.11 Because of the important role of FSHR signaling, the FSHR gene may be a candidate gene for PCOS. A previous genome-wide association study in Chinese women with PCOS identified a region on chromosome 2p16.3 that encodes the fshr gene as a reproducible susceptible locus for PCOS.12 Also, the study on European ancestry concludes that the gene products of luteinizing hormone choriogonadotropin receptor (LHCGR) and FSHR are likely to be
1
Department of Zoology GC University, Lahore, Pakistan Department of Obstetrics, Gynecology and Reproductive Sciences, Yale University School of Medicine, New Haven, CT, USA 2
Corresponding Author: Irfana Liaqat, Department of Zoology, GC University Lahore, Lahore, Pakistan. Email: [email protected]
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
2
Reproductive Sciences
important in the etiology of PCOS, regarding ethnicity.13 The FSHR gene contains 2 polymorphisms in exon 10, which are in linkage disequilibrium (LD). This leads to a change in 2 amino acids at position A370T and N680S. A370T rs6165 in the extracellular domain of FSHR is the site responsible for high affinity hormone binding.14,15 Previous genetic studies have examined the association between fshr gene polymorphism and PCOS.16-18 Earlier findings also showed an association of genomic variants of fshr gene with PCOS susceptibility. Estrogens play a significant role in the development and function of the reproductive system. The main mediators of estrogen action are 2 specific high-affinity receptors, the ESR1 and ESR2, both of which are members of the nuclear receptor superfamily and act as ligand-activated transcription factors. The ESR1 and ESR2 receptors are necessary for the proper function of the hypothalamic–pituitary–ovarian axis and are expressed in the human ovary, where ESR2 is the predominant receptor and its activation enhances folliculogenesis and ovulation.19 Furthermore, the expression of ESR2 is lower in follicles derived from women with PCOS compared with healthy women. In contrast, ESR1 expression is markedly increased in theca cells of polycystic ovaries, causing alteration in the ESR1–ESR2 ratio in PCOS and possibly abnormal follicular development.20 Based on these observations, variants of ESR1 and ESR2 may be implicated in the pathogenesis of PCOS. A number of polymorphic sites in esr1 and esr2 have been identified with the most widely studied being rs2234693 and rs9340799 polymorphism in esr1 and rs4986938 in esr2. The lhcgr gene encodes a receptor for luteinizing hormone (LH) and human chorionic gonadotropin (hCG), and mutations in lhcgr were associated with infertility.21 The effect of LH is mediated by LH receptor (LHR) which is expressed in the theca cells and granulosa cells.22 Abnormal LH signaling is believed to play a permissive role in augmenting ovarian androgen production in PCOS increasing the likelihood of anovulation.23 Studies have shown that lhb and lhr gene mutations may change the structure or function of the LH and LHR, either activating or inactivating their bioactivity, which cause anovulation, amenorrhea, and polycystic ovaries in women.24,25 There is compelling evidence for the genetic influence of lhb and lhr on the development of PCOS, although the results in different populations and loci show inconsistencies. In this study, we examine the association of genetic polymorphisms with PCOS in Pakistani women. This population has never been studied before. We posit that the putative functional significance of 11 different polymorphisms on the fshr, fshb, lhcgr, lhb, lhcgr, lhb, esr1, and esr2 genes is linked to the development of PCOS.
hospital Lahore and Lady Willington hospital, Lahore). The women were referred from clinics, hospitals, and physicians from all over the Punjab province. Written informed consent was obtained from each patient as approved by the Research Ethics Committee of the hospitals. The anthropometric data of all the patients were collected and every individual was assessed after registering their medical history. Ninety-six healthy Pakistani women from Punjab with regular menses, history of spontaneous conception, and without hyperandrogenemia (hirsutism and virilism) volunteered as controls.
Inclusion and Exclusion Criteria Inclusion of patients was based on a diagnosis of PCOS according to the Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group, 2004.4 Hence, diagnostic criteria included women who displayed 2 of the following 3 criteria: oligo- or anovulation, clinical and/or biochemical signs of hyperandrogenism, and polycystic ovary morphology. We enrolled only women who displayed polycystic ovaries by ultrasound to ensure that the phenotype was definitely PCOS. Exclusion criteria included patients treated for infertility, that is, in vitro fertilization, gonadotropins, aromatase inhibitors, clomiphene, or steroids (including oral contraceptives). Also excluded were patients receiving medications that are known to alter insulin secretion/ action or normal function of the hypothalamic–pituitary–gonadal axis in the last 6 months. Patients with any other known cause of oligomenorrhea or hyperandrogenism, that is, hyperprolactinemias, congenital adrenal hyperplasia, hypothyroidism, hyperthyroidism, Cushing syndrome, virilizing ovarian, or adrenal tumors were also excluded. The body mass index (BMI) of each patient was calculated as weight (kg)/(height in m).2
Interviews and Physical Examinations All participants completed a structured questionnaire covering family history, education level, weight and height, waist and hip circumference (WHR), patient’s medical, gynecological, and surgical history. Complete physical examination including ultrasonography was conducted. Eligible controls were genetically unrelated and were matched on the bases of age and residential area to minimize possible selection bias. Hence, all patients had the same ethnicities and similar socioeconomic status. Patients were recruited by gynecologists who had reviewed the patient’s medical records to determine that eligibility criteria were met. The patients and controls were age matched.
Genotyping and DNA Sequencing Blood Sampling and DNA Extraction
Materials and Methods Patients Ninety-six Pakistani women with known infertility were recruited from the outpatient’s infertility clinics of Obstetrics/Gynecology wards of tertiary hospitals (Sir Ganga Ram 2
Blood samples were obtained from women for biochemical assays and DNA sequencing analysis at 2 to 3 days after the start of menstruation. Blood samples for molecular genetic studies were collected in tubes containing EDTA as an anticoagulant and were stored at 4 C. Genomic DNA was then
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
Liaqat et al
3
extracted from the blood of patients with PCOS and normal controls using a standard extraction method.26
Candidate Genes We chose 6 candidate genes that have been implicated in the etiology of PCOS (Table 1). These 6 genes map to 6 distinct chromosomal locations. The common variants in 6 regions, 2p16.3, 2p21, 6q25.1, 11p14.1, 14q23.2, and 19p13.33, were analyzed. Detection of single-nucleotide polymorphism (SNP) of fshr, fshb,, lhcgr, lhb, esr1, and esr2 are shown in Table 1. The National Center for Biotechnology Information reference sequence assembly used for chromosome position, gene ID, and gene symbol is GRCh37.p5 with build 37.3. Also, following the nomenclature guidelines recommended by the Human Genome Variation Society, the coding reference position of the relevant DNA used along with the Ensemble accession file was reported in Table 1.
Polymerase Chain Reaction Analysis The sequences of the polymerase chain reaction (PCR) primers and cycling conditions are described in Table 2. Polymerase chain reaction was carried out in a total volume of 25 mL reaction mixtures consisting of 50 to 100 ng of DNA template, 10 mmol of each primer, 10 PCR buffer containing 15 mmol/L MgCl2, 10 mmol/L deoxynucleotide triphosphate (dNTP), and 5 U/mL Hot star Taq DNA polymerase (Qiagen, Hilden Germany). We used a control without DNA in order to check for contamination.
Gel Electrophoresis and Verification of PCR Products Polymerase chain reaction products were visualized by ethidium bromide staining on a 2% agarose gel (Sigma Aldrich, St. Louis, Missouri). The identities of the PCR products were verified by DNA sequencing.
Statistical Analysis A chi-square test was used to test for Hardy–Weinberg equilibrium in cases and controls by comparing the observed genotype frequencies to the expected ones. The maximum likelihood haplotype frequency estimates and standard errors were computed using the HAPLO software,27 which implements the expectation-maximization (E-M) algorithm of Dempster et al.28
Results Population Characteristics The selected anthropometric characteristics of the study population are summarized in Table 3. Women with PCOS had higher mean BMI value (31.10 + 1.47) than that of controls (30.49 + 1.66; P ¼ .001). The waist–hip ratio in PCOS was 1.16 + 0.07 and in controls 1.12 + 0.05. However, the mean age of menarche was not different among the groups. The proportion of obese women within the PCOS and control groups was 96.90% and 95.%, respectively (P < .0001).
Genotype and Allele Frequencies The genotype distribution and relative allele frequencies of all the studied polymorphism of 96 patients with PCOS and 96 controls are shown in Table 4. This table illustrates the number of relative genotypes (n), percentage of genotype (%), allele frequencies and their percentage, estimated heterozygosity, chi-square value (w2), and odd ratios (OR) at 95% confidence interval (CI) along with the P values. The genotype frequencies of all the SNPs fit the Hardy-Weinberg principle in both PCOS and controls; nonsignificant P values suggest that alleles are in equilibrium (Table 4). The LHCGR on chromosome region 2p16.3 was analyzed for rs61996318 polymorphism. The heterozygotes CA were greater in PCOS (16.6%) than in controls (7.2%; P ¼ .03).
New SNPs in lhcgr and esr1 DNA Sequencing The amplification products were purified with Qiaquick PCR purification kit and subjected for direct sequencing with either the forward or the reverse primers (Qiagen, Hilden Germany). The DNA concentration and purity were measured using an absorbance ratio of 260/280 nm by nanodrop (Thremoscientific, 2000, Waltham, Massachusetts). DNA sequencing was carried out with the Applied Biosystem, 3730xL capillary instruments at Keck Biotechnology Resource Laboratory Yale University (West Haven, Connecticut). The Sanger chemistry for this platform involves dideoxy terminators (di dNTPs) tagged with a difference fluorescent dye (Big Dye Terminators, Qiagen Inc), along with AmpliTaq polymerase. The sample undergoes cycle sequencing in a thermocycler and then the product is bead purified with Beckman Coulter Clean SEQ particles (Applied Biosystem, New Haven, Connecticut).
The lhcgr PCR product displayed a new SNP at 605þ52delT coding reference position (ensemble ENST00000294954), where there was a loss of base ‘‘A’’ in which the gene sequence changes from GCC to GAG. In the PCOS group, there were 28 homozygotic variants in this new SNP, and in the controls, there were 6 (P .001, OR ¼ 2.61, 95% CI ¼ 1.69-4.03). Heterozygotes Del/A were greater in patients (50%) than in controls (36.4%) increasing the risk of disease (P .001; Table 4). A statistically significant higher frequency of the ‘‘missing’’ allele was observed in patients versus controls (54.2% vs 24.5%). For the esr1 gene, the rs2234693 polymorphism is characterized by a T!C transition 397 nucleotides upstream in the intron. The rs9340799 polymorphism marks an A!G transition 351 nucleotides upstream in intron one. In rs2234693, the frequency of mutant allele ‘‘C’’ was 47.4% in the patients and
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
3
4
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
2100 2488
ESR2 Gonadotropin FSHB action FSHR
3972
Estrogen receptor b Follicle-stimulating hormone b subunit Follicle-stimulating hormone receptor Luteinizing hormone choriogonadotropin receptor Luteinizing hormone b
Estrogen receptor a
rs1800447 rs4002462
rs6166 rs6165 rs61996318 rs111834744
rs2234693 rs8179176 rs9340799 rs4986938 rs6169
dbSNP
14q23.2 11p14.1
6q25.1
Chr
C>T A>G
g.49189921 g.49191041 g.48941162 g.48941073
g.152163335 g.152163334 g.1521633381 g.64699816 g.30255185
c.82T>C c.16-26T>C
c.2039G>A c.919G>A c.568C>A c.605 þ 52delT
c.453-397T>C c.453-398C>T c.453-351A>G c.*1859G>A c.228C>T
Coding DNA Chromosomal Reference Position Position
19q13.33 g.49519905 g.49519997
A>G 2p16.3 A>G G>T 2p21 DEL>A
C>T C>T A>G G>A C>T
Ref SNP Alleles
Gene Mode
ENST00000221421 Missense Intron
ENST00000440973 Intron Intron Intron ENST00000557772. UTR-3 ENST00000417547. CdsSynon ENST00000406846 Missense Missense ENST00000294954 Missense Intron
Ensembl Accession
28
680 307 190
76
Trp-Arg
Ser-Asn Ala-Thr Gln-Lys
Tyr-Tyr
Protein Residue Position Change
Abbreviations: PCOS, polycystic ovary syndrome; FSHR indicates follicle-stimulating hormone receptor; FSHB, follicle-stimulating hormone b; ESR, estrogen receptor; LHCGR, luteinizing hormone chorionic gonadotropin receptor; LHB, luteinizing hormone b; dbSNP, single nucleotide polymorphism database; Chr, chromosome; UTR, untranslated region; Tyr, tyrosine; Ser, serine; Ala, alanine; Thr, threonine; Gln, glutamine; Lys, lysine; Trp, tryptophan; Arg, arginine.
LHB
LHCGR 3973
2492
2099
Gene ID Candidate Gene
ESR1
Steroid hormone
Marker Locus
Gene Symbol
Table 1. Genotyping Panel for 6 PCOS Candidate Genes.
Liaqat et al
5
Table 2. Primer, Annealing Temperature, PCR Program, and Product Size. Annealing PCR Temperature Program (35 Product ( C) Cycles) Size (nt)
Gene Name (ID)
Polymorphism Location Base rs Number Change
FSHR (2492)
rs6166
Exon 10 A>G
F: GCAAGTGTGGCTGCTATGAA R: GTGACATACCCTTCAAAGGC
55 C
rs6165
Exon 10 A>G
F: CCTGCACAAAGACAGTGATG R: TGGCAAAGACAGTGAAAAAG
55 C
FSHB (2488)
rs6169
Exon 3
F: TGTTAGAGCAAGCAGTATTCAATTTCT R: GTATGTGGCCTGAAATGTCCACTGATC
60 C
LHCGR (3973)
rs61996318
Exon G>T
F: TGATGGTGGTGGTGATGATG R: GGTTTCTAGCCAGCCAGTTG
60 C
rs111834744
Intron DEL>A
LHB (3972)
rs1800447
Exon 2 G>A
F: TGATGGTGGTGGTGATGATG R: GGTTTCTAGCCAGCCAGTTG F: GTCTCAGACCTGGGTGAAGC R: GCACAGATGGTGGTGTTGAC
ESR1 (2099)
rs4002462 rs2234693
Exon 2 A>G Intron 1 C>T
ESR2 (2100)
rs9340799 rs4986938
Intron 1 A>G UTR0 A>G
Primer Sequence
95 C 15 min, 95 C 1 min 55 C 1 min, 72 C 1 min 95 C 15 min, 95 C 1 min 55 C 1 min, 72 C 1 min 95 C 15 min, 94 C 1 min 60 C 30 sec, 72 C 1 min 95 C 15 min, 94 C 1 min 60 C 40 Sec, 72 C 1 min
231
58 C
95 C 15 min, 94 C 45 sec 58 C 45 sec, 72 C 45 sec
185
Same as for rs1800447 F: CTGCCACCCTATCTGTATC R: ACCCTGGCGTCGATTATCT
53 C
95 C 15 min, 95 C 45 sec 53 C 45 sec, 72 C 1 min
Same as for rs2234693 F: CGGCAGAGGACAGTAAAAGC R: TGAGAGTTGGGAAGGTGGAG
58 C
95 C 15 min, 94 C 45 sec 58 C 45 sec, 72 C 45 sec
577
357
379
213
Abbreviations: FSHR indicates follicle-stimulating hormone receptor; FSHB, follicle-stimulating hormone b; ESR, estrogen receptor; LHCGR, luteinizing hormone chorionic gonadotropin receptor; LHB, luteinizing hormone b; UTR, untranslated region; PCR, polymerase chain reaction; nt, nucleotide; min, minutes; sec, seconds.
Table 3. Anthropometric Characteristics of Patients and Controls. PCOS Characteristics
Mean + SD
Age BMI WHR Age of menarche Gynecological history
26.87 31.10 1.16 13.09
+ 4.42 + 1.47 + 0.07 + 1.06
n ¼ 96 Oligomenorrhea Less than 9 menses per year H/O irregular menses with weight gain Patient symptoms Infertility Weight gain Hirsutism Facial hair
Control
Confidence Level (95.0%) 0.89 0. 0.28 0.01 0.21 %
Mean + SD 26.02 + 30.49 + 1.12 + 13.07 +
3.521 1.66 0.05 1.522
Confidence Level (95.0%)
P
0.56 0.0.33 0.01 0.02
G) Exon 10
rs6165 (A>G) Exon 10
LHCGR rs61996318 (C>A) Exon
rs111834744 (D>T) Intron
LHB rs1800447 (C>T) Exon
rs4002462 (A>G) Intron
Genotype Frequencies TT CT CC C Allele T Allele E(HET) AA AG GG Allele frequency A Allele G Allele E(HET) AA AG GG Allele frequency A Allele G Allele E(HET) CC CA AA Allele frequency C Allele A Allele E(HET) TT DT DD Allele frequency T Allele D Allele E(HET) CC TC TT Allele frequency A Allele G Allele E(HET) AA AG GG Allele frequency A Allele G Allele E(HET)
Control (n ¼ 96)
n
%
n
%
w2
OR
95% CI
P
42 42 12 66 126
43.7 43.7 13.5 34.4 65.6 45
26 51 19 89 103
27.0 53.1 19.7 46.4 53.6 50
5.24
2.09
1.14-3.83
.020
29 47 20
30.2 48.9 20.8
24 47 25
25.0 48.9 26.0
0.85
1.23
0.85-1.84
.350
105 87
54.7 45.3 50.0 28.1 48.9 22.9
95 97
49.5 50.5 50.0 22.9 51.0 26.0
0.51
1.18
0.79-1.76
.470
101 91
52.6 47.4 50.0
93 99
48.4 51.6 50.0
79 16 1
82.2 16.6 1.0
89 7 0
92.7 7.2
4.28
2.73
1.16-6.70
.030
174 18
90.6 9.4 17.0 20.8 50.0 29.1
185 7
96.4 3.6 7.0 57.2 36.4 6.2
18.27
2.610
1.69-4.03
.001
88 104
45.8 54.2 50.0
145 47
75.5 24.5 37.0
80 15 1
83.3 15.6 1.0
88 8 0
91.7 8.3 0.0
2.15
3.09
0.83-11.62
.120
183 9
95.3 4.7 9.0 90.6 9.4 0.0
189 3
98.4 1.6 3.0 96.9 3.1 0.0
2.74
2.23
0.94-5.30
.090
91.1 8.9 16.0
184 8
27 47 22
20 48 28
87 9 0 175 17
22 49 25
55 35 6
93 3 0
95.8 4.2 8.0 (continued)
6
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
Liaqat et al
7
Table 4. (continued) PCOS (n ¼ 96) Polymorphism ESR1 rs2234693 (C>T) Intron 1
rs9340799 (G>A) Intron 1
rs8179176 (C>T) Intron 1
ESR2 rs4986938 (G>A) UTR-3
Control (n ¼ 96)
Genotype Frequencies
n
%
n
%
w2
OR
95% CI
P
TT CT CC Allele frequency C Allele T Allele E(HET) AA GA GG Allele frequency G Allele A Allele E(HET) CC CT TT Allele frequency C Allele T Allele E(HET)
27 47 22
28.1 49.0 22.9
43 43 10
44.8 44.8 10.4
7.90
1.84
1.22- 2.79
.005
91 101
47.4 52.6 49.0 29.2 49.0 21.9
63 129
32.8 67.2 45.0 43.8 44.8 11.5
5.74
1.68
1.12- 2.55
.010
46.4 53.6 49.0 74.0 24.0 2.1
65 127
7.66
2.97
1.40-6.34
.006
165 27
85.9 14.1 24.0
182 10
94.8 5.2 10.0
33 46 17 112 80
34.4 47.9 17.7 58.3 41.7 48.0
50 39 7 139 53
52.1 40.6 7.3 72.4 27.6 41.0
7.78
1.87
1.22-2.87
.005
GG AG AA G Allele A Allele E(HET)
28 47 21 89 103 71 23 2
42 43 11
86 10 0
33.9 66.1 45.0 89.6 10.4 0.0
Abbreviations: E(HET), expected heterozygosity value for the polymorphism, w2, chi-square; CI, confidence interval; PCOS, polycystic ovary syndrome; FSHR indicates follicle-stimulating hormone receptor; FSHB, follicle-stimulating hormone b; ESR, estrogen receptor; LHCGR, luteinizing hormone chorionic gonadotropin receptor; LHB, luteinizing hormone b; UTR, untranslated region; OR, odds ratio. a There were no statistically significant deviations from Hardy-Weinberg.
32.8% in the control group (P < .005). We also found statistically significant differences in the genotypes and allele frequencies between PCOS and control groups for rs9340799 (P < .01, OR ¼ 1.45, 95% CI ¼ 0.96-2.190, w2 ¼ 3.52). A new SNP rs8179176 was found during the screening of DNA sequencing map of esr1 gene. The heterozygotes CT were greater in patients (24%) than in controls (10.4%). The frequency of ‘‘T’’ allele was 14.1% in the patients and 5.2% in the control group (P < .006, OR ¼ 2.978, 95% CI ¼ 1.3996.340, w2 ¼ 7.657). This suggested that these genetic variants are related in the occurrence of PCOS in Pakistani women from the Punjab province. The esr2 gene was studied for polymorphism rs4986938 which is a G!A change at position 1859 in the 3 0-untranslated region of exon 8. The mutant allele ‘‘A’’ had a significantly higher frequency among the cases (41.7%) compared to the controls (27.6%) yielding an odds ratio of 1.873 (CI 1.22-2.87; P ¼ .005, w2 ¼ 7.776). The homozygous GG genotype was more frequent in controls (52.1%) than in PCOS (34.4%; P ¼ .005, OR ¼ 1.87, 95% CI ¼ 1.22-2.87; Table 4).
The FSHB gene was analyzed for SNP rs6169 T/C in exon 3. Genotype and allele frequencies were significantly different for PCOS and controls. A statistically significant higher frequency of the ‘‘T’’ allele was observed in patients than in controls (Table 4). The frequency of ‘‘C’’ (34.4% in PCOS and 46.4% in control) and ‘‘T’’ (65.6% in PCOS and 53.6% in control) allele differs significantly in PCOS and control groups (P ¼ .020, OR ¼ 1.650, 95% CI ¼ 1.093-2.489). No statistically significant differences were observed for genotype distribution and allele frequencies between PCOS and controls for fshr polymorphisms rs6165, rs6166, and lhb polymorphisms rs1800447 and rs4002462 (P > .05).
Haplotype and LD Haplotype estimation analysis of SNPs genotype data revealed that the estimated overall haplotype frequencies in PCOS and control groups differ significantly (Table 5 and Figure 1). So the null hypothesis of the 2 groups being the same in haplotype frequency distributions is strongly rejected. Four major haplotypes of fshr were present in the study population (Table 5).
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
7
8
Reproductive Sciences
Table 5. Multi-SNP Haplotypes Distribution and Their Associations With Risk of PCOS in Pakistani Women.a Haplotype Frequencies + SEE Haplotypes FSHR AA GG GA AG LHCGR TC DC TA DA LHB AC AT GC ESR1 AT AC GT GC
PCOS
Control
Genetic Heterogeneity Test
Expected Heterozygosity
Chi-square
df
P
PCOS
Control
0.504 0.431 0.022 0.043
+ 0.036 + 0.036 + 0.028 + 0.028
0.305 0.326 0.179 0.190
+ 0.042 + 0.038 + 0.037 + 0.035
58.3
3
Genetic Polymorphisms in Pakistani Women With Polycystic Ovary Syndrome Irfana Liaqat, Nusrat Jahan, Graciela Krikun and Hugh S. Taylor Reproductive Sciences published online 6 August 2014 DOI: 10.1177/1933719114542015 The online version of this article can be found at: http://rsx.sagepub.com/content/early/2014/08/04/1933719114542015
Published by: http://www.sagepublications.com
On behalf of:
Society for Gynecologic Investigation
Additional services and information for Reproductive Sciences can be found at: Email Alerts: http://rsx.sagepub.com/cgi/alerts Subscriptions: http://rsx.sagepub.com/subscriptions Reprints: http://www.sagepub.com/journalsReprints.nav Permissions: http://www.sagepub.com/journalsPermissions.nav
>> OnlineFirst Version of Record - Aug 6, 2014 What is This?
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
Original Article
Genetic Polymorphisms in Pakistani Women With Polycystic Ovary Syndrome
Reproductive Sciences 1-11 ª The Author(s) 2014 Reprints and permission: sagepub.com/journalsPermissions.nav DOI: 10.1177/1933719114542015 rs.sagepub.com
Irfana Liaqat1,2, Nusrat Jahan, PhD1, Graciela Krikun, PhD2, and Hugh S. Taylor, PhD2
Abstract Polycystic ovary syndrome (PCOS) is the major cause of anovulatory infertility. Although the genetic basis of PCOS is not well understood, it is a common metabolic and endocrine disorder. This study investigates the possible genomic variants associated with PCOS in Pakistani women from the Punjab region. DNA samples from 96 patients with genetically unrelated PCOS and 96 controls were analyzed by direct sequencing to determine the polymorphisms of different loci on follicle-stimulating hormone receptor (fshr), follicle-stimulating hormone b (fshrb), luteinizing hormone chorionic gonadotropin (lhcgr), luteinizing hormone b (lhb), estrogen receptor a (esr1), and estrogen receptor b (esr2) genes. Significant associations were observed within the genotype frequencies, allele frequencies, and multi-single-nucleotide polymorphism (SNP) haplotype analysis of most polymorphisms studied. This study identified new SNPs at positions 605þ52 Del/T in lhcgr genes occurring in this particular subpopulation. The strong r2 value suggests that polymorphisms in the fshr and esr1 genes were in linkage disequilibrium. Our study provides evidence of statistically significant associations between susceptibility to PCOS in Pakistani women and the gene polymorphisms mentioned earlier. This suggests that the susceptible loci for PCOS lie within or very close to the chromosomal regions spanning these genes. Keywords polycystic ovarian syndrome (PCOS), single-nucleotide polymorphisms (SNPs)
Introduction Polycystic ovary syndrome (PCOS) is the most common ovarian disorder and is associated with obesity, anovulation, hyperandrogenism, hirsutism, and infertility that affect 6% to 10% of reproductive-age women worldwide1 and accounts for 70% of cases of anovulatory infertility.2 The syndrome was first described by Stein and Leventhal in 1935.3 The etiology of PCOS is still not clear. Some genetic and hormonal factors have been implicated for the pathogenesis of PCOS including altered ovarian synthesis of steroids, hyperinsulinemia, aberrant folliculogenesis, abnormal secretion of gonadotropin, and neuroendocrine abnormalities.1 Among different criteria for the diagnosis of PCOS, the most widely used are the Rotterdam criteria (2004). These include any form of hyperandrogenemia, either clinical (hirsutism and acne) or endocrine (high level of androgens), oligomenorrhea, and the determination of polycystic ovaries by ultrasound examination. The diagnosis can be made if 2 of 3 criteria are met.4 The fact that there are 3 major criteria makes PCOS a heterogeneous disease. The search for PCOS-susceptible genes has been focused mainly on polymorphisms of genes encoding sex hormones and regulatory proteins like follicle-stimulating hormone b (FSHB), follicle-stimulating hormone receptor (FSHR), estrogen receptor a (ESR1), and estrogen receptor b (ESR2).5-8
Various genetic markers have been implicated in the predisposition to PCOS; however, no single variant has conclusively and repeatedly been associated with the syndrome.9 Follicle-stimulating hormone (FSH) is a pituitary glycoprotein that plays an important role during folliculogenesis by promoting the proliferation and differentiation of granulosa cells and maturation and development of follicles.10 The effect of FSH is mediated by binding to a specific FSHR that is situated on the granulosa cells of the ovary.11 Because of the important role of FSHR signaling, the FSHR gene may be a candidate gene for PCOS. A previous genome-wide association study in Chinese women with PCOS identified a region on chromosome 2p16.3 that encodes the fshr gene as a reproducible susceptible locus for PCOS.12 Also, the study on European ancestry concludes that the gene products of luteinizing hormone choriogonadotropin receptor (LHCGR) and FSHR are likely to be
1
Department of Zoology GC University, Lahore, Pakistan Department of Obstetrics, Gynecology and Reproductive Sciences, Yale University School of Medicine, New Haven, CT, USA 2
Corresponding Author: Irfana Liaqat, Department of Zoology, GC University Lahore, Lahore, Pakistan. Email: [email protected]
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
2
Reproductive Sciences
important in the etiology of PCOS, regarding ethnicity.13 The FSHR gene contains 2 polymorphisms in exon 10, which are in linkage disequilibrium (LD). This leads to a change in 2 amino acids at position A370T and N680S. A370T rs6165 in the extracellular domain of FSHR is the site responsible for high affinity hormone binding.14,15 Previous genetic studies have examined the association between fshr gene polymorphism and PCOS.16-18 Earlier findings also showed an association of genomic variants of fshr gene with PCOS susceptibility. Estrogens play a significant role in the development and function of the reproductive system. The main mediators of estrogen action are 2 specific high-affinity receptors, the ESR1 and ESR2, both of which are members of the nuclear receptor superfamily and act as ligand-activated transcription factors. The ESR1 and ESR2 receptors are necessary for the proper function of the hypothalamic–pituitary–ovarian axis and are expressed in the human ovary, where ESR2 is the predominant receptor and its activation enhances folliculogenesis and ovulation.19 Furthermore, the expression of ESR2 is lower in follicles derived from women with PCOS compared with healthy women. In contrast, ESR1 expression is markedly increased in theca cells of polycystic ovaries, causing alteration in the ESR1–ESR2 ratio in PCOS and possibly abnormal follicular development.20 Based on these observations, variants of ESR1 and ESR2 may be implicated in the pathogenesis of PCOS. A number of polymorphic sites in esr1 and esr2 have been identified with the most widely studied being rs2234693 and rs9340799 polymorphism in esr1 and rs4986938 in esr2. The lhcgr gene encodes a receptor for luteinizing hormone (LH) and human chorionic gonadotropin (hCG), and mutations in lhcgr were associated with infertility.21 The effect of LH is mediated by LH receptor (LHR) which is expressed in the theca cells and granulosa cells.22 Abnormal LH signaling is believed to play a permissive role in augmenting ovarian androgen production in PCOS increasing the likelihood of anovulation.23 Studies have shown that lhb and lhr gene mutations may change the structure or function of the LH and LHR, either activating or inactivating their bioactivity, which cause anovulation, amenorrhea, and polycystic ovaries in women.24,25 There is compelling evidence for the genetic influence of lhb and lhr on the development of PCOS, although the results in different populations and loci show inconsistencies. In this study, we examine the association of genetic polymorphisms with PCOS in Pakistani women. This population has never been studied before. We posit that the putative functional significance of 11 different polymorphisms on the fshr, fshb, lhcgr, lhb, lhcgr, lhb, esr1, and esr2 genes is linked to the development of PCOS.
hospital Lahore and Lady Willington hospital, Lahore). The women were referred from clinics, hospitals, and physicians from all over the Punjab province. Written informed consent was obtained from each patient as approved by the Research Ethics Committee of the hospitals. The anthropometric data of all the patients were collected and every individual was assessed after registering their medical history. Ninety-six healthy Pakistani women from Punjab with regular menses, history of spontaneous conception, and without hyperandrogenemia (hirsutism and virilism) volunteered as controls.
Inclusion and Exclusion Criteria Inclusion of patients was based on a diagnosis of PCOS according to the Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group, 2004.4 Hence, diagnostic criteria included women who displayed 2 of the following 3 criteria: oligo- or anovulation, clinical and/or biochemical signs of hyperandrogenism, and polycystic ovary morphology. We enrolled only women who displayed polycystic ovaries by ultrasound to ensure that the phenotype was definitely PCOS. Exclusion criteria included patients treated for infertility, that is, in vitro fertilization, gonadotropins, aromatase inhibitors, clomiphene, or steroids (including oral contraceptives). Also excluded were patients receiving medications that are known to alter insulin secretion/ action or normal function of the hypothalamic–pituitary–gonadal axis in the last 6 months. Patients with any other known cause of oligomenorrhea or hyperandrogenism, that is, hyperprolactinemias, congenital adrenal hyperplasia, hypothyroidism, hyperthyroidism, Cushing syndrome, virilizing ovarian, or adrenal tumors were also excluded. The body mass index (BMI) of each patient was calculated as weight (kg)/(height in m).2
Interviews and Physical Examinations All participants completed a structured questionnaire covering family history, education level, weight and height, waist and hip circumference (WHR), patient’s medical, gynecological, and surgical history. Complete physical examination including ultrasonography was conducted. Eligible controls were genetically unrelated and were matched on the bases of age and residential area to minimize possible selection bias. Hence, all patients had the same ethnicities and similar socioeconomic status. Patients were recruited by gynecologists who had reviewed the patient’s medical records to determine that eligibility criteria were met. The patients and controls were age matched.
Genotyping and DNA Sequencing Blood Sampling and DNA Extraction
Materials and Methods Patients Ninety-six Pakistani women with known infertility were recruited from the outpatient’s infertility clinics of Obstetrics/Gynecology wards of tertiary hospitals (Sir Ganga Ram 2
Blood samples were obtained from women for biochemical assays and DNA sequencing analysis at 2 to 3 days after the start of menstruation. Blood samples for molecular genetic studies were collected in tubes containing EDTA as an anticoagulant and were stored at 4 C. Genomic DNA was then
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
Liaqat et al
3
extracted from the blood of patients with PCOS and normal controls using a standard extraction method.26
Candidate Genes We chose 6 candidate genes that have been implicated in the etiology of PCOS (Table 1). These 6 genes map to 6 distinct chromosomal locations. The common variants in 6 regions, 2p16.3, 2p21, 6q25.1, 11p14.1, 14q23.2, and 19p13.33, were analyzed. Detection of single-nucleotide polymorphism (SNP) of fshr, fshb,, lhcgr, lhb, esr1, and esr2 are shown in Table 1. The National Center for Biotechnology Information reference sequence assembly used for chromosome position, gene ID, and gene symbol is GRCh37.p5 with build 37.3. Also, following the nomenclature guidelines recommended by the Human Genome Variation Society, the coding reference position of the relevant DNA used along with the Ensemble accession file was reported in Table 1.
Polymerase Chain Reaction Analysis The sequences of the polymerase chain reaction (PCR) primers and cycling conditions are described in Table 2. Polymerase chain reaction was carried out in a total volume of 25 mL reaction mixtures consisting of 50 to 100 ng of DNA template, 10 mmol of each primer, 10 PCR buffer containing 15 mmol/L MgCl2, 10 mmol/L deoxynucleotide triphosphate (dNTP), and 5 U/mL Hot star Taq DNA polymerase (Qiagen, Hilden Germany). We used a control without DNA in order to check for contamination.
Gel Electrophoresis and Verification of PCR Products Polymerase chain reaction products were visualized by ethidium bromide staining on a 2% agarose gel (Sigma Aldrich, St. Louis, Missouri). The identities of the PCR products were verified by DNA sequencing.
Statistical Analysis A chi-square test was used to test for Hardy–Weinberg equilibrium in cases and controls by comparing the observed genotype frequencies to the expected ones. The maximum likelihood haplotype frequency estimates and standard errors were computed using the HAPLO software,27 which implements the expectation-maximization (E-M) algorithm of Dempster et al.28
Results Population Characteristics The selected anthropometric characteristics of the study population are summarized in Table 3. Women with PCOS had higher mean BMI value (31.10 + 1.47) than that of controls (30.49 + 1.66; P ¼ .001). The waist–hip ratio in PCOS was 1.16 + 0.07 and in controls 1.12 + 0.05. However, the mean age of menarche was not different among the groups. The proportion of obese women within the PCOS and control groups was 96.90% and 95.%, respectively (P < .0001).
Genotype and Allele Frequencies The genotype distribution and relative allele frequencies of all the studied polymorphism of 96 patients with PCOS and 96 controls are shown in Table 4. This table illustrates the number of relative genotypes (n), percentage of genotype (%), allele frequencies and their percentage, estimated heterozygosity, chi-square value (w2), and odd ratios (OR) at 95% confidence interval (CI) along with the P values. The genotype frequencies of all the SNPs fit the Hardy-Weinberg principle in both PCOS and controls; nonsignificant P values suggest that alleles are in equilibrium (Table 4). The LHCGR on chromosome region 2p16.3 was analyzed for rs61996318 polymorphism. The heterozygotes CA were greater in PCOS (16.6%) than in controls (7.2%; P ¼ .03).
New SNPs in lhcgr and esr1 DNA Sequencing The amplification products were purified with Qiaquick PCR purification kit and subjected for direct sequencing with either the forward or the reverse primers (Qiagen, Hilden Germany). The DNA concentration and purity were measured using an absorbance ratio of 260/280 nm by nanodrop (Thremoscientific, 2000, Waltham, Massachusetts). DNA sequencing was carried out with the Applied Biosystem, 3730xL capillary instruments at Keck Biotechnology Resource Laboratory Yale University (West Haven, Connecticut). The Sanger chemistry for this platform involves dideoxy terminators (di dNTPs) tagged with a difference fluorescent dye (Big Dye Terminators, Qiagen Inc), along with AmpliTaq polymerase. The sample undergoes cycle sequencing in a thermocycler and then the product is bead purified with Beckman Coulter Clean SEQ particles (Applied Biosystem, New Haven, Connecticut).
The lhcgr PCR product displayed a new SNP at 605þ52delT coding reference position (ensemble ENST00000294954), where there was a loss of base ‘‘A’’ in which the gene sequence changes from GCC to GAG. In the PCOS group, there were 28 homozygotic variants in this new SNP, and in the controls, there were 6 (P .001, OR ¼ 2.61, 95% CI ¼ 1.69-4.03). Heterozygotes Del/A were greater in patients (50%) than in controls (36.4%) increasing the risk of disease (P .001; Table 4). A statistically significant higher frequency of the ‘‘missing’’ allele was observed in patients versus controls (54.2% vs 24.5%). For the esr1 gene, the rs2234693 polymorphism is characterized by a T!C transition 397 nucleotides upstream in the intron. The rs9340799 polymorphism marks an A!G transition 351 nucleotides upstream in intron one. In rs2234693, the frequency of mutant allele ‘‘C’’ was 47.4% in the patients and
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
3
4
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
2100 2488
ESR2 Gonadotropin FSHB action FSHR
3972
Estrogen receptor b Follicle-stimulating hormone b subunit Follicle-stimulating hormone receptor Luteinizing hormone choriogonadotropin receptor Luteinizing hormone b
Estrogen receptor a
rs1800447 rs4002462
rs6166 rs6165 rs61996318 rs111834744
rs2234693 rs8179176 rs9340799 rs4986938 rs6169
dbSNP
14q23.2 11p14.1
6q25.1
Chr
C>T A>G
g.49189921 g.49191041 g.48941162 g.48941073
g.152163335 g.152163334 g.1521633381 g.64699816 g.30255185
c.82T>C c.16-26T>C
c.2039G>A c.919G>A c.568C>A c.605 þ 52delT
c.453-397T>C c.453-398C>T c.453-351A>G c.*1859G>A c.228C>T
Coding DNA Chromosomal Reference Position Position
19q13.33 g.49519905 g.49519997
A>G 2p16.3 A>G G>T 2p21 DEL>A
C>T C>T A>G G>A C>T
Ref SNP Alleles
Gene Mode
ENST00000221421 Missense Intron
ENST00000440973 Intron Intron Intron ENST00000557772. UTR-3 ENST00000417547. CdsSynon ENST00000406846 Missense Missense ENST00000294954 Missense Intron
Ensembl Accession
28
680 307 190
76
Trp-Arg
Ser-Asn Ala-Thr Gln-Lys
Tyr-Tyr
Protein Residue Position Change
Abbreviations: PCOS, polycystic ovary syndrome; FSHR indicates follicle-stimulating hormone receptor; FSHB, follicle-stimulating hormone b; ESR, estrogen receptor; LHCGR, luteinizing hormone chorionic gonadotropin receptor; LHB, luteinizing hormone b; dbSNP, single nucleotide polymorphism database; Chr, chromosome; UTR, untranslated region; Tyr, tyrosine; Ser, serine; Ala, alanine; Thr, threonine; Gln, glutamine; Lys, lysine; Trp, tryptophan; Arg, arginine.
LHB
LHCGR 3973
2492
2099
Gene ID Candidate Gene
ESR1
Steroid hormone
Marker Locus
Gene Symbol
Table 1. Genotyping Panel for 6 PCOS Candidate Genes.
Liaqat et al
5
Table 2. Primer, Annealing Temperature, PCR Program, and Product Size. Annealing PCR Temperature Program (35 Product ( C) Cycles) Size (nt)
Gene Name (ID)
Polymorphism Location Base rs Number Change
FSHR (2492)
rs6166
Exon 10 A>G
F: GCAAGTGTGGCTGCTATGAA R: GTGACATACCCTTCAAAGGC
55 C
rs6165
Exon 10 A>G
F: CCTGCACAAAGACAGTGATG R: TGGCAAAGACAGTGAAAAAG
55 C
FSHB (2488)
rs6169
Exon 3
F: TGTTAGAGCAAGCAGTATTCAATTTCT R: GTATGTGGCCTGAAATGTCCACTGATC
60 C
LHCGR (3973)
rs61996318
Exon G>T
F: TGATGGTGGTGGTGATGATG R: GGTTTCTAGCCAGCCAGTTG
60 C
rs111834744
Intron DEL>A
LHB (3972)
rs1800447
Exon 2 G>A
F: TGATGGTGGTGGTGATGATG R: GGTTTCTAGCCAGCCAGTTG F: GTCTCAGACCTGGGTGAAGC R: GCACAGATGGTGGTGTTGAC
ESR1 (2099)
rs4002462 rs2234693
Exon 2 A>G Intron 1 C>T
ESR2 (2100)
rs9340799 rs4986938
Intron 1 A>G UTR0 A>G
Primer Sequence
95 C 15 min, 95 C 1 min 55 C 1 min, 72 C 1 min 95 C 15 min, 95 C 1 min 55 C 1 min, 72 C 1 min 95 C 15 min, 94 C 1 min 60 C 30 sec, 72 C 1 min 95 C 15 min, 94 C 1 min 60 C 40 Sec, 72 C 1 min
231
58 C
95 C 15 min, 94 C 45 sec 58 C 45 sec, 72 C 45 sec
185
Same as for rs1800447 F: CTGCCACCCTATCTGTATC R: ACCCTGGCGTCGATTATCT
53 C
95 C 15 min, 95 C 45 sec 53 C 45 sec, 72 C 1 min
Same as for rs2234693 F: CGGCAGAGGACAGTAAAAGC R: TGAGAGTTGGGAAGGTGGAG
58 C
95 C 15 min, 94 C 45 sec 58 C 45 sec, 72 C 45 sec
577
357
379
213
Abbreviations: FSHR indicates follicle-stimulating hormone receptor; FSHB, follicle-stimulating hormone b; ESR, estrogen receptor; LHCGR, luteinizing hormone chorionic gonadotropin receptor; LHB, luteinizing hormone b; UTR, untranslated region; PCR, polymerase chain reaction; nt, nucleotide; min, minutes; sec, seconds.
Table 3. Anthropometric Characteristics of Patients and Controls. PCOS Characteristics
Mean + SD
Age BMI WHR Age of menarche Gynecological history
26.87 31.10 1.16 13.09
+ 4.42 + 1.47 + 0.07 + 1.06
n ¼ 96 Oligomenorrhea Less than 9 menses per year H/O irregular menses with weight gain Patient symptoms Infertility Weight gain Hirsutism Facial hair
Control
Confidence Level (95.0%) 0.89 0. 0.28 0.01 0.21 %
Mean + SD 26.02 + 30.49 + 1.12 + 13.07 +
3.521 1.66 0.05 1.522
Confidence Level (95.0%)
P
0.56 0.0.33 0.01 0.02
G) Exon 10
rs6165 (A>G) Exon 10
LHCGR rs61996318 (C>A) Exon
rs111834744 (D>T) Intron
LHB rs1800447 (C>T) Exon
rs4002462 (A>G) Intron
Genotype Frequencies TT CT CC C Allele T Allele E(HET) AA AG GG Allele frequency A Allele G Allele E(HET) AA AG GG Allele frequency A Allele G Allele E(HET) CC CA AA Allele frequency C Allele A Allele E(HET) TT DT DD Allele frequency T Allele D Allele E(HET) CC TC TT Allele frequency A Allele G Allele E(HET) AA AG GG Allele frequency A Allele G Allele E(HET)
Control (n ¼ 96)
n
%
n
%
w2
OR
95% CI
P
42 42 12 66 126
43.7 43.7 13.5 34.4 65.6 45
26 51 19 89 103
27.0 53.1 19.7 46.4 53.6 50
5.24
2.09
1.14-3.83
.020
29 47 20
30.2 48.9 20.8
24 47 25
25.0 48.9 26.0
0.85
1.23
0.85-1.84
.350
105 87
54.7 45.3 50.0 28.1 48.9 22.9
95 97
49.5 50.5 50.0 22.9 51.0 26.0
0.51
1.18
0.79-1.76
.470
101 91
52.6 47.4 50.0
93 99
48.4 51.6 50.0
79 16 1
82.2 16.6 1.0
89 7 0
92.7 7.2
4.28
2.73
1.16-6.70
.030
174 18
90.6 9.4 17.0 20.8 50.0 29.1
185 7
96.4 3.6 7.0 57.2 36.4 6.2
18.27
2.610
1.69-4.03
.001
88 104
45.8 54.2 50.0
145 47
75.5 24.5 37.0
80 15 1
83.3 15.6 1.0
88 8 0
91.7 8.3 0.0
2.15
3.09
0.83-11.62
.120
183 9
95.3 4.7 9.0 90.6 9.4 0.0
189 3
98.4 1.6 3.0 96.9 3.1 0.0
2.74
2.23
0.94-5.30
.090
91.1 8.9 16.0
184 8
27 47 22
20 48 28
87 9 0 175 17
22 49 25
55 35 6
93 3 0
95.8 4.2 8.0 (continued)
6
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
Liaqat et al
7
Table 4. (continued) PCOS (n ¼ 96) Polymorphism ESR1 rs2234693 (C>T) Intron 1
rs9340799 (G>A) Intron 1
rs8179176 (C>T) Intron 1
ESR2 rs4986938 (G>A) UTR-3
Control (n ¼ 96)
Genotype Frequencies
n
%
n
%
w2
OR
95% CI
P
TT CT CC Allele frequency C Allele T Allele E(HET) AA GA GG Allele frequency G Allele A Allele E(HET) CC CT TT Allele frequency C Allele T Allele E(HET)
27 47 22
28.1 49.0 22.9
43 43 10
44.8 44.8 10.4
7.90
1.84
1.22- 2.79
.005
91 101
47.4 52.6 49.0 29.2 49.0 21.9
63 129
32.8 67.2 45.0 43.8 44.8 11.5
5.74
1.68
1.12- 2.55
.010
46.4 53.6 49.0 74.0 24.0 2.1
65 127
7.66
2.97
1.40-6.34
.006
165 27
85.9 14.1 24.0
182 10
94.8 5.2 10.0
33 46 17 112 80
34.4 47.9 17.7 58.3 41.7 48.0
50 39 7 139 53
52.1 40.6 7.3 72.4 27.6 41.0
7.78
1.87
1.22-2.87
.005
GG AG AA G Allele A Allele E(HET)
28 47 21 89 103 71 23 2
42 43 11
86 10 0
33.9 66.1 45.0 89.6 10.4 0.0
Abbreviations: E(HET), expected heterozygosity value for the polymorphism, w2, chi-square; CI, confidence interval; PCOS, polycystic ovary syndrome; FSHR indicates follicle-stimulating hormone receptor; FSHB, follicle-stimulating hormone b; ESR, estrogen receptor; LHCGR, luteinizing hormone chorionic gonadotropin receptor; LHB, luteinizing hormone b; UTR, untranslated region; OR, odds ratio. a There were no statistically significant deviations from Hardy-Weinberg.
32.8% in the control group (P < .005). We also found statistically significant differences in the genotypes and allele frequencies between PCOS and control groups for rs9340799 (P < .01, OR ¼ 1.45, 95% CI ¼ 0.96-2.190, w2 ¼ 3.52). A new SNP rs8179176 was found during the screening of DNA sequencing map of esr1 gene. The heterozygotes CT were greater in patients (24%) than in controls (10.4%). The frequency of ‘‘T’’ allele was 14.1% in the patients and 5.2% in the control group (P < .006, OR ¼ 2.978, 95% CI ¼ 1.3996.340, w2 ¼ 7.657). This suggested that these genetic variants are related in the occurrence of PCOS in Pakistani women from the Punjab province. The esr2 gene was studied for polymorphism rs4986938 which is a G!A change at position 1859 in the 3 0-untranslated region of exon 8. The mutant allele ‘‘A’’ had a significantly higher frequency among the cases (41.7%) compared to the controls (27.6%) yielding an odds ratio of 1.873 (CI 1.22-2.87; P ¼ .005, w2 ¼ 7.776). The homozygous GG genotype was more frequent in controls (52.1%) than in PCOS (34.4%; P ¼ .005, OR ¼ 1.87, 95% CI ¼ 1.22-2.87; Table 4).
The FSHB gene was analyzed for SNP rs6169 T/C in exon 3. Genotype and allele frequencies were significantly different for PCOS and controls. A statistically significant higher frequency of the ‘‘T’’ allele was observed in patients than in controls (Table 4). The frequency of ‘‘C’’ (34.4% in PCOS and 46.4% in control) and ‘‘T’’ (65.6% in PCOS and 53.6% in control) allele differs significantly in PCOS and control groups (P ¼ .020, OR ¼ 1.650, 95% CI ¼ 1.093-2.489). No statistically significant differences were observed for genotype distribution and allele frequencies between PCOS and controls for fshr polymorphisms rs6165, rs6166, and lhb polymorphisms rs1800447 and rs4002462 (P > .05).
Haplotype and LD Haplotype estimation analysis of SNPs genotype data revealed that the estimated overall haplotype frequencies in PCOS and control groups differ significantly (Table 5 and Figure 1). So the null hypothesis of the 2 groups being the same in haplotype frequency distributions is strongly rejected. Four major haplotypes of fshr were present in the study population (Table 5).
Downloaded from rsx.sagepub.com at UNIV OF WINNIPEG on August 25, 2014
7
8
Reproductive Sciences
Table 5. Multi-SNP Haplotypes Distribution and Their Associations With Risk of PCOS in Pakistani Women.a Haplotype Frequencies + SEE Haplotypes FSHR AA GG GA AG LHCGR TC DC TA DA LHB AC AT GC ESR1 AT AC GT GC
PCOS
Control
Genetic Heterogeneity Test
Expected Heterozygosity
Chi-square
df
P
PCOS
Control
0.504 0.431 0.022 0.043
+ 0.036 + 0.036 + 0.028 + 0.028
0.305 0.326 0.179 0.190
+ 0.042 + 0.038 + 0.037 + 0.035
58.3
3
